ID: 1157481169

View in Genome Browser
Species Human (GRCh38)
Location 18:48054698-48054720
Sequence ACTGGAAGCTTGCAATTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157481166_1157481169 6 Left 1157481166 18:48054669-48054691 CCGCCTGGCATTTGGCTGGGAAA No data
Right 1157481169 18:48054698-48054720 ACTGGAAGCTTGCAATTTCCAGG No data
1157481167_1157481169 3 Left 1157481167 18:48054672-48054694 CCTGGCATTTGGCTGGGAAAGAA No data
Right 1157481169 18:48054698-48054720 ACTGGAAGCTTGCAATTTCCAGG No data
1157481162_1157481169 15 Left 1157481162 18:48054660-48054682 CCACGAGAACCGCCTGGCATTTG No data
Right 1157481169 18:48054698-48054720 ACTGGAAGCTTGCAATTTCCAGG No data
1157481161_1157481169 18 Left 1157481161 18:48054657-48054679 CCACCACGAGAACCGCCTGGCAT No data
Right 1157481169 18:48054698-48054720 ACTGGAAGCTTGCAATTTCCAGG No data
1157481159_1157481169 22 Left 1157481159 18:48054653-48054675 CCGTCCACCACGAGAACCGCCTG No data
Right 1157481169 18:48054698-48054720 ACTGGAAGCTTGCAATTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157481169 Original CRISPR ACTGGAAGCTTGCAATTTCC AGG Intronic