ID: 1157483961

View in Genome Browser
Species Human (GRCh38)
Location 18:48073820-48073842
Sequence TAGGGCTTTGTGCAGAAACT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 170}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157483961 Original CRISPR TAGGGCTTTGTGCAGAAACT CGG (reversed) Intronic
901269352 1:7939562-7939584 TAGGGCTTTGTGCTCCGACTGGG - Intronic
903498377 1:23787501-23787523 TGGGGCTTGCTGCAGAAACCTGG + Exonic
904997458 1:34642134-34642156 TAGGGCTTGGTGTAGAAGGTGGG - Intergenic
906009276 1:42508499-42508521 GAGGGCTTTGTGTAATAACTAGG - Intronic
906129324 1:43446725-43446747 TAGGGCCATTTTCAGAAACTGGG - Intronic
908589439 1:65613783-65613805 TAGGTTTTTGTTCAGATACTTGG - Intronic
909063937 1:70910264-70910286 TGTGGCTTTAGGCAGAAACTGGG - Intronic
913103430 1:115591516-115591538 TAGGGCTTTGACCAAAAGCTTGG - Intergenic
913405411 1:118485481-118485503 TTGGGGATTGTGCAGAGACTTGG + Intergenic
915152290 1:153843601-153843623 TAGAGCTTTATGCAGTTACTTGG - Intronic
917166294 1:172116671-172116693 TAGGGCTTTGTGGTCAAACTTGG + Intronic
918113735 1:181480288-181480310 AATGGCTTTGTGAAGAGACTTGG - Intronic
919134936 1:193495989-193496011 CATTGATTTGTGCAGAAACTGGG + Intergenic
920317865 1:205092067-205092089 TAGGGCTTTATCCAGTAACGTGG - Intronic
1063015575 10:2073648-2073670 TTTGTCTTTGTGCAGGAACTTGG + Intergenic
1064175443 10:13071334-13071356 TAGGGCTTTGAGCTGAAGTTTGG - Intronic
1066089033 10:31999635-31999657 TGGTCCTTTGTGCAGATACTGGG + Intergenic
1067183614 10:44008740-44008762 CAGGGCTTTGTGGGGAAATTTGG + Intergenic
1067399438 10:45957435-45957457 CAAGGCTTTGTCTAGAAACTTGG - Intergenic
1070601571 10:77869870-77869892 TAGAGCTAGGTTCAGAAACTGGG - Intronic
1071848401 10:89543305-89543327 GAAGGCTTTGTGAATAAACTGGG - Intronic
1074420863 10:113307918-113307940 TAGGGTTTTGAGCAGAAAGCTGG - Intergenic
1074534852 10:114321410-114321432 TAATGTTTTTTGCAGAAACTTGG - Intronic
1074806936 10:117063336-117063358 GAGGGCCTGGTGCTGAAACTGGG - Intronic
1078430391 11:11283628-11283650 TGGGGCTTCGTGCAGAGACCTGG + Intronic
1079953690 11:26836277-26836299 TATGGCTTTGTGGAGTAATTAGG - Intergenic
1080059090 11:27938155-27938177 TAGTGTTTTGTACAGAAAATAGG + Intergenic
1081744758 11:45465036-45465058 TAGGGCTTTGAGCTGTCACTTGG + Intergenic
1082610546 11:55291692-55291714 TTGGGCTTCATGAAGAAACTTGG - Intergenic
1084608889 11:70188176-70188198 AATGGCTTTGTGCAAAAACAAGG - Exonic
1085436687 11:76510644-76510666 TAGAGCTTTGTCCACAAACTGGG + Intronic
1085719739 11:78902723-78902745 TAGGGCTTTGGGCATAAAGGTGG + Intronic
1086296342 11:85372463-85372485 TAGGGCTTTGACCCGAAGCTTGG - Intronic
1087431957 11:98066338-98066360 TAGGGCTTTGACCCGAAGCTTGG + Intergenic
1088181771 11:107121170-107121192 GAGGACTTTGTGTTGAAACTTGG + Intergenic
1092585821 12:9899898-9899920 TAGGGCTTTGACCTGAAGCTTGG + Intronic
1092793297 12:12087781-12087803 TAGGGCTTTGTGAAAAAGCAGGG + Intronic
1092881716 12:12892118-12892140 AAGGGCTTTTTGCAGCATCTGGG - Intronic
1093414952 12:18909149-18909171 TGACGCTGTGTGCAGAAACTGGG - Intergenic
1097093873 12:56529788-56529810 TAGGGCTTAGTGGAGAAATAGGG + Intronic
1099460258 12:82912345-82912367 TGGGGCTCTGTGTAGGAACTTGG + Intronic
1099535015 12:83832709-83832731 TAGGGCTTTGACCTGAAGCTTGG + Intergenic
1101507412 12:105360099-105360121 TAGGACTGACTGCAGAAACTAGG + Intronic
1102057035 12:109904285-109904307 TAGGTCCTTGTGCAGGGACTGGG + Intronic
1103413050 12:120726113-120726135 TAGGGGTCTGTGCAGGAACCAGG - Intronic
1103919524 12:124392291-124392313 TTGGGGTTTCTGCAGGAACTTGG - Intronic
1104704960 12:130937049-130937071 TAGGGCTTTGTACTTAAACTGGG - Intergenic
1108642227 13:52393973-52393995 TAGGGCTGGGGGCAGTAACTGGG - Intronic
1108705370 13:52980651-52980673 AAGGGCTTTGTGCTGAAATCAGG + Intergenic
1109745321 13:66616907-66616929 TAGGGCTTTGACCTGAAGCTTGG - Intronic
1111574592 13:90135620-90135642 TGGGGCTTTGTGAAGTAATTAGG + Intergenic
1112549357 13:100404960-100404982 TAGGGCTTTGACCCGAAGCTTGG + Intronic
1114283740 14:21220110-21220132 GAGGGCTTTGTGAAGAGAATGGG - Intronic
1115523879 14:34259892-34259914 AAGGGATTTAAGCAGAAACTAGG - Intronic
1116097335 14:40387446-40387468 CAGTGCTTTGTGGAGAAACCTGG - Intergenic
1117156839 14:52950684-52950706 CGGGGCTTTCGGCAGAAACTCGG + Intronic
1120008065 14:79382439-79382461 TAGGGCTATGTCCAGAAACTAGG + Intronic
1120271261 14:82316508-82316530 TAGGGCTTTGTGAAGTGATTAGG + Intergenic
1120476132 14:84989979-84990001 TAGGTCTTTCTCCAGAAACTAGG - Intergenic
1121275212 14:92662756-92662778 TAGGGGTTTCTGGATAAACTGGG - Intronic
1124023354 15:25943525-25943547 TTGGGCTCTGTGCAAAACCTTGG - Intergenic
1128813013 15:70585739-70585761 CAGGGCACTGTGCAGAGACTGGG - Intergenic
1128864575 15:71104795-71104817 TAGAGCTTTGTGTAAAAATTTGG + Intronic
1129239702 15:74244185-74244207 TTGGGCTGTGAGCAGAAACCAGG + Intronic
1129942136 15:79507398-79507420 TATGGGTTACTGCAGAAACTGGG + Intergenic
1135501747 16:23001777-23001799 TAATGCTTTCTGCAGCAACTTGG - Intergenic
1139727793 16:68915630-68915652 TAGCGCTTTCTAGAGAAACTAGG - Intronic
1146010054 17:29186834-29186856 TTACCCTTTGTGCAGAAACTTGG + Intergenic
1146039207 17:29434829-29434851 TAGGGCTTTGACCTGAAATTTGG + Intronic
1146396887 17:32475226-32475248 GATTGCTTGGTGCAGAAACTAGG + Intronic
1147120072 17:38330610-38330632 TGGGGCTTTGTGGGGATACTGGG + Exonic
1147222299 17:38943277-38943299 GAGGGCTTTTTACAGAACCTAGG + Intronic
1147245980 17:39121151-39121173 TAAGGCTTTGTTCAAAAACCTGG - Intronic
1147875641 17:43618581-43618603 CAGGGCTTTGGGCAGAAATAGGG + Intergenic
1149102538 17:52923195-52923217 TAGGGCTTTGACCCGAAGCTTGG + Intergenic
1149170359 17:53802516-53802538 AAGGGCTTTGTGCATGTACTAGG - Intergenic
1157483961 18:48073820-48073842 TAGGGCTTTGTGCAGAAACTCGG - Intronic
1157813714 18:50716430-50716452 TAGGGCTGAGTGTGGAAACTTGG - Intronic
1157822049 18:50779286-50779308 TAGGGCTTTGACCTGAAGCTTGG - Intergenic
1158151957 18:54383431-54383453 TAGGGCTTTGACCTGAAGCTTGG + Intronic
1158896361 18:61917674-61917696 TAATGCTTTGTGGAGTAACTAGG - Intergenic
1159309373 18:66687586-66687608 TAGGGCTTCGGCCTGAAACTTGG - Intergenic
1159369341 18:67511632-67511654 TAGGGCTTTGAGGAGACACCTGG - Exonic
1161062175 19:2220664-2220686 TCTGGCTCTCTGCAGAAACTGGG - Intronic
1162251673 19:9449794-9449816 TTGGACTTTGAGCAGAAACGAGG - Intergenic
1166515755 19:43445562-43445584 TTGGGCTTTGCACAGAAGCTTGG - Intergenic
1167430178 19:49449636-49449658 TTGGTCTTTATGCAGAAACCTGG + Exonic
1167649992 19:50723900-50723922 TAGGGCTTCCTGCAGATGCTGGG - Exonic
925051775 2:821148-821170 AACGGCTCTGTGCAGAAGCTGGG - Intergenic
929763856 2:44828104-44828126 TTGGCCTTAGTGCAGAAACCAGG - Intergenic
929810615 2:45186405-45186427 TAGGGCTTTGGGGAGGAACTTGG + Intergenic
930837853 2:55813989-55814011 TAAGTATGTGTGCAGAAACTTGG + Intergenic
941182016 2:162270855-162270877 TAAAGTTTTGTGCAGAAACCTGG + Intronic
941575621 2:167226669-167226691 TAGGGCTTTGTGAAGAGTGTGGG - Intronic
941853618 2:170208189-170208211 TAGGGCTTTGACCTGAAGCTTGG + Intronic
946297307 2:218795271-218795293 TAGGGCTTTGACCCGAAGCTTGG + Intronic
946813790 2:223554694-223554716 AAGGGCTTTGTGCAAAAATAAGG - Intergenic
946875015 2:224120220-224120242 TAATGCCTTTTGCAGAAACTTGG + Intergenic
947278142 2:228417775-228417797 TAGGGTTCTGTAAAGAAACTGGG + Intergenic
948973203 2:241445282-241445304 GAGGGCTGTGAGCAGTAACTCGG - Intronic
1170222123 20:13952234-13952256 TAGGGCTTTGACCTGAAGCTTGG - Intronic
1172348258 20:34221663-34221685 TAGGTTTTTGAGCAGAAAGTAGG + Intronic
1173233530 20:41222002-41222024 GAGGGCTTTGAGCAGAAGGTTGG + Intronic
1175377036 20:58535046-58535068 TAGTGCTTTGTGGAATAACTAGG + Intergenic
1176379914 21:6107261-6107283 TGCAGCTTTGTGCAGACACTGGG - Intergenic
1177122861 21:17159488-17159510 TAGGGCTGTGTGCAGTCATTTGG + Intergenic
1177414586 21:20777369-20777391 TAGGGCTTTGATCTGAAGCTAGG + Intergenic
1177516000 21:22152471-22152493 CCGGGCTTTGTGCATAGACTTGG + Intergenic
1178938951 21:36888945-36888967 TGGGGCTTTGGGCAGAAAGGAGG - Intronic
1179619623 21:42604670-42604692 TAGGGTTTTCAGCAGAAATTGGG - Intergenic
1179743560 21:43430977-43430999 TGCAGCTTTGTGCAGACACTGGG + Intergenic
952193261 3:31046363-31046385 TAGGGCTTTGACCAGAAGCTTGG - Intergenic
953240775 3:41147565-41147587 TAGAGCTGTGTCCAGACACTGGG - Intergenic
953282765 3:41574968-41574990 CAGGGCTGTGGACAGAAACTGGG - Intronic
953871343 3:46629949-46629971 TAGGGATTTGAGCAGCAACTTGG - Intergenic
955745856 3:62139818-62139840 TAGGGCTTTGTCCATAGATTTGG - Intronic
955757184 3:62237206-62237228 AAGGCCTTTATGCAGAAATTTGG + Intronic
955967456 3:64403314-64403336 GGGGTCTGTGTGCAGAAACTGGG + Intronic
957969005 3:87359518-87359540 CCGGAGTTTGTGCAGAAACTGGG + Intergenic
961975440 3:131019645-131019667 TCTGGCTGTGTGCAGACACTAGG - Intronic
962259022 3:133891381-133891403 TTGGGCTGTGTGTAGAAAGTAGG - Intronic
963441933 3:145351368-145351390 CTGGGCATTGTGCAGAAACTAGG - Intergenic
964304257 3:155324490-155324512 TAGGGCTTTGACCCGAAGCTTGG - Intergenic
965303102 3:167028831-167028853 AAGAACTTTGAGCAGAAACTTGG + Intergenic
965610814 3:170542174-170542196 TCGAGCTTTGTGTAGCAACTGGG - Intronic
966295123 3:178410974-178410996 TAGGGAGTTGAGCAGAAAATAGG + Intergenic
968231780 3:197008764-197008786 TGGGGCTGTGTGCAGAGGCTGGG - Intronic
969527258 4:7710201-7710223 TGAGGCTTTGCGCAGAAACATGG - Intronic
980180713 4:129397217-129397239 TATGGGTTTGTGCAGAAATGAGG + Intergenic
980719293 4:136672802-136672824 CAAGCCTTTGTCCAGAAACTTGG - Intergenic
981140185 4:141259115-141259137 GAGGGCTTTGTCTTGAAACTTGG + Intergenic
981841204 4:149114641-149114663 TGTGGCTTTTTCCAGAAACTAGG + Intergenic
982352354 4:154429609-154429631 TAAGGGTTTGGGCAGAAACTGGG - Intronic
983034901 4:162851714-162851736 TAGGGCTTTGTACAGTCCCTTGG - Intergenic
988680934 5:33483029-33483051 TATGGCTTTGTGCGGAAGCCGGG + Intergenic
988977751 5:36531579-36531601 TAAAGCATTGTGCAAAAACTAGG - Intergenic
991488841 5:67164645-67164667 TGGGGCTCTGTGCAGACTCTGGG - Exonic
995393595 5:111664411-111664433 TAGGGCTTTGACCTGAAGCTTGG + Intronic
995812197 5:116120188-116120210 TAGCGTTTTTTGCAGCAACTTGG + Intronic
999130698 5:149281070-149281092 GAGTGCTTTGTGCAGAGGCTGGG + Intronic
1002977303 6:2094039-2094061 TGGGCCTTTGTGCGGAAACAGGG + Intronic
1007273252 6:40654417-40654439 TAGGCCCTTGTGCAGAGTCTGGG + Intergenic
1008833193 6:55794283-55794305 TACAGCTCTGTGCAGAAACAGGG - Exonic
1010991581 6:82485497-82485519 TAGGGCTTTGTCCCAAAGCTTGG - Intergenic
1011538317 6:88402433-88402455 TAGGTGTTTGTTCAGAAACATGG - Intergenic
1011816862 6:91201762-91201784 CAAGCCTTTTTGCAGAAACTTGG - Intergenic
1019003479 6:168776552-168776574 TAGTGCTATATGAAGAAACTGGG + Intergenic
1019843839 7:3476878-3476900 TAGGGCTTTTGGCAGTAAGTGGG + Intronic
1021331467 7:19343459-19343481 TAGGGCTTTGACCAGAAGCCTGG - Intergenic
1024491428 7:49990064-49990086 TAGGGCTTTGACCTGAAGCTTGG - Intronic
1024898680 7:54292353-54292375 GAAGCCTTTGTGCTGAAACTTGG + Intergenic
1025779649 7:64589162-64589184 TAGAGATTTATGAAGAAACTTGG - Intergenic
1026446514 7:70488943-70488965 TAGTGCTTGGTGAAGAAAATGGG - Intronic
1027135225 7:75619083-75619105 TAGGGGTGTGTGTACAAACTCGG - Intronic
1032631458 7:133657648-133657670 GAAGGCTGTGTGGAGAAACTTGG + Intronic
1035256929 7:157635319-157635341 GAGGCCTTTGATCAGAAACTGGG - Intronic
1037140744 8:15517110-15517132 GAGTACTTTGTTCAGAAACTTGG - Intronic
1040526416 8:48229127-48229149 GAGGGCTTTGTGTAATAACTAGG + Intergenic
1045162546 8:99564806-99564828 TAGAGCTATGTGTAGAACCTTGG + Intronic
1048892311 8:138959117-138959139 TAAGGCTGTGGGCAGAAACCAGG - Intergenic
1049083539 8:140460314-140460336 GAGGTCTGAGTGCAGAAACTAGG + Intergenic
1052595531 9:30552725-30552747 TAATGCCTTTTGCAGAAACTTGG - Intergenic
1056501624 9:87215321-87215343 TAAGGCTTTGTCTAAAAACTTGG - Intergenic
1185889344 X:3810542-3810564 GATGGCTTTGAGCAGAAACAAGG + Intergenic
1186511512 X:10133347-10133369 CAGAGCTTTGTGCAGAAGCATGG + Intronic
1188803655 X:34560811-34560833 TAGGGCTTTGACCCAAAACTTGG + Intergenic
1189153307 X:38729731-38729753 TAGGGCTTTGACATGAAACTTGG - Intergenic
1189616592 X:42790079-42790101 TAGGACTTTGACCAGAAGCTTGG + Intergenic
1190576475 X:51844673-51844695 GAGGGCTTTGTGAAGAGATTAGG + Intronic
1190703746 X:53007835-53007857 TATGGCTTTACGCAGAAAATTGG - Intergenic
1191841884 X:65519141-65519163 GAGGGCTTTGTGCAGGAGGTAGG + Intronic
1191859767 X:65656754-65656776 GAGGGCTTTGTGCAGGAGGTAGG + Intronic
1192213888 X:69144557-69144579 AAGGGCTTTGTGTAGACAATGGG - Intergenic
1192575196 X:72238179-72238201 TATCTTTTTGTGCAGAAACTGGG - Intronic
1193269666 X:79514786-79514808 TAGGGCTTTGACCTGAAGCTTGG - Intergenic
1194066437 X:89267480-89267502 TAGGGCTTTGACCCGAAGCTTGG + Intergenic
1194131268 X:90084833-90084855 TAGGGCTTTGACCTGAAACTTGG + Intergenic
1194843936 X:98780039-98780061 GAAGGCTTTGTGTAAAAACTTGG + Intergenic
1197163930 X:123355052-123355074 TAATGCTTTCTCCAGAAACTTGG + Intronic
1197874347 X:131087796-131087818 TAGGGCTTTCTTCAGAGTCTTGG - Intronic
1200720607 Y:6601601-6601623 TAGGGCTTTGACCCGAAGCTTGG + Intergenic
1200772798 Y:7142793-7142815 GATGGCTTTGAGCAGAAACAAGG - Intergenic