ID: 1157482251

View in Genome Browser
Species Human (GRCh38)
Location 18:48062931-48062953
Sequence GAGCAGGTGAAGGCAAAATG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 402
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 371}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157482251_1157482260 19 Left 1157482251 18:48062931-48062953 CCGCATTTTGCCTTCACCTGCTC 0: 1
1: 0
2: 2
3: 28
4: 371
Right 1157482260 18:48062973-48062995 AGGCCCTGGCATCAGTGGGATGG 0: 1
1: 0
2: 2
3: 25
4: 270
1157482251_1157482259 15 Left 1157482251 18:48062931-48062953 CCGCATTTTGCCTTCACCTGCTC 0: 1
1: 0
2: 2
3: 28
4: 371
Right 1157482259 18:48062969-48062991 ATGGAGGCCCTGGCATCAGTGGG 0: 1
1: 0
2: 1
3: 13
4: 176
1157482251_1157482257 5 Left 1157482251 18:48062931-48062953 CCGCATTTTGCCTTCACCTGCTC 0: 1
1: 0
2: 2
3: 28
4: 371
Right 1157482257 18:48062959-48062981 TCTGTTCAGGATGGAGGCCCTGG 0: 1
1: 0
2: 0
3: 20
4: 214
1157482251_1157482256 -1 Left 1157482251 18:48062931-48062953 CCGCATTTTGCCTTCACCTGCTC 0: 1
1: 0
2: 2
3: 28
4: 371
Right 1157482256 18:48062953-48062975 CAGCTCTCTGTTCAGGATGGAGG 0: 1
1: 0
2: 0
3: 13
4: 243
1157482251_1157482255 -4 Left 1157482251 18:48062931-48062953 CCGCATTTTGCCTTCACCTGCTC 0: 1
1: 0
2: 2
3: 28
4: 371
Right 1157482255 18:48062950-48062972 GCTCAGCTCTCTGTTCAGGATGG 0: 1
1: 0
2: 1
3: 22
4: 191
1157482251_1157482258 14 Left 1157482251 18:48062931-48062953 CCGCATTTTGCCTTCACCTGCTC 0: 1
1: 0
2: 2
3: 28
4: 371
Right 1157482258 18:48062968-48062990 GATGGAGGCCCTGGCATCAGTGG 0: 1
1: 0
2: 1
3: 22
4: 232
1157482251_1157482253 -8 Left 1157482251 18:48062931-48062953 CCGCATTTTGCCTTCACCTGCTC 0: 1
1: 0
2: 2
3: 28
4: 371
Right 1157482253 18:48062946-48062968 ACCTGCTCAGCTCTCTGTTCAGG 0: 1
1: 0
2: 0
3: 21
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157482251 Original CRISPR GAGCAGGTGAAGGCAAAATG CGG (reversed) Intronic
901234169 1:7658688-7658710 GACCTGGTGGAGGCAAGATGAGG - Intronic
903101025 1:21029705-21029727 GAGAAAGTGAAGGCAGAAAGGGG + Intronic
905211317 1:36376175-36376197 GAGCAGGTGAAGCCAACAGAGGG - Intronic
905301517 1:36989271-36989293 CAGCACGTAAAGGCCAAATGAGG + Intronic
905379557 1:37551535-37551557 GAGCTGGTTAAGTTAAAATGAGG + Intronic
907246655 1:53113417-53113439 GAGCAGGTGCAGGCATCCTGGGG - Intronic
907681465 1:56568134-56568156 GGGAAGGTGGAGGAAAAATGGGG + Intronic
908239237 1:62174875-62174897 GGTCAGGTGAAGGAACAATGAGG + Intergenic
909051988 1:70777197-70777219 GGGCAGGTTAATGCAAATTGAGG - Intergenic
909357132 1:74722528-74722550 GAGCAGGTCAAGGAATTATGAGG + Intronic
910100417 1:83569440-83569462 GAAAAGGAGAAGGCAAAAAGTGG - Intergenic
910155032 1:84207221-84207243 GAGCAGGGGGAGGGAGAATGGGG + Intronic
910700034 1:90063544-90063566 GTGAAGGTGGAGGCAAAATCTGG + Intergenic
911510123 1:98801194-98801216 GGGTAGGTGAAGGAAAAAGGGGG + Intergenic
911510913 1:98806554-98806576 GGGTAGGTGAAGGAAAAAGGGGG + Intergenic
912853836 1:113149636-113149658 GAGCAGGGCAAGGCCACATGAGG + Intergenic
913711908 1:121493119-121493141 GACAAGGTGATGGGAAAATGTGG - Intergenic
915571135 1:156745645-156745667 GAGAAGGTGATGGCAAAGTCAGG - Intronic
916409881 1:164536329-164536351 GAGCAGGTGAATGAGACATGAGG - Intergenic
916600641 1:166290222-166290244 GAGCAGGTGCTGCCAAGATGGGG - Intergenic
918097736 1:181348739-181348761 GAGCAGCTGAAAGCAGAATATGG - Intergenic
918696093 1:187548551-187548573 GAGCAGGTGAAGGCAAAGAAAGG - Intergenic
919248550 1:195021256-195021278 GAGTAGGTGATTGGAAAATGAGG + Intergenic
919845388 1:201639204-201639226 CAGCAGGTGAAGCCAGAGTGGGG + Intronic
920209461 1:204317416-204317438 GAGGAGGTGAAGGCTACAGGTGG - Intronic
920719197 1:208371107-208371129 GAGCAGGTGAAAGCAACCAGAGG - Intergenic
921016815 1:211199625-211199647 GAGAAAGTGGAGGCAAACTGAGG - Intergenic
923155924 1:231279388-231279410 GTGGAGGTGAAAGGAAAATGGGG + Intergenic
923277860 1:232414406-232414428 GTGCATTTGAAGTCAAAATGCGG - Intronic
1062943996 10:1446065-1446087 GAGGGGGTGAAGGAAACATGAGG + Intronic
1063972265 10:11389344-11389366 GAAAAGGGGAAGGGAAAATGTGG + Intergenic
1063982711 10:11468649-11468671 GAGGAGGTGTGGGAAAAATGCGG + Intronic
1064082901 10:12322912-12322934 GAACATGTGAAGACAAAGTGGGG + Intergenic
1064800469 10:19064954-19064976 GAGCAGATTAATGCAAATTGAGG + Intronic
1065122754 10:22544562-22544584 GAGCAGGTGTGGGCAGAAGGGGG - Intronic
1065264277 10:23958729-23958751 GAGCGAGTTTAGGCAAAATGGGG + Intronic
1065388586 10:25158429-25158451 GAGCAGCTGAAGTAAAAATATGG - Intergenic
1065804878 10:29385040-29385062 GAGGAGGGGAAAGCAAAAAGAGG - Intergenic
1065944260 10:30592742-30592764 GAGGAGGGGAAAGCAAAAAGGGG + Intergenic
1066248442 10:33608638-33608660 GAGTAGGTAAATGTAAAATGGGG + Intergenic
1067460143 10:46452220-46452242 AAGTGGGTGATGGCAAAATGGGG - Intergenic
1067627047 10:47932383-47932405 AAGTGGGTGATGGCAAAATGGGG + Intergenic
1069443852 10:68454917-68454939 GAGCAGTTGAAGATAAAATTAGG + Intronic
1070607409 10:77908510-77908532 CAGCAGGTGCTGGAAAAATGAGG - Intronic
1071929984 10:90458202-90458224 CACCAAGTGAAGGCCAAATGAGG + Intergenic
1072327932 10:94316519-94316541 GAAAAAGTGAAGGCAAACTGAGG - Intronic
1072635968 10:97178377-97178399 GATCAGATGAAGCCAAACTGAGG + Intronic
1072753555 10:98001685-98001707 AAGCAGGTGAAGGTAAACTAGGG + Intronic
1073812210 10:107164165-107164187 GATCAGGAGAAGGCAGAACGGGG - Exonic
1074625086 10:115174766-115174788 GAGCAAGTGTAGGCAAAGTAAGG - Intronic
1074989304 10:118688612-118688634 GAGCAGGTGACGCCGAAATTTGG - Intronic
1075360064 10:121823383-121823405 GAGAAGGTGAAGGTGAAGTGGGG + Intronic
1075488490 10:122846985-122847007 GAGCAGGTGAAGGTCAGATGGGG + Intronic
1075495613 10:122916281-122916303 GAGCAGGTAAAGGTCAGATGTGG - Intergenic
1075872272 10:125779566-125779588 GAGCAGGTGAAGGTCAGATGGGG + Intergenic
1076127081 10:127983757-127983779 AAGCGGCAGAAGGCAAAATGGGG - Intronic
1076255859 10:129024312-129024334 GAGCTGGTGAGGCCAGAATGAGG - Intergenic
1076290756 10:129343625-129343647 GAGCAGGTGCAGGTAGGATGGGG + Intergenic
1077644029 11:3907766-3907788 GAGCAGGTGGAGAGGAAATGAGG - Intronic
1077948883 11:6932913-6932935 GAGCAGGAGTTGGCAAAATATGG + Intronic
1078334009 11:10450187-10450209 GGGCAGGTGAAGGCAGAGCGAGG + Intronic
1078461881 11:11520653-11520675 GAGCAGGAGAAAGCTAGATGGGG + Intronic
1079251802 11:18792291-18792313 GCGCAGGTGTTGGCAACATGCGG - Intronic
1079698555 11:23515031-23515053 GAGATGATGAAGGCCAAATGGGG + Intergenic
1080040766 11:27757287-27757309 AAACAGGTGTAAGCAAAATGGGG + Intergenic
1080463195 11:32473562-32473584 GGGCAGGTCAATGCAAACTGAGG - Intergenic
1080699047 11:34628788-34628810 GTACAGGTGAAGGCAAAAGTGGG + Intronic
1080704808 11:34680435-34680457 AACCAGGTGAAGGCAGCATGTGG - Intergenic
1081005836 11:37737722-37737744 CAGAAGCAGAAGGCAAAATGTGG - Intergenic
1081995994 11:47364507-47364529 GGGCAGGAGAAGGCAAAAATGGG - Intronic
1082814415 11:57498851-57498873 GGGCAGGGGAAGGCAAAGTCAGG + Intronic
1082897416 11:58206516-58206538 GAGCATGTGAAGACAAAACAAGG - Intergenic
1082897875 11:58212427-58212449 GAGCATGTGAAGACAAAACAAGG + Intergenic
1083716542 11:64580672-64580694 GGGCAGGGGAAGGCATGATGTGG - Intergenic
1084026068 11:66450537-66450559 GAGCAGGAGAAAGAGAAATGAGG + Intronic
1085195375 11:74668595-74668617 TAGAAGGTGAAGGAAAAATAAGG + Intronic
1085399789 11:76229010-76229032 GAGCAGGTGTTGGCAAAGGGAGG + Intergenic
1086388704 11:86338167-86338189 GTGGAGGGGAAGGGAAAATGAGG - Intronic
1087008059 11:93488310-93488332 GAGCAGCAGAGGGCAAGATGGGG + Intronic
1087019086 11:93584526-93584548 GAGCTGGTTAAGTTAAAATGAGG + Intergenic
1087915421 11:103804332-103804354 GGCCATATGAAGGCAAAATGAGG + Intergenic
1088439506 11:109853795-109853817 AATCAGGAGAAAGCAAAATGTGG - Intergenic
1088834456 11:113566311-113566333 GAGGAGGCTAAGGCAAAGTGGGG + Intergenic
1088975875 11:114816094-114816116 GAGCAGGAGATGGCCAGATGTGG - Intergenic
1089106596 11:116012029-116012051 GGGCAGGGGTAGGAAAAATGAGG - Intergenic
1089139060 11:116271968-116271990 GAGGAGGTGAGGGCAAGATTTGG - Intergenic
1089742798 11:120596666-120596688 GAGTATGTGTAGGGAAAATGAGG + Intronic
1090053414 11:123401120-123401142 GAAGAGATGAAGGCAGAATGAGG + Intergenic
1090695318 11:129235313-129235335 GAGCAGGTAAAGTCAACGTGGGG - Intronic
1092128770 12:6093809-6093831 TGGCAGGTGAAGGCAGAGTGTGG + Intronic
1092295028 12:7190390-7190412 GAGCTGGTGGAGGCCGAATGCGG + Exonic
1092914680 12:13179308-13179330 GAGCAGGAGAGAGCAAAAGGAGG - Intergenic
1092939176 12:13391333-13391355 GAGGGGGTCAAGGCAAGATGTGG + Intergenic
1094861426 12:34470549-34470571 GAGCTCATTAAGGCAAAATGTGG - Intergenic
1096120552 12:49086721-49086743 AAGGAGGTGAAAGCATAATGGGG - Intergenic
1096538652 12:52290860-52290882 GAGCTTGTGAAGGAAAAGTGTGG - Intronic
1096540125 12:52302500-52302522 GAGCTTGTGAAGGAAAAGTGTGG + Intronic
1096602071 12:52736454-52736476 GATCTGGTGAAGGAAAAATGAGG - Intergenic
1097284124 12:57864735-57864757 GTGCAGGAGAAGGCAGAATCAGG + Intergenic
1097365878 12:58711841-58711863 GAGCAGGGTAAGGGAAAATAGGG - Intronic
1098495764 12:71133845-71133867 GAGCAGATGGAAGCAACATGAGG - Intronic
1098587698 12:72173547-72173569 GAGCACGTGCAGGAACAATGCGG - Intronic
1099117591 12:78647160-78647182 GAGAAGGGCAAAGCAAAATGGGG + Intergenic
1099465980 12:82988559-82988581 GCACAGTTGAAGGCAGAATGAGG + Intronic
1099536147 12:83847326-83847348 GACCAGGTGAAGAAAAAAAGTGG - Intergenic
1100726930 12:97418556-97418578 GAGCAGGTGAAAGCAGAGTGTGG + Intergenic
1100811092 12:98339029-98339051 GGGCAGGTGAAAGAAAAATGTGG + Intergenic
1102551334 12:113694331-113694353 GAGGAGGGGAAGGGAAAATGAGG - Intergenic
1102876093 12:116449918-116449940 GAGCTGGTTTAGGCAAAATGAGG - Intergenic
1102891156 12:116559518-116559540 GGCCTGGTGAAGGCAAAGTGGGG + Intergenic
1103176845 12:118871742-118871764 GAGGAGGAGAAGGCAGCATGGGG - Intergenic
1103879006 12:124151693-124151715 GGGCAGGTTAATGCAAATTGAGG + Intronic
1104625260 12:130348006-130348028 GAGCAGGGGTTGGCAAATTGTGG - Intronic
1105518742 13:21113104-21113126 GAGCAGGAGAAGGGGCAATGGGG - Intergenic
1105823982 13:24105772-24105794 GAGCTGATTAAGGAAAAATGAGG + Intronic
1106373603 13:29161895-29161917 GAGCATGTGCAGGCAGACTGGGG - Intronic
1108216774 13:48193230-48193252 GAGCTGGGGGAGGAAAAATGAGG - Intergenic
1109886484 13:68552227-68552249 GAGAAGATGAAGGGAAAATATGG - Intergenic
1110122174 13:71895776-71895798 AAGCAGGAGTAGGAAAAATGGGG - Intergenic
1110253093 13:73402607-73402629 GAGAAGGTCAAGGCAACATGAGG + Intergenic
1110511282 13:76354498-76354520 GAGAAGGTTAAGTTAAAATGAGG - Intergenic
1111147721 13:84206209-84206231 GAGAAGGAGAAGGAAAAATAAGG - Intergenic
1111508886 13:89233754-89233776 GGACAGGTGAAGGCAAATTCTGG - Intergenic
1111962235 13:94824343-94824365 GAGCAGGGGTTGGCAAACTGTGG - Intergenic
1111992439 13:95130395-95130417 GAGCAGCAGAAAACAAAATGTGG - Intronic
1112328970 13:98462509-98462531 GAGGAGGTGCAGGCTTAATGGGG - Intronic
1112455632 13:99559904-99559926 GAGGAGGTGAAGTCAAGATGAGG + Intronic
1112508740 13:99990709-99990731 GAGCAGGAGAAGGCGAAGCGAGG - Intergenic
1113683192 13:112259395-112259417 AAGCAGGAGAAGGCAGAATTTGG + Intergenic
1113868611 13:113544770-113544792 GAGCTACTTAAGGCAAAATGAGG - Intronic
1114702293 14:24691446-24691468 GAACAGGTAAAAACAAAATGTGG - Intergenic
1115157308 14:30356049-30356071 GAGCAGGAGAAGGCAAAGGCAGG - Intergenic
1115255900 14:31401371-31401393 GAGAAGGCGAAGGGAAAGTGAGG - Intronic
1115882628 14:37937169-37937191 GAGCAGGTGCTGGTAAAAGGAGG - Intronic
1116259350 14:42602982-42603004 GGGCAGGTTAATGCAAATTGAGG + Intergenic
1119468279 14:74876666-74876688 GAGGAGGGGAAGGCAAAATTTGG - Intergenic
1120469409 14:84903607-84903629 GACCATGTGAAGGATAAATGTGG + Intergenic
1120469728 14:84907466-84907488 GAGCAGGTAAGTGCAAAATCAGG - Intergenic
1121542712 14:94740720-94740742 GAACAGGTGATGGTAAAATATGG - Intergenic
1122043636 14:99008192-99008214 CAGCAGGTGAAGCCAATCTGTGG - Intergenic
1122907741 14:104809921-104809943 GAGGTGATGAAGGTAAAATGAGG - Intergenic
1123722427 15:23071379-23071401 GAGCAGGTTAAGGGAAGAAGAGG + Intergenic
1123801640 15:23827283-23827305 GGGTAGGTGAGGGGAAAATGGGG - Intergenic
1123835205 15:24182977-24182999 GGGCAAGTCAAGGCAAATTGAGG + Intergenic
1123854901 15:24398888-24398910 GGGCAGGTCAATGCAAATTGAGG + Intergenic
1124597223 15:31101471-31101493 GAGCAGGTGCAGGCAAGCTCAGG - Intronic
1125308446 15:38350271-38350293 GAGCATGTGAGGGCAAAGTGAGG - Intronic
1126065120 15:44820519-44820541 GTGCAGGGGAAGGCAAGTTGGGG + Intergenic
1126094709 15:45080064-45080086 GTGCAGGGGAAGGCAAGTTGGGG - Intergenic
1126425666 15:48524637-48524659 GAGGGGTAGAAGGCAAAATGAGG + Intronic
1126431952 15:48595684-48595706 GAGAAGATGAAGGCACAAAGAGG - Intronic
1126753292 15:51899159-51899181 GATCATGTGAAGCCAAAATGAGG - Intronic
1126969644 15:54096034-54096056 GAGCATGTGAAGGCAACAATGGG + Intronic
1127453672 15:59139449-59139471 GAGCGGGTGAAAGGAAAGTGAGG - Intronic
1128025174 15:64429903-64429925 CAGCATGTAAAGGCAAAATGTGG - Intronic
1129044839 15:72725668-72725690 GGGAAGGGGAAGGGAAAATGGGG - Intronic
1129981172 15:79872616-79872638 GGGCAGGTCAATGCAAATTGAGG + Intronic
1130688832 15:86062674-86062696 GAGCAGGAGAAGGAAAGAGGAGG - Intergenic
1132803272 16:1764327-1764349 GAGCGGGTGGAGGCCCAATGAGG + Exonic
1135354531 16:21758182-21758204 GAGAAAGTGAAGGGGAAATGGGG - Intronic
1135453019 16:22574322-22574344 GAGAAAGTGAAGGGGAAATGGGG - Intergenic
1135956696 16:26962170-26962192 GAGCAGCTTAAGGACAAATGTGG + Intergenic
1136502616 16:30680426-30680448 GGGCAGGTGAAGGTGAAAGGAGG - Intergenic
1137742648 16:50795531-50795553 GAGCAGCTAAAGGAAAAATAGGG - Intronic
1140696864 16:77543362-77543384 GACCAGGTGAAGAGAAAAAGAGG + Intergenic
1141388738 16:83646879-83646901 TAGCAGGTGAAGGGGAAAGGGGG - Intronic
1142008424 16:87701331-87701353 GAACAGGTGAAGCCATACTGTGG + Intronic
1143547932 17:7610738-7610760 AAGCAGGTGAAGGCAAGAGCAGG + Intronic
1144049989 17:11490235-11490257 GAGAAGGTGGAGGCAAAAGTTGG + Intronic
1144444485 17:15314478-15314500 GAGCAGGTGAAGATAAACAGGGG + Intronic
1146087973 17:29847876-29847898 GGGCAGGTTAATGCAAATTGAGG - Intronic
1147344453 17:39779739-39779761 GGGCAGGTGAGGGCAAACTGTGG - Intronic
1148140289 17:45323288-45323310 GAGCAGGTGAGGGCTGGATGGGG + Intergenic
1148348703 17:46923012-46923034 GAGAAGGGGAAGGAGAAATGAGG - Intergenic
1148467676 17:47874719-47874741 GTGCAGGTGGGGGCACAATGAGG - Intergenic
1148669810 17:49402239-49402261 GCGGAAGTCAAGGCAAAATGAGG + Intronic
1148897150 17:50845612-50845634 GAGGAGGAGGAGGCAACATGAGG - Intergenic
1150547600 17:66176950-66176972 GAACAGGTGCAGGAATAATGGGG - Exonic
1152943787 17:83187106-83187128 GAACAGGAGCAGGCAAATTGGGG - Intergenic
1153197136 18:2612925-2612947 GAACAGGATCAGGCAAAATGAGG + Intronic
1153504727 18:5784918-5784940 GACCTGATAAAGGCAAAATGAGG + Intergenic
1153527820 18:6014549-6014571 TAGCAGGGGATGGCAAAGTGAGG + Intronic
1153607439 18:6848323-6848345 GAGAAGATAAAGGCAAAATGAGG - Intronic
1155262944 18:24062284-24062306 GAGCAGGGAAAGGGAAAAGGAGG + Intronic
1155583971 18:27343671-27343693 AGGCAGCTGCAGGCAAAATGTGG + Intergenic
1156191030 18:34720539-34720561 GAGAAGGGAAAGGCAAAATCTGG + Intronic
1156718732 18:40044046-40044068 GAACAGGTAAAGGCAAAAGCTGG + Intergenic
1157482251 18:48062931-48062953 GAGCAGGTGAAGGCAAAATGCGG - Intronic
1157686078 18:49643952-49643974 GAGCTGGGGGAGGGAAAATGGGG - Intergenic
1159433484 18:68385244-68385266 CAGCAGGTGAAGAGAGAATGAGG - Intergenic
1160981424 19:1818297-1818319 GAACAGGTGGAGAGAAAATGAGG + Intronic
1161577398 19:5062032-5062054 GAGCAGGTGCAGGCCCCATGGGG - Intronic
1161624666 19:5319474-5319496 GACCAGGTGAAGGCAAAGGTGGG - Intronic
1163447001 19:17352800-17352822 GAGCAGGAGCAGGCAAAAGAGGG - Intronic
1167651477 19:50732238-50732260 GAGGTGGTGAAGGTTAAATGGGG - Intergenic
1168526068 19:57089769-57089791 GAGGTGATGAAGGTAAAATGAGG + Intergenic
927139881 2:20122665-20122687 GAGCCAGTGAAGGCACAGTGAGG + Intergenic
928079512 2:28297132-28297154 GAGTAGGAGAAGGCAATGTGGGG + Intronic
929250790 2:39752902-39752924 GAGCAGGGGAAGGCAGAGGGAGG - Intronic
930184353 2:48397023-48397045 GTGCAAGTGAAGGCAGAAAGTGG - Intergenic
931326722 2:61233415-61233437 AAACAGATGAATGCAAAATGTGG + Intronic
931565638 2:63613329-63613351 GAGCAGGAGCAGGGAAAAGGAGG + Intronic
931965433 2:67528671-67528693 GTGCAGGTTAATGCAAATTGAGG - Intergenic
932708430 2:74045331-74045353 CAGCAGGTGAAAGCATGATGAGG - Intronic
932748645 2:74356562-74356584 AAACAGGTGAATGCAAATTGTGG + Intronic
932856014 2:75234736-75234758 CAACAGGTGAGGGCAAAATAGGG + Intergenic
932964078 2:76450098-76450120 CAGAAGGTGAAGCCAAAAGGTGG + Intergenic
933521934 2:83384776-83384798 TAGCAGGTGAATACAAAATTTGG + Intergenic
933609819 2:84422296-84422318 GAGGAGGTGAAGGAATACTGGGG - Intergenic
935175227 2:100643103-100643125 GAGGTGGTTAAGGTAAAATGGGG - Intergenic
936276281 2:111100547-111100569 TAGGACGTGAAGGCAACATGTGG - Intronic
936285066 2:111175383-111175405 GAGAAGGATAAAGCAAAATGTGG + Intergenic
936960223 2:118065571-118065593 GGGCTGTGGAAGGCAAAATGTGG - Intergenic
937580673 2:123483892-123483914 GAGCAGGTGACGGCAGGTTGGGG + Intergenic
938069172 2:128299532-128299554 CAGCAGCTGAAGGCACATTGAGG + Intronic
938141979 2:128802000-128802022 GAGAAGGAAAAGGCAAACTGTGG - Intergenic
939228199 2:139390147-139390169 GAGAAGGTGAGTCCAAAATGAGG + Intergenic
940115757 2:150206482-150206504 TAGCAGGTGGAGAGAAAATGGGG + Intergenic
944281483 2:197903331-197903353 GAGCAGGAGTAGGCAAACTGGGG - Intronic
944929520 2:204501874-204501896 GAGCAAGGGAAGCCAGAATGTGG - Intergenic
945356310 2:208843578-208843600 GTGCAGGTGGAGGGGAAATGTGG + Intronic
945372598 2:209037859-209037881 TAGCAGATGAGGGCAAAATTAGG + Intergenic
946299474 2:218813929-218813951 GAGTGGGTGTATGCAAAATGTGG - Intronic
946414137 2:219530985-219531007 TAGGAGGAGATGGCAAAATGAGG + Intronic
948525656 2:238569387-238569409 GAGCAGTTGAGGGGGAAATGGGG - Intergenic
948841991 2:240655973-240655995 CAGCAGGTTCAGGCAGAATGGGG + Intergenic
1168888289 20:1275621-1275643 GAGAATGAGAAAGCAAAATGAGG - Intronic
1169732530 20:8801909-8801931 GAGCAGATAAAGGCAAACAGAGG + Intronic
1172459591 20:35107189-35107211 GACCAGGGGCAGGGAAAATGGGG - Intergenic
1173079902 20:39855893-39855915 GAGGTGGTGAAGGCAAAGTCTGG - Intergenic
1173150834 20:40565425-40565447 GTGCAGGGGAATGCAAAGTGAGG + Intergenic
1173308103 20:41871170-41871192 GAACAGGTCAATGCAAATTGAGG - Intergenic
1173326554 20:42038775-42038797 GAGTAGGCTAAGGTAAAATGTGG + Intergenic
1174117761 20:48239129-48239151 GAGCACATCAAGGAAAAATGTGG - Intergenic
1175349007 20:58305012-58305034 GAGCTGGTGAATAAAAAATGAGG - Intergenic
1176005207 20:62858536-62858558 GAGTTGGTGAAGACAAGATGGGG - Intronic
1178763104 21:35422836-35422858 GGGGAGGTGACAGCAAAATGTGG + Intronic
1178805027 21:35832020-35832042 GAGCTGGTGAAGGTGAATTGGGG - Intronic
1179538597 21:42068602-42068624 GGGCAGGTGCAGGCAGAAAGAGG - Intronic
1180223587 21:46375791-46375813 GAGGTGGTGGAGGCCAAATGAGG - Intronic
1180717037 22:17878824-17878846 AGGTAGGTGATGGCAAAATGGGG - Intronic
1181104478 22:20565670-20565692 CAGCAGGAGAAGGAAAAGTGTGG - Intronic
1182396703 22:30041454-30041476 GAGCCGGTCAAGGCAGAGTGGGG - Intergenic
1183166246 22:36149146-36149168 GAGGAGGAGAAAGCAAATTGTGG + Intronic
1183712619 22:39514323-39514345 GGGCAGGTGAAGGCCAAAGCGGG + Exonic
1184323190 22:43759657-43759679 GAGCTGGTAAGGGCAAAATGTGG - Intronic
949120310 3:376028-376050 AAGCAGATGAAGGCAAACAGAGG + Intronic
949676277 3:6457340-6457362 GTGCAGATTAAGGGAAAATGTGG + Intergenic
949703513 3:6787142-6787164 GAACAAGTGAAGTCAACATGTGG - Intronic
950944734 3:16933481-16933503 GAGTGGGTGAAGTCAAAATGGGG - Intronic
951224377 3:20104189-20104211 CAACAGCTGAAGGCAAAAAGTGG + Intronic
953715476 3:45313572-45313594 GAGTAGGTAAAGGAAAAAGGGGG + Intergenic
953980582 3:47411044-47411066 GGGCAGGTGAAGGCACCAGGTGG - Exonic
954857003 3:53652694-53652716 GAGCAGGGGCTGGCAAACTGTGG + Intronic
955597925 3:60612012-60612034 GAGCAGGTGAGGGCTAGGTGAGG - Intronic
956932418 3:74059943-74059965 GGGAAGGAGAAGGAAAAATGTGG + Intergenic
957380748 3:79425925-79425947 GAACAGCTGAAGCCACAATGTGG - Intronic
958721095 3:97844600-97844622 CAGCAGGTATAGGCTAAATGGGG - Intronic
960623077 3:119654818-119654840 GAGAAGGAGGAGGAAAAATGAGG - Intronic
962002388 3:131312091-131312113 GGGCATGTAAAGCCAAAATGGGG + Intronic
963189876 3:142457636-142457658 GAGCATGTGAAGTTACAATGAGG - Exonic
963924255 3:150934892-150934914 GGGCAGGAGAAGGCAGAATAGGG - Intronic
964270785 3:154954045-154954067 GAGAAGGTGAAAGTAAAATGGGG - Intergenic
966993174 3:185254589-185254611 GGGCAGCTAAAGGCAAGATGGGG - Intronic
969591835 4:8126494-8126516 GTGAAGGTGATGGCAAAATCTGG - Intronic
969696389 4:8737515-8737537 GAGGAGATTAAGTCAAAATGGGG + Intergenic
970351251 4:15203747-15203769 AAGCAGGGCAAGACAAAATGTGG + Intergenic
970427691 4:15960782-15960804 GAGGTGGTTAAGGTAAAATGGGG + Intronic
971944909 4:33261857-33261879 AAGCAGGGCAAGGAAAAATGAGG - Intergenic
972378468 4:38495959-38495981 GAGCAGGGGTTGGCAAACTGTGG + Intergenic
972419158 4:38870047-38870069 GAGCAGGTGTAAGCACAGTGAGG + Intronic
975103472 4:70541322-70541344 GAGCAGGGGGAGGCAGAATGTGG - Intergenic
975486241 4:74936363-74936385 GAGCAGGAGAGGGATAAATGTGG - Intronic
975610382 4:76196928-76196950 GAGCTGATGAAGGTTAAATGAGG + Intronic
981816337 4:148834922-148834944 GAGTGGGTGAAGACAAAAAGTGG - Intergenic
982159989 4:152558691-152558713 GACCAGGGGGAGGCAAAGTGAGG + Intergenic
982572951 4:157073807-157073829 GAGAAGGAGAAGGCTGAATGTGG + Intergenic
983576215 4:169264359-169264381 GAGGGGGTTAAGGTAAAATGAGG - Intronic
983709336 4:170694665-170694687 CAGCAGGTATAGGAAAAATGGGG - Intergenic
984610362 4:181830105-181830127 GAGGATGTGATGGAAAAATGTGG + Intergenic
985136653 4:186792982-186793004 GGGCAGGTTAATGCAAATTGAGG + Intergenic
985257857 4:188087217-188087239 TAGCAGGGGTAGGCAAACTGTGG + Intergenic
985436215 4:189931696-189931718 GGGTAGGTAAAGGCAAAAGGGGG - Intergenic
988982810 5:36588414-36588436 GAGCAGGGGAGGGAAAAATTGGG - Intergenic
989093084 5:37754919-37754941 GTGCTGGTGAAGGCTAAAAGAGG - Intergenic
989525273 5:42446441-42446463 GGGCAGGTGAAGGGAAAAGTAGG + Intronic
989999566 5:50877390-50877412 GAGCAGGAGTGGGAAAAATGAGG - Intergenic
995804480 5:116036011-116036033 GAGCTGGCAAAGCCAAAATGTGG + Intronic
996486009 5:124035262-124035284 GAACAAGTGAATGCAAAATAGGG - Intergenic
997466176 5:134089585-134089607 GAGCAGGGAAAGGCATGATGGGG - Intergenic
998092982 5:139381767-139381789 AAGCAGGTGGAGGCAGAAAGCGG + Intronic
998747268 5:145275065-145275087 GAGGAGATTAAGGTAAAATGAGG - Intergenic
999433063 5:151540466-151540488 GAGCAGGAGAAGGGAGATTGAGG - Intronic
999513044 5:152272687-152272709 GAGCAGCAGAATGCAAAGTGGGG - Intergenic
999916910 5:156272770-156272792 GAGCAGGGAAAGGCAAACTGTGG + Intronic
1000096558 5:157976175-157976197 GAGGAGGAGAAGGGAAAAGGAGG + Intergenic
1000501098 5:162051621-162051643 GTGGATGTGAAGACAAAATGAGG + Intergenic
1000734843 5:164886160-164886182 AGGCAGGGGAAGACAAAATGTGG - Intergenic
1000928388 5:167221439-167221461 AAGCAGGTAAAGAGAAAATGAGG + Intergenic
1001084980 5:168693838-168693860 GAGAGGCTGAAGGCAAAATTTGG - Intronic
1002213696 5:177613035-177613057 GAGATGGTGAAGCCAGAATGAGG + Intergenic
1002850674 6:993680-993702 GTGGAGGTGAAGGAAACATGAGG + Intergenic
1003518860 6:6840606-6840628 AATCAAGTGAAGGGAAAATGAGG - Intergenic
1004767477 6:18746625-18746647 AAGCAGGTGGAGGTAAAAAGGGG - Intergenic
1006109458 6:31735940-31735962 GAGCTGGTGAAGGGACAGTGGGG - Intronic
1006342016 6:33452346-33452368 GGGCAGGGGAGGCCAAAATGGGG - Exonic
1006578785 6:35064680-35064702 GGGCAGAAGAAGGCAAAAGGAGG - Intronic
1008063983 6:47027949-47027971 TGGCAGGTAAAGGCAGAATGAGG + Intronic
1008914063 6:56767707-56767729 GAGCAGGTTAAGAGAAATTGAGG + Intronic
1009515357 6:64609411-64609433 GAGCAACTGAAGGCTAAATAGGG + Intronic
1010100489 6:72100467-72100489 GAGAAGAAAAAGGCAAAATGTGG - Intronic
1010865954 6:80976978-80977000 GGGCAGGTCAATGCAAATTGAGG - Intergenic
1011423023 6:87194484-87194506 GAGCAGAAGTAGGCAAAATCAGG + Intronic
1012929640 6:105303390-105303412 GAGAAGTTGAAGGCAGAAAGTGG - Intronic
1014159857 6:118155457-118155479 GAGCAGGAGAGGGCAAGAGGGGG - Intronic
1014240548 6:119013265-119013287 AATCAGGTGAAGGGATAATGAGG + Intronic
1015051130 6:128841751-128841773 GACAGGGTGAAGTCAAAATGAGG - Intergenic
1016187089 6:141210252-141210274 GAGTTGGTGAAGGCAACAAGGGG - Intergenic
1016569970 6:145500831-145500853 GAGCTGGTCAAGACAAACTGTGG - Intergenic
1017503746 6:155048540-155048562 GAGCAAGAGAAGGGAGAATGGGG + Intronic
1017858781 6:158376106-158376128 GAGGAGGTGCAGGGAAAAGGGGG - Intronic
1018351077 6:162959679-162959701 GAGCAAGTGTAGGAAAAAGGAGG + Intronic
1019225048 6:170502173-170502195 CAGCAGGGGAAGGAAAAAAGAGG + Intergenic
1020176861 7:5888923-5888945 GTGGCGGTGAAGGCAAAATGTGG - Intergenic
1021432914 7:20581940-20581962 GGGCAGGGCAAGGCAGAATGGGG + Intergenic
1021809829 7:24392484-24392506 GAGAAGTTGGAGGCAAGATGAGG + Intergenic
1022521620 7:31011851-31011873 CAGCAAGTGAAAGCAAAAGGAGG - Intergenic
1023857232 7:44192095-44192117 GAGCGGCTGAAGCCAAAGTGTGG + Intronic
1024134695 7:46394310-46394332 GAGAAGGTGAAGGCCAACGGTGG + Intergenic
1024300346 7:47882701-47882723 GGGCAGGAGGAGGAAAAATGTGG + Intronic
1024414754 7:49093457-49093479 GAGCTAATGAAGGCAAAGTGTGG + Intergenic
1024600045 7:50972442-50972464 CATCAGATGAAGCCAAAATGAGG - Intergenic
1025790305 7:64681948-64681970 GTCCAGGTGAAGGCAAAAAGAGG - Intronic
1026399063 7:69990543-69990565 GGGGAGGTGGAGGGAAAATGTGG + Intronic
1029081978 7:97982077-97982099 GTGGCGGTGAAGGCAAACTGTGG + Intergenic
1031136292 7:117887770-117887792 GAACAGGTATAGGCACAATGTGG - Intergenic
1031145174 7:117989532-117989554 GAGCAGGTGATGGCAAGAATGGG - Intergenic
1032238349 7:130142657-130142679 ACGCAGGTGAAAGCTAAATGAGG - Intergenic
1032374064 7:131392181-131392203 GGGTAGGTGAGGGCAAAAAGAGG + Intronic
1032635213 7:133699466-133699488 GAGTCTGTAAAGGCAAAATGAGG + Intronic
1032803049 7:135331797-135331819 AAGACGGTGGAGGCAAAATGTGG - Intergenic
1033144147 7:138856581-138856603 GAGCAGGTGGAGACATAATTAGG - Intronic
1033798127 7:144871510-144871532 GAAGAGGTTAAGGTAAAATGAGG - Intergenic
1033819172 7:145112793-145112815 GGGCAAGTGAAAGCAAAAAGGGG - Intergenic
1034340781 7:150353460-150353482 GAGCAGGAGAGTGCAAACTGAGG - Intergenic
1034775735 7:153824893-153824915 GAGAAGGTGAAGCCAAACTTTGG - Intergenic
1036088473 8:5638764-5638786 GAGAAGGTGAAGGGAAAATGAGG + Intergenic
1036639656 8:10574556-10574578 GTGCAGGTGAAAGCAAAGAGAGG - Intergenic
1037051751 8:14382469-14382491 GAGCAGGTGCAAGCTAAATGTGG + Intronic
1037317848 8:17616046-17616068 GAGTAGGTGAAGCCAGACTGTGG + Intronic
1037473987 8:19238111-19238133 GAGAGGGTGAAGGCAAAATGCGG + Intergenic
1037582650 8:20254776-20254798 ACGCAGGAGAAAGCAAAATGGGG - Intronic
1038473741 8:27846836-27846858 GAGCAGGTAATGGGAAATTGTGG + Intergenic
1038795237 8:30703779-30703801 GAGCAGGGGAAGGAAGAAGGAGG + Intronic
1039410970 8:37354851-37354873 GAGATGATGAAGTCAAAATGAGG - Intergenic
1040988394 8:53321889-53321911 GAGTAAGTGAAGGAGAAATGTGG - Intergenic
1041777287 8:61537172-61537194 GAGAAGGTAAAGGGAAGATGGGG + Intronic
1042567736 8:70129614-70129636 GAGAGGATGATGGCAAAATGTGG - Intronic
1042576935 8:70231416-70231438 GTGCAGATGAAAGCAAAATGTGG + Intronic
1042873641 8:73420385-73420407 GAGCAGATGCAGTAAAAATGTGG - Exonic
1042996930 8:74710943-74710965 GAGCAGGTTGAGTCAAAACGTGG - Intronic
1047000016 8:120564234-120564256 GAGCTGGTTAAAGCTAAATGTGG + Intronic
1047186969 8:122642455-122642477 GAGCAGCTTAAGGGGAAATGTGG - Intergenic
1048397149 8:134024614-134024636 GAGAAGGGTAAAGCAAAATGGGG - Intergenic
1048987579 8:139743034-139743056 GAGCAGGGGAGGAGAAAATGTGG + Intronic
1049272914 8:141705568-141705590 GAGCAGATGATAGGAAAATGGGG + Intergenic
1049310921 8:141933495-141933517 GAGCACGTGCAAGCAAGATGGGG - Intergenic
1051830256 9:21268027-21268049 GAGCAGGAGAAAGCAAAAAGAGG - Intergenic
1052730655 9:32281284-32281306 GAAGAGGTGAAGGCAATAAGGGG + Intergenic
1053266344 9:36717056-36717078 GAGGAGGTGAAGGGATCATGGGG - Intergenic
1054799728 9:69335365-69335387 GGGCAGGTGACTGCTAAATGGGG + Intronic
1054812501 9:69446135-69446157 GTCCAGGTGCAGGCAAAAAGGGG + Intronic
1055076762 9:72223147-72223169 GAGCAGGAGAGGGAAAAACGTGG - Exonic
1055363224 9:75517570-75517592 GGGCAGGGGAACCCAAAATGTGG + Intergenic
1055678844 9:78693762-78693784 GAACAGCTGAAGGCAATATATGG + Intergenic
1056664911 9:88573652-88573674 GAGCAGGAGGAGGGGAAATGGGG + Intronic
1057145922 9:92759601-92759623 GAGCAGGAGAGGGCCCAATGTGG - Intronic
1060771769 9:126337156-126337178 GAGGAGGGGGAAGCAAAATGGGG - Intronic
1061533116 9:131230101-131230123 GAGCAGGGGAAGGAAAATAGTGG + Intronic
1061799685 9:133107038-133107060 GAACAGATGAAGCCAAAGTGGGG + Intronic
1062411936 9:136430100-136430122 GAGCAGGAGAAGGCAGGAAGGGG - Intronic
1062636581 9:137494697-137494719 GAGCAGGTGAAGGCACAGAGTGG - Intronic
1185652825 X:1661253-1661275 GAGCAGGTGCAGGCACTAGGGGG - Intergenic
1186379627 X:9044222-9044244 GAGGAGATGGAGGCAAAATTAGG + Intronic
1187050906 X:15694910-15694932 GAGAATGTGAGGGGAAAATGCGG + Intronic
1189405783 X:40721372-40721394 GAGCCGGTGATGGCCAAAGGGGG + Intronic
1189842227 X:45092853-45092875 GAACAGATGAAGGCTAAATTGGG + Intronic
1190554767 X:51623081-51623103 GGGCAGGTCAATGCAAATTGAGG + Intergenic
1190596148 X:52053918-52053940 GAGAAGGAAAAAGCAAAATGAGG - Intronic
1190612676 X:52200155-52200177 GAGAAGGAAAAAGCAAAATGAGG + Intronic
1191188715 X:57641143-57641165 CAGCAGGCAAAGGGAAAATGAGG - Intergenic
1192336298 X:70223132-70223154 GAGCAGGGAATGGCAAAATCTGG + Intergenic
1195206478 X:102604614-102604636 GAGCTGTTGAAGGCACAGTGGGG - Intergenic
1195389221 X:104343689-104343711 GGGCAGGTTAATGCAAATTGAGG + Intergenic
1195427316 X:104748970-104748992 TAGAAGGAGAAGGCAAATTGAGG + Intronic
1195826025 X:109001641-109001663 CAGCAGGGGAAGGGAAAAAGGGG + Intergenic
1196909819 X:120474056-120474078 GAGTAGGGAAAGGAAAAATGGGG - Intergenic
1196938428 X:120752425-120752447 GAGAAGCTGAAGGCAAGGTGAGG + Intergenic
1197898366 X:131341710-131341732 GTGCAGGTGAAGGAACACTGTGG + Intronic
1198059321 X:133028761-133028783 GAGAAAGTGAAGGCACTATGTGG + Intronic
1200233860 X:154458942-154458964 GAGGAGGTGAAGACAGGATGTGG + Intronic
1201557855 Y:15283311-15283333 GAGGAAGTTAAGGCACAATGAGG - Intergenic