ID: 1157483652

View in Genome Browser
Species Human (GRCh38)
Location 18:48072405-48072427
Sequence GCCAATGGATGCAGCCACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 171}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157483652_1157483660 19 Left 1157483652 18:48072405-48072427 CCTGGGTGGCTGCATCCATTGGC 0: 1
1: 0
2: 0
3: 18
4: 171
Right 1157483660 18:48072447-48072469 AACCCCAGCTCACCTTTCCCAGG 0: 1
1: 0
2: 3
3: 26
4: 264
1157483652_1157483656 -8 Left 1157483652 18:48072405-48072427 CCTGGGTGGCTGCATCCATTGGC 0: 1
1: 0
2: 0
3: 18
4: 171
Right 1157483656 18:48072420-48072442 CCATTGGCCAGGTTGGCCTCAGG 0: 1
1: 0
2: 2
3: 17
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157483652 Original CRISPR GCCAATGGATGCAGCCACCC AGG (reversed) Intronic
900173986 1:1284051-1284073 GAGAATGGAAGCAGCCACACGGG + Exonic
900214883 1:1476048-1476070 GCCAAGGGCTGAAGCGACCCCGG - Intronic
900222094 1:1514402-1514424 GCCAAGGGCTGAAGCGACCCCGG - Intronic
900631574 1:3639210-3639232 GAGATTGGATGCAGCCACTCCGG + Intronic
902623737 1:17664945-17664967 GCGGATGGCTGCATCCACCCTGG - Intronic
903329598 1:22590491-22590513 GCCCATGGATGTGGCCACGCAGG - Intronic
904814161 1:33182555-33182577 GCCAATGGAGGCAGCCTCCGGGG - Intergenic
905531312 1:38681096-38681118 GGCAATGGAAGCAGCTTCCCAGG + Intergenic
907437168 1:54457352-54457374 ACCATTGGATGTGGCCACCCAGG - Intergenic
909585191 1:77281751-77281773 GCCCAGGGATGCAGCTACCGGGG - Intergenic
910251096 1:85200574-85200596 GCCGGTGGGTGCAGCCGCCCGGG + Exonic
912915263 1:113808421-113808443 ATCAATGGATTCAGCCAACCTGG - Intronic
915238704 1:154503461-154503483 GCCTATGGTTGCAGCTACTCAGG + Intronic
915511407 1:156388800-156388822 GCCAGTGGAGTCAGCCAGCCCGG + Intergenic
916624780 1:166543308-166543330 GACAATGGAAACAGCAACCCTGG + Intergenic
917380892 1:174406783-174406805 GCCTATGGTTACAGCCACTCGGG + Intronic
920306577 1:205022035-205022057 GCCCATGCAAGCTGCCACCCTGG + Exonic
920581745 1:207115415-207115437 GACAAACGATGCAGACACCCAGG + Exonic
924234798 1:241991602-241991624 GTCACTGGCTGCAGCCACCCTGG + Intergenic
1062836529 10:639549-639571 GCCACTGCATGAAGCCACGCTGG + Intronic
1063430731 10:5985843-5985865 TCCAATTGCTGCAGCCAACCTGG + Intergenic
1063581959 10:7316305-7316327 GCCAAGGGATCCAGCCAGCTGGG + Intronic
1063664500 10:8053435-8053457 GCCAGCGGCTGCAGCCACCCGGG + Intergenic
1067774600 10:49153935-49153957 GCAGATGGCTGCAGCCAGCCAGG - Intergenic
1069695351 10:70381976-70381998 GCCATTGGCTGCAGGCACCGGGG - Intronic
1070087562 10:73251949-73251971 GCCGATTGGTGCAGCCACCCAGG + Exonic
1070624668 10:78042187-78042209 CCCAACAGATGCAGCCAGCCTGG - Intronic
1073387687 10:103140619-103140641 GTAAATTGATGCAGCCACCGTGG - Intronic
1076037311 10:127210629-127210651 GTCCATGGCTGGAGCCACCCAGG - Intronic
1076321627 10:129586808-129586830 GCAGAGGGATGCAGCCACTCTGG - Intronic
1076701477 10:132275396-132275418 GCCCTTGGAGGCAGCCATCCTGG + Intronic
1081605817 11:44526534-44526556 GGCAGAGGATGCAGCCCCCCGGG + Intergenic
1081661797 11:44892944-44892966 ACCAATTGAGGCAGCCTCCCAGG - Intronic
1083319559 11:61837571-61837593 GCCAATGGCAACAGCCACCTGGG - Intronic
1084756462 11:71241966-71241988 GCCAGAGGGTGAAGCCACCCAGG + Intronic
1089276879 11:117342998-117343020 GCCTATAGATGCAGCTACCCAGG - Intronic
1091485688 12:885494-885516 ACCAAAGGATGCAGCCCACCAGG - Exonic
1092564148 12:9647751-9647773 CCCAATGGAGGCCTCCACCCGGG - Intergenic
1097196924 12:57247747-57247769 CCCAAAGGCTGCAGGCACCCTGG - Intronic
1098261167 12:68672659-68672681 GCCTGTGGTTCCAGCCACCCAGG + Intergenic
1101004363 12:100387191-100387213 GGGAATGGGTGCAGCCACCATGG - Intronic
1104371612 12:128228582-128228604 GCCCAAGGATGCAGCTTCCCTGG + Intergenic
1104727389 12:131086364-131086386 GCCCAGGAATGCAGCCTCCCAGG + Intronic
1104749671 12:131230228-131230250 GCTGATGGCTGCAGCCAGCCCGG - Intergenic
1106221241 13:27748237-27748259 TCCAATGGGTGAAGCCAGCCGGG - Intergenic
1114049750 14:18913376-18913398 GCCACTGAACACAGCCACCCTGG + Intergenic
1114112812 14:19488555-19488577 GCCACTGAACACAGCCACCCTGG - Intergenic
1117004395 14:51403994-51404016 TCCAATGGGTGCAGCCACTTTGG - Intergenic
1118575851 14:67241007-67241029 GCCAAGGGATGTAGAAACCCAGG + Intergenic
1119801680 14:77450860-77450882 GCCAAATGGTGCAGCCACCGTGG - Intronic
1122163671 14:99804932-99804954 GGCCCTGGATGCAGCCACCCTGG + Intronic
1122179905 14:99947325-99947347 GCCGATGGAGGCAGCCCTCCCGG - Intergenic
1122430344 14:101636129-101636151 GCCAAAGGAGGAAGCCACACAGG - Intergenic
1122552933 14:102559926-102559948 TCCAACTGAGGCAGCCACCCTGG - Intergenic
1122922418 14:104885509-104885531 GCCACTGGGTGCGGCCCCCCAGG + Exonic
1123103064 14:105818763-105818785 GCCAACGGAGGCAGCCGCTCAGG - Intergenic
1128721671 15:69954941-69954963 GCCTCTGGATGCAGCCAGCCTGG - Intergenic
1130235160 15:82126587-82126609 GCCATTGGATTCAGCCCCACAGG - Intergenic
1131781515 15:95864716-95864738 GTCAAGTGATGCATCCACCCTGG - Intergenic
1133102024 16:3485555-3485577 CCCAGTGAATGCAGCCACACTGG - Exonic
1133340807 16:5034601-5034623 GCAAATGGTTGCAGCAAGCCAGG + Intronic
1136272913 16:29159039-29159061 TCCAGTGGACGCAGCCAGCCGGG - Intergenic
1136576447 16:31128057-31128079 GCCAGTGGCGGCAGCCCCCCGGG + Exonic
1136648113 16:31640542-31640564 GCAAATGGGTGCAGCCATGCTGG + Intergenic
1136929205 16:34403872-34403894 GCCAAATGCTGCAGCTACCCAGG + Intergenic
1136975369 16:35007932-35007954 GCCAAATGCTGCAGCTACCCAGG - Intergenic
1138252725 16:55516227-55516249 GCCTATTGCTGCAGCCACTCAGG - Intronic
1140996143 16:80261352-80261374 GCCTATTGATTCAGCCACGCAGG + Intergenic
1141445572 16:84055618-84055640 GCCAATGGCAGCAGCCGCCCTGG - Intronic
1142076470 16:88120851-88120873 TCCAGTGGACGCAGCCAGCCGGG - Intergenic
1144499253 17:15771002-15771024 GCCCATCGATGCAGCCTCCAGGG + Intergenic
1145162644 17:20586035-20586057 GCCCATCGATGCAGCCTCCAGGG + Intergenic
1145276699 17:21435698-21435720 GTCAAGTGATGCAGCCTCCCGGG - Intergenic
1148195241 17:45708481-45708503 GGCAGGGGATGCATCCACCCAGG - Intergenic
1149526271 17:57358285-57358307 GCCCATGAATGCAACCACCCAGG - Intronic
1151252106 17:72844334-72844356 GACACTGGATGAAGCCACCAAGG - Intronic
1151674661 17:75591262-75591284 GCCCATGGGTTCAGCCACCCAGG - Intergenic
1151704698 17:75760809-75760831 GCCTTTGGTTGCAGCTACCCAGG + Intronic
1156392606 18:36664966-36664988 GCCCATGGTTGCAGCTACTCAGG + Intronic
1157286314 18:46379689-46379711 GCCAGTTCATTCAGCCACCCTGG + Intronic
1157483652 18:48072405-48072427 GCCAATGGATGCAGCCACCCAGG - Intronic
1160759867 19:778198-778220 CCCAATGGTTCCAGCCACTCAGG + Intergenic
1161721397 19:5904618-5904640 GCCAAAGGATGTGGCCAGCCTGG + Intergenic
1161854208 19:6754269-6754291 GCCCATGACTGCAGCCAGCCCGG + Exonic
1163404153 19:17112253-17112275 GCTAATGGCTGGAGCCACCGAGG + Intronic
1163697683 19:18772227-18772249 GCCAGTGGAAGCGGCCAGCCTGG + Intronic
1164619012 19:29682706-29682728 GCCACTGGCAGCTGCCACCCTGG - Intergenic
1165176008 19:33930344-33930366 CCCCAAGGCTGCAGCCACCCTGG - Intergenic
1165333900 19:35155799-35155821 CTCACTGGAAGCAGCCACCCGGG - Intronic
1166407510 19:42531598-42531620 GCCACTGGATGGGGCCACCTGGG + Intronic
1168110516 19:54189310-54189332 GCCACTGGGCGCCGCCACCCTGG + Intronic
1168308213 19:55447646-55447668 CCAAATGGATGCAGCCCCACTGG - Intergenic
925747096 2:7052605-7052627 ACCCATGCATGCATCCACCCAGG + Intronic
925836212 2:7949637-7949659 GGAAATGGCTGCAGCGACCCAGG + Intergenic
925874307 2:8298844-8298866 GCCAATGAATCAAGCCATCCTGG + Intergenic
926248985 2:11142558-11142580 GCCAAAGGGTGGAGCCACCTCGG + Intronic
926635988 2:15180548-15180570 GCCACAGGATGCGGCCAGCCAGG - Intronic
928177798 2:29046808-29046830 GCCACTGCATGCAGGCACCCAGG - Intronic
932434289 2:71694202-71694224 GCCCATGCATTCACCCACCCAGG + Intergenic
933970048 2:87462933-87462955 GACAATGGATGCTCCCCCCCAGG - Intergenic
935155866 2:100482914-100482936 TCCAATGGATGCTGCCAGCAGGG + Intronic
936323735 2:111487563-111487585 GACAATGGATGCTCCCCCCCAGG + Intergenic
937794590 2:126001875-126001897 GCCAAAGGGTACAGCCACCTTGG - Intergenic
938288475 2:130137183-130137205 GCCACTGAACACAGCCACCCTGG - Intergenic
938427109 2:131201707-131201729 GCCACTGAACACAGCCACCCTGG + Intronic
938468054 2:131535753-131535775 GCCACTGAACACAGCCACCCTGG + Intergenic
943222918 2:185133039-185133061 GCCACTGGATGAAGCCAGCTGGG + Intergenic
944805872 2:203280574-203280596 GCCTGTGGTTGCAGCCACTCGGG + Intronic
946076675 2:217079414-217079436 GCAAATGGATTTTGCCACCCAGG + Intergenic
948427057 2:237895033-237895055 GCCAATGGTGCCAGCCACCAAGG + Intronic
948733376 2:239981254-239981276 GCCCATGGATGGAGCCCCACAGG + Intronic
1170575891 20:17661190-17661212 GCCAATAAATGCTGCTACCCAGG + Intronic
1171511120 20:25685715-25685737 GCCATTTGCTGGAGCCACCCAGG + Intronic
1173682412 20:44894100-44894122 GCCACTGGATGCAGCAAGTCAGG - Intronic
1174655714 20:52170477-52170499 GCAAAGGGATTCAGGCACCCAGG + Intronic
1179545568 21:42110698-42110720 GCCCATGTTTGCAGCCTCCCCGG - Intronic
1180468227 22:15635751-15635773 GCCACTGAACACAGCCACCCTGG + Intergenic
1180605454 22:17055854-17055876 CCCAAAGGATTCAGCCACCAAGG + Intergenic
1181633690 22:24164560-24164582 GCAAGTGAGTGCAGCCACCCTGG + Exonic
1183018348 22:35008061-35008083 CACAAAGGATGCAGCCACCCTGG + Intergenic
1183117620 22:35703838-35703860 GCCAGTTGGTGCAGCCACCCAGG - Intergenic
1183189697 22:36313954-36313976 TCTAATGGAGGCACCCACCCAGG + Intronic
1183509956 22:38228925-38228947 ACCAGTTGGTGCAGCCACCCAGG - Intronic
1184356726 22:43985796-43985818 GCAAAAGGACGCGGCCACCCCGG - Intronic
949414304 3:3799546-3799568 GCCTAGGGATGCCGCCGCCCGGG - Exonic
949854747 3:8451182-8451204 GCCAATGGCTCCAGCAGCCCAGG - Intergenic
950260351 3:11538747-11538769 GCCTGTGGTTGCAGCTACCCAGG + Intronic
950486877 3:13279063-13279085 GCCGATGGCTGCATCCACCGGGG - Intergenic
950609589 3:14117378-14117400 GGCAGTGAATGCACCCACCCTGG - Intronic
951309115 3:21102211-21102233 GCCTATGGATACAGCTAACCAGG - Intergenic
954468703 3:50674255-50674277 TCCAAGGGAGGCAGACACCCAGG + Intergenic
960705397 3:120476272-120476294 GCAAATGGATCCAGGCAACCTGG - Intergenic
963588407 3:147225130-147225152 GCCAAATGATGCAGCCACTCTGG - Intergenic
964491786 3:157243916-157243938 GCCTATGGTTCCAGCCACTCAGG + Intergenic
967037107 3:185656146-185656168 CCCAAGGGCTGCAGCCAGCCAGG + Intronic
967965753 3:194959042-194959064 GTCAAGGGATGCAGGCTCCCAGG + Intergenic
975091912 4:70413878-70413900 GACAATGCATGAAGTCACCCAGG - Intergenic
976796890 4:88944225-88944247 GCCTATGGTTCCAGCTACCCAGG + Intronic
980944389 4:139304672-139304694 ACCTATGGATGCAGACACCAAGG + Intronic
986237304 5:5923887-5923909 GAAAGTGGATCCAGCCACCCTGG - Intergenic
988167169 5:27608623-27608645 GCCAGTGCATCCAGCCACACAGG + Intergenic
995012661 5:107275488-107275510 GCAAATGGATACACCTACCCTGG + Intergenic
995352212 5:111191901-111191923 GCCAATGAATGCTGAAACCCTGG - Intergenic
995828991 5:116333205-116333227 GCCACTGCATCCAGCCACCATGG - Intronic
996493667 5:124128812-124128834 GGCACTGGATTCAGCTACCCAGG + Intergenic
998920113 5:147058930-147058952 GCCAATGGATCCAGATTCCCTGG + Intronic
999132854 5:149297826-149297848 GCCAAGGGAGGCAGACACTCAGG + Intronic
1000365229 5:160484535-160484557 GCAAATGAGTGCAGCCCCCCAGG - Intergenic
1004401465 6:15292789-15292811 ACCAATGGTTCCAGCCACTCAGG - Intronic
1011555852 6:88570830-88570852 GCCACTGCATGCAGCCTGCCTGG + Intergenic
1019663328 7:2238199-2238221 GCCAGTGCATGCAGCTACCCTGG + Intronic
1023924328 7:44654661-44654683 GCCCATGGCTTCAACCACCCTGG - Intronic
1024587978 7:50857526-50857548 GCCCTTGGCTGGAGCCACCCTGG - Intergenic
1027838862 7:83281024-83281046 GATAATGCATGCAGCAACCCAGG - Intergenic
1028952999 7:96657817-96657839 CCTAATGGAGGCAGCCACCCTGG - Intronic
1029118086 7:98248229-98248251 GCTACTGGATGAAGCCACCAGGG + Intronic
1032121712 7:129161830-129161852 GCTAAAGGAGGCAGCCTCCCTGG + Intronic
1036296186 8:7540074-7540096 GCCACAGGATGCAGCCAGCATGG + Intronic
1036326380 8:7780945-7780967 GCCACAGGATGCAGCCAGCATGG - Intronic
1042157147 8:65856605-65856627 GCAAATGTATGTACCCACCCTGG - Intergenic
1042520234 8:69703697-69703719 TGCACTGGAGGCAGCCACCCTGG + Intronic
1042840724 8:73120947-73120969 GCAAATGGAGGCTGCCAACCTGG + Intronic
1046942632 8:119945789-119945811 GCCAATGGATGAAGGCACACGGG + Intronic
1048038958 8:130706716-130706738 GCCAATGAAAGCAGCCACAAGGG - Intergenic
1049382261 8:142323077-142323099 GCCCACGGATGCAGCCAGGCCGG - Intronic
1049537024 8:143187241-143187263 GCCAAGGGACGCACCCTCCCTGG + Intergenic
1049559205 8:143299822-143299844 GCCTATAGTTCCAGCCACCCAGG + Intergenic
1049772722 8:144391202-144391224 GCCAATTGCTGCCGCCAGCCTGG + Exonic
1052986795 9:34493822-34493844 GCCAATGGATTTGGCCACCCTGG + Intronic
1053459797 9:38259431-38259453 GACAATGGACACAGACACCCTGG - Intergenic
1055783215 9:79842793-79842815 GCTAATGGGTGCAGCCAGGCAGG + Intergenic
1056906544 9:90655245-90655267 GCAAAATGATGCAGCCACTCTGG + Intergenic
1057073649 9:92122465-92122487 GCAAAATGATGCAGCCACTCTGG - Intergenic
1057198970 9:93130371-93130393 GCCGGTGGATGCAGCAAGCCTGG - Intronic
1057322579 9:94028544-94028566 GCCAAAGGATGCAAACTCCCTGG + Intergenic
1057630058 9:96712470-96712492 GCCTGTGGTTGCAGCTACCCAGG + Intergenic
1059471117 9:114505377-114505399 GCCCCGGGATGCAGCCGCCCGGG + Intronic
1060603881 9:124897015-124897037 GCCACTAGCTGCAGCCACACTGG + Intronic
1061146176 9:128800160-128800182 GACAGTGGATGAAGCCATCCTGG - Intronic
1061798388 9:133101479-133101501 GCCAGTGGAGGGAGGCACCCAGG + Intronic
1186220822 X:7347488-7347510 GTCAAGAGATGCAGGCACCCCGG - Intronic
1186764628 X:12758414-12758436 GTCAGTAGCTGCAGCCACCCAGG + Intergenic
1189172747 X:38925329-38925351 GCCATTGGATGCACCAACCTTGG - Intergenic
1193308491 X:79977025-79977047 GCATATGGATCCCGCCACCCAGG - Intergenic
1193506440 X:82349776-82349798 GCCACTGGCTGCTGCCACCAGGG + Intergenic
1194520383 X:94910879-94910901 GCCTAGGAATGCAGCCAACCAGG + Intergenic
1198301690 X:135339618-135339640 GTAAATGTATGCAGCGACCCTGG - Intronic
1199301679 X:146220867-146220889 GCCCATGAATGCAGCCAGCAGGG - Intergenic
1199881728 X:151978839-151978861 GGAACTGGATGCAGTCACCCAGG + Intergenic
1200119541 X:153783856-153783878 GGCCATGGAGGCTGCCACCCAGG + Exonic