ID: 1157482695

View in Genome Browser
Species Human (GRCh38)
Location 18:48065754-48065776
Sequence CAGGTAGCTGCGGCATCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 124}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157482684_1157482695 27 Left 1157482684 18:48065704-48065726 CCTGACCTCTCGCCCTGGCTCTG 0: 1
1: 0
2: 0
3: 48
4: 470
Right 1157482695 18:48065754-48065776 CAGGTAGCTGCGGCATCCCAGGG 0: 1
1: 0
2: 0
3: 14
4: 124
1157482692_1157482695 -10 Left 1157482692 18:48065741-48065763 CCATGAGGTCACACAGGTAGCTG 0: 1
1: 0
2: 1
3: 32
4: 248
Right 1157482695 18:48065754-48065776 CAGGTAGCTGCGGCATCCCAGGG 0: 1
1: 0
2: 0
3: 14
4: 124
1157482688_1157482695 14 Left 1157482688 18:48065717-48065739 CCTGGCTCTGGTGTGAAGCAGCC 0: 1
1: 0
2: 2
3: 27
4: 247
Right 1157482695 18:48065754-48065776 CAGGTAGCTGCGGCATCCCAGGG 0: 1
1: 0
2: 0
3: 14
4: 124
1157482691_1157482695 -7 Left 1157482691 18:48065738-48065760 CCTCCATGAGGTCACACAGGTAG 0: 1
1: 0
2: 0
3: 32
4: 243
Right 1157482695 18:48065754-48065776 CAGGTAGCTGCGGCATCCCAGGG 0: 1
1: 0
2: 0
3: 14
4: 124
1157482687_1157482695 15 Left 1157482687 18:48065716-48065738 CCCTGGCTCTGGTGTGAAGCAGC 0: 1
1: 0
2: 1
3: 41
4: 224
Right 1157482695 18:48065754-48065776 CAGGTAGCTGCGGCATCCCAGGG 0: 1
1: 0
2: 0
3: 14
4: 124
1157482686_1157482695 22 Left 1157482686 18:48065709-48065731 CCTCTCGCCCTGGCTCTGGTGTG 0: 1
1: 0
2: 1
3: 17
4: 202
Right 1157482695 18:48065754-48065776 CAGGTAGCTGCGGCATCCCAGGG 0: 1
1: 0
2: 0
3: 14
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157482695 Original CRISPR CAGGTAGCTGCGGCATCCCA GGG Intronic
900458607 1:2789576-2789598 GAGATCGCTGCAGCATCCCACGG + Exonic
900551040 1:3255701-3255723 CAGATAGCTCTGGCATCCAAGGG - Intronic
900972368 1:5998651-5998673 CAGGTATCTGCTGCATCCGGTGG + Intronic
902481673 1:16715409-16715431 CACGCTGCTGGGGCATCCCAGGG - Intergenic
902809098 1:18878149-18878171 CTGTTAGCTGCTGCTTCCCACGG - Intronic
903339338 1:22644112-22644134 CAGGCTGCTACGGGATCCCAGGG + Exonic
904919591 1:33996608-33996630 CAGGCAGCTGGGGCATCCAAAGG + Intronic
907181340 1:52572979-52573001 CAGTTAGCTAGGGCACCCCAGGG + Intergenic
913338933 1:117737492-117737514 CAGGTAGCTGGGACCACCCATGG + Intergenic
917796800 1:178538543-178538565 CATGTCGCTGCCCCATCCCACGG - Intronic
922877605 1:228952131-228952153 GAGGTCTCTGAGGCATCCCAAGG - Intergenic
923080410 1:230647994-230648016 CAGCTAACTGGGGCAACCCAGGG + Intronic
1063480999 10:6376367-6376389 CAGGTGCCTGCTGCATCCCTGGG - Intergenic
1067432707 10:46254437-46254459 CAGGGATCTGCAGCATCCTAGGG - Intergenic
1067440561 10:46307046-46307068 CAGGGATCTGCAGCATCCTAGGG + Intronic
1068008838 10:51422326-51422348 CACCTAGCTGTGGCATCCTATGG - Intronic
1072296264 10:94012072-94012094 CAGGAAGCTGCACCGTCCCAGGG + Intronic
1074087812 10:110221919-110221941 GAGGTAGCTGCCGCCTCCCAGGG - Intronic
1074311558 10:112327308-112327330 CAGGTTGCTGTGGGAGCCCAGGG + Intergenic
1077241987 11:1515480-1515502 CAGGTAGCTGGTGCATTCCCCGG + Intergenic
1083353896 11:62050933-62050955 CAGGCAGGTGTGGCAGCCCAAGG + Intergenic
1091144079 11:133261985-133262007 CAGGTAGCTGGAGCCACCCACGG - Intronic
1102172301 12:110851624-110851646 CAGGAAGGTGTGGCTTCCCATGG + Intronic
1102648293 12:114418140-114418162 CAGGTAGCTCAGGCATCCTTGGG - Intergenic
1104795344 12:131513323-131513345 CAGCAAGGTGAGGCATCCCAGGG + Intergenic
1107810246 13:44193691-44193713 CAGGTGGCTGGGGCCTTCCAGGG + Intergenic
1112617436 13:101019639-101019661 CAGGAAGCTGTTGCATACCAAGG - Intergenic
1112626275 13:101107672-101107694 CAGGTTGCTGCAGTGTCCCATGG - Intronic
1116262884 14:42653848-42653870 CAGTAAGCTACGGCATCTCATGG - Intergenic
1121458434 14:94054555-94054577 CAGGTAGGTGCCGCTTACCATGG - Intronic
1121533976 14:94678341-94678363 CAGGTCTCTGCGGCACCCAACGG - Intergenic
1122883315 14:104699716-104699738 CAGGGAGGAGGGGCATCCCAAGG + Intronic
1124005721 15:25793965-25793987 GAGGTAGCTGCTGTATCCCTGGG - Intronic
1125717666 15:41828237-41828259 CCGGTGTCAGCGGCATCCCAGGG - Intronic
1127293639 15:57591753-57591775 CAGGGCGCTGCGCCCTCCCAGGG - Intergenic
1129737027 15:77972278-77972300 CAGGTAGCAGGGCCCTCCCAAGG + Intergenic
1130435011 15:83889316-83889338 CAGGTGCCTGTGGCATCCCAGGG + Intronic
1130872562 15:87982875-87982897 CTGGTAGCTCCAGAATCCCAAGG - Intronic
1133789995 16:9002232-9002254 GATGTGGCTGTGGCATCCCAGGG + Intergenic
1139241343 16:65395458-65395480 CAGGCAGCAGCAGCATCACATGG + Intergenic
1140391749 16:74593067-74593089 CAGCTTGCTGCATCATCCCATGG - Intronic
1141135549 16:81462856-81462878 CAGGGAGGTGAGGCAGCCCAAGG - Intronic
1142238406 16:88934114-88934136 AAGGGAGCTTCGGCATGCCAGGG - Intronic
1142747796 17:1968666-1968688 CAGGAAGGAGGGGCATCCCAGGG - Intronic
1143994584 17:10995693-10995715 CAGGTAGCTGCAGCTTCCAATGG - Intergenic
1145782708 17:27573655-27573677 AAGGTAGCTGCTGTATCCCAAGG + Intronic
1148773291 17:50079156-50079178 CAAGTGGCTGCTGTATCCCACGG + Exonic
1149788593 17:59457413-59457435 CAGGTGGCTGCAGCATGCCATGG + Intergenic
1152070553 17:78131879-78131901 CAGGCAGCTGCGGGAGCCCGCGG + Exonic
1152558825 17:81067815-81067837 CAGGCAGCCCCGGCATCTCAGGG - Intronic
1152648872 17:81482797-81482819 CAGGTGTCTGCGGCTCCCCAGGG + Intergenic
1157482695 18:48065754-48065776 CAGGTAGCTGCGGCATCCCAGGG + Intronic
1157542846 18:48524491-48524513 GAGGTAGCTGCAGGATCTCATGG - Intergenic
1158871571 18:61693225-61693247 CAGATGGCTGCTGCATCCCCAGG - Intergenic
1161556261 19:4944448-4944470 CAGGTACCTGCAGCGTCCCGGGG + Exonic
1161978553 19:7619201-7619223 CAGGCAGCTGCCGCCTCCCTGGG - Intergenic
1163182343 19:15613493-15613515 CAGCTGGGTGCCGCATCCCATGG + Intergenic
1163263804 19:16206493-16206515 CAGAGAGCTGTGGCATCCCCAGG + Intronic
1163745767 19:19046010-19046032 GAGGTATCTGAGGCTTCCCAAGG + Intronic
1167153409 19:47723112-47723134 CAGGGAGCTGTGGGAGCCCAGGG - Intronic
1168343571 19:55640054-55640076 GATGTAGCTGTGGCACCCCAGGG + Intronic
1202715712 1_KI270714v1_random:41321-41343 CACGCTGCTGGGGCATCCCAGGG - Intergenic
925278846 2:2669191-2669213 CAGGTAGCTGCTGCAGGGCAGGG + Intergenic
926683029 2:15678291-15678313 CAGGTAGCAGCCCCTTCCCAGGG - Intergenic
927466288 2:23339299-23339321 CAGAAAGCTGCTGCATACCATGG + Intergenic
928149200 2:28810932-28810954 CAGGTACCTGCGGAAGCCCGGGG - Exonic
928181859 2:29073607-29073629 CCGGGAGCTGCTGCAGCCCATGG - Exonic
929412362 2:41711378-41711400 CATGTGGCTGCTGCATCTCAGGG - Intergenic
932453546 2:71831588-71831610 CAGGCATCTGGGGCTTCCCATGG - Intergenic
932859412 2:75274386-75274408 CAGGCAGCTGGGCCTTCCCATGG + Intergenic
938790491 2:134671543-134671565 CAGAGAGCTGTGGCATCCCTGGG - Intronic
942684712 2:178519211-178519233 CAGGTGGCTTAGACATCCCAAGG + Intergenic
944637990 2:201693091-201693113 CAGATAGCTGGGGCATGCCATGG + Intronic
948363095 2:237436497-237436519 CAGGCAGCGGCGCCATCCTAAGG + Intergenic
948616389 2:239202036-239202058 CAGGCATCTCCAGCATCCCAGGG + Intronic
1170443442 20:16401354-16401376 CAAGTAACTGCAGCATCCCCTGG + Intronic
1172039189 20:32031629-32031651 CAGAAAGCTGCGGCGTCCCGGGG - Exonic
1173046639 20:39518872-39518894 CAGATGGCTGGGGAATCCCAAGG + Intergenic
1174597296 20:51694037-51694059 CTGGAAGCTGCGGCTTCCCGTGG - Exonic
1175089303 20:56488846-56488868 CAGGCAGCTGCGACAGGCCAGGG - Intronic
1175862564 20:62158023-62158045 CAGGTAACTGCCCCCTCCCAAGG - Intronic
1176205550 20:63886182-63886204 CAGGTGGTTGCTGCATCTCAGGG + Intronic
1176378279 21:6097882-6097904 CTTCTTGCTGCGGCATCCCAAGG + Intergenic
1179745193 21:43440365-43440387 CTTCTTGCTGCGGCATCCCAAGG - Intergenic
1181137516 22:20779002-20779024 CTGGGAGCTCAGGCATCCCAGGG - Intronic
1182024308 22:27105749-27105771 CAGATAGCAGCGGCTTCCCAAGG + Intergenic
1184351195 22:43945335-43945357 CAGGAAGTAGCGGCATCCCCTGG - Intronic
1184419508 22:44371482-44371504 CTGGTGGCTGCGGCATCCCTGGG - Intergenic
1185015859 22:48342202-48342224 CAGGCAGCTGAGGCACCCCCGGG + Intergenic
951898403 3:27632974-27632996 CAGGTAGCTGAGGCCGGCCATGG - Intergenic
954918490 3:54168859-54168881 CCTGTAGGTGCCGCATCCCAGGG + Intronic
956878693 3:73489061-73489083 CAGGTATCTCCCCCATCCCAAGG - Intronic
956928829 3:74019455-74019477 CAGGAGGCTGAGGCATTCCAGGG - Intergenic
962581376 3:136800915-136800937 CAAGTAGCTGTGGCATTACAGGG + Intergenic
968891286 4:3370103-3370125 CAGGAAGCTGTGGCTTGCCAGGG - Intronic
972306806 4:37838617-37838639 CAGGTAGATGCAGCACCCCTAGG + Intronic
985759462 5:1737652-1737674 CAGGGAGCTCCAGCCTCCCAGGG - Intergenic
987038169 5:14038347-14038369 CAGGCAGCTGCTGCATCGCGGGG - Intergenic
987182608 5:15384205-15384227 CGGGTAGCTGAGGGATGCCAGGG + Intergenic
990447549 5:55906555-55906577 CGGATAGCTGGGTCATCCCATGG + Intronic
997268011 5:132508892-132508914 CAGGTAGCTGCTTCAGCCCTGGG - Intergenic
999284423 5:150385758-150385780 CAGGTAGGAGGGGTATCCCAGGG + Intronic
1001999878 5:176191652-176191674 AAGGGAGCTGGGGCTTCCCAGGG + Intergenic
1003965502 6:11248807-11248829 CAGGTAGCAGAGCCATCCCAGGG - Intronic
1005021653 6:21424194-21424216 CAGGAAGATTAGGCATCCCATGG - Intergenic
1007729049 6:43934752-43934774 CAAGCAGCTGCTCCATCCCAGGG + Intergenic
1007985307 6:46201899-46201921 CTTGTAGCTGGGGCTTCCCAGGG - Intergenic
1012893540 6:104923692-104923714 CAGGTAAGTGGGTCATCCCAAGG + Intergenic
1013334697 6:109144002-109144024 TAGATAGATGCGGTATCCCATGG + Intronic
1016994280 6:149950630-149950652 CAGGACGCTGCTTCATCCCAAGG + Intergenic
1017004034 6:150016778-150016800 CAGGACGCTGCTTCATCCCAAGG - Intergenic
1018765704 6:166931576-166931598 CCGGTAGCTGAGGGGTCCCAGGG - Intronic
1019571993 7:1717264-1717286 CAGGTACCTGGAGCAGCCCATGG + Intronic
1024003562 7:45208664-45208686 CAGGAAGCTGGGGCATCCTAGGG + Intergenic
1028605597 7:92651861-92651883 CAGGGAGCTGGGGCACTCCAAGG + Intronic
1030344513 7:108417341-108417363 CTTGTAGTTGCGTCATCCCATGG + Intronic
1036228087 8:6976883-6976905 CAGGGGGCTGAGGCAGCCCAGGG - Intergenic
1036230540 8:6996000-6996022 CAGGGGGCTGAGGCAGCCCAGGG - Intergenic
1036232989 8:7015103-7015125 CAGGGGGCTGAGGCAGCCCAGGG - Intronic
1036262791 8:7253595-7253617 GAGGTCGCTGCGGCTTTCCACGG + Intergenic
1036314831 8:7712134-7712156 GAGGTCGCTGCGGCTTTCCACGG + Intergenic
1037516895 8:19641082-19641104 CAGGTAGATTCCGCATCCCTGGG - Intronic
1039472998 8:37825787-37825809 CAGGCAGCATCGGCTTCCCATGG + Intronic
1039723740 8:40193012-40193034 CAGGGTGCTGCTGCAACCCAGGG - Intergenic
1040487714 8:47889540-47889562 CAGGACACTGCTGCATCCCAGGG + Intronic
1046098947 8:109592582-109592604 CAGGTAGCTGAGCCAGCCCAAGG - Intronic
1047174166 8:122524636-122524658 CATGTATCTGGGGCACCCCATGG - Intergenic
1047406150 8:124587213-124587235 CAGGCATCTGCTGCATGCCAGGG - Intronic
1049198665 8:141329406-141329428 CTGGGCTCTGCGGCATCCCAGGG + Intergenic
1049570380 8:143367590-143367612 CAGATGGCTGCGGCAGACCACGG + Intergenic
1055787321 9:79884617-79884639 AGGGAAGCTGCGGCATCCCAGGG + Intergenic
1057864453 9:98667946-98667968 CAGGGAGCTGCCTCATCCCACGG + Intronic
1057919909 9:99088416-99088438 CCCGTAGCTGAGCCATCCCATGG + Intergenic
1059161556 9:112039816-112039838 CATGTAGCTGCTCCACCCCAGGG - Intergenic
1061791321 9:133060781-133060803 CAGGTGGCTGGGGCGCCCCAGGG - Intergenic
1061794999 9:133081348-133081370 CAGGTGGCTGGGGCGCCCCAGGG - Intronic
1061852745 9:133425454-133425476 CAGGCAGCTGCTGACTCCCAGGG - Intronic
1185621520 X:1453482-1453504 CAGGCAGCTGCGGGGTCCCGGGG + Intronic
1186189685 X:7056353-7056375 CAGGTGGCAGCGCCATCCCCTGG - Intronic