ID: 1157486469

View in Genome Browser
Species Human (GRCh38)
Location 18:48090795-48090817
Sequence CAGTGGAACTGGAAGGTAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 315
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 284}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157486469 Original CRISPR CAGTGGAACTGGAAGGTAGA TGG (reversed) Intronic
903858449 1:26351068-26351090 AAGGGGGACTGGAAGGTGGAGGG + Intronic
907121622 1:52013074-52013096 CACCGGAACTGGAAGGTGGAGGG - Intergenic
907355436 1:53869078-53869100 AAGTGGGCATGGAAGGTAGAGGG + Intronic
907766117 1:57412212-57412234 CAGAGGAAGGGGAAAGTAGACGG - Intronic
909508145 1:76418367-76418389 CAGTGTAGCTTGAAGGTGGAGGG + Intronic
909579490 1:77218390-77218412 CAGTGGAACTGGAGAGGTGAGGG + Intronic
909979578 1:82082694-82082716 AAGTGGAAAAGAAAGGTAGAAGG - Intergenic
910266136 1:85339836-85339858 CAGTTGAGCTGGAAGGAGGAGGG - Intronic
910569981 1:88689059-88689081 CAGTGACACTGGAAAGTGGAAGG + Intronic
911003104 1:93188569-93188591 AAGTGGCACTGGAAGATAGAAGG - Intronic
913183450 1:116344788-116344810 CTCTGCAACTGGAAGGTTGAAGG - Intergenic
915564628 1:156706653-156706675 CAGTGGAGATGGCAGGGAGACGG + Intergenic
916186898 1:162142237-162142259 CAGTGGCTCTGTAAGGAAGATGG + Intronic
916337074 1:163684930-163684952 GATTGGAACTGGAAGTCAGAAGG - Intergenic
917159121 1:172037690-172037712 CAGTGGAAATGCCAAGTAGATGG + Intronic
917609186 1:176669000-176669022 TAGTGGAACTGGTGGGTTGAGGG + Intronic
918471468 1:184880168-184880190 CAGAGGAACTGGATGTTAGAAGG - Intronic
919874082 1:201848732-201848754 CAATAGAGCTGGAGGGTAGATGG - Intronic
920048003 1:203146039-203146061 CAGAGGAGCTGGAAGGAGGAAGG - Intronic
920664440 1:207951179-207951201 AAGTGGTAGTGGAAGGTAGAGGG - Intergenic
921279611 1:213552883-213552905 CAGTAGTGCTTGAAGGTAGAAGG - Intergenic
921430491 1:215059772-215059794 AAGAAGAACTGGGAGGTAGAAGG + Intronic
923397795 1:233584193-233584215 AAGAGGAGCTGGAAGGGAGATGG - Intergenic
1063286255 10:4692092-4692114 AAGGGGAACGGGAAGGGAGAAGG + Intergenic
1063723980 10:8616250-8616272 CAGGGGAACTTGTAGATAGAAGG + Intergenic
1064750312 10:18521766-18521788 CAGGGGACCTGGAAGATACAGGG + Intronic
1070647570 10:78212389-78212411 CAGTGGAGCTGGAGAGCAGAAGG - Intergenic
1071191471 10:83106632-83106654 CTATAGAACTGGAAGCTAGAAGG + Intergenic
1071275351 10:84049103-84049125 CAGTGGGGGTGGAGGGTAGAAGG + Intergenic
1071703447 10:87968476-87968498 CTTTTGAACTGGCAGGTAGAAGG - Exonic
1071712099 10:88060071-88060093 CAGAGGAAATGGAAAGTACAAGG + Intergenic
1072816615 10:98515906-98515928 CAGTGGAGCTGGTGGGGAGAGGG - Intronic
1073327457 10:102650948-102650970 CTGGGAAACTGGAAGGAAGATGG - Intronic
1075084067 10:119402390-119402412 CTGTAGAACTGGAGGGTAGAAGG - Intronic
1075180513 10:120206936-120206958 CAGTGGAGCTGGAGGGAAGGAGG - Intergenic
1076027774 10:127130443-127130465 CAGTTAAACTGGAGGGAAGAGGG + Intronic
1076794387 10:132791563-132791585 CAGTGGAGCTGGGGGGAAGAGGG + Intergenic
1077609540 11:3635938-3635960 GTGCGGACCTGGAAGGTAGAAGG - Intergenic
1079683823 11:23331740-23331762 CAGTGGGACTGGCAGGTAGGTGG + Intergenic
1079893905 11:26094403-26094425 CTGAGGAACATGAAGGTAGAAGG - Intergenic
1081884118 11:46480103-46480125 AAGTGGAAGAGGAAGGCAGAAGG - Intronic
1085405541 11:76259666-76259688 CAGAGGAAGAGGAAGGAAGAAGG + Intergenic
1085554207 11:77404667-77404689 CATTGTAACTGGAAGGAAGAAGG - Intronic
1085955520 11:81388950-81388972 CTGCGGAACTTGAATGTAGATGG + Intergenic
1086539860 11:87896219-87896241 GAGTGGAAATGGAAGGTCGGGGG - Intergenic
1088680452 11:112237096-112237118 CAGTGGAAATAGATGGAAGAAGG + Intronic
1088746278 11:112807642-112807664 CAGGGGAAGTGGAAGTTAGAGGG + Intergenic
1090807201 11:130210003-130210025 AAGTGGAGCTGGGAGGTAGAAGG + Exonic
1090841097 11:130487895-130487917 CAGTGGAGGTGGGAGCTAGAGGG - Intergenic
1092203166 12:6599831-6599853 CAGTGGATGTGGTAGGAAGAAGG + Exonic
1093777601 12:23095611-23095633 CATTGGAAATGGAATATAGAAGG - Intergenic
1094187912 12:27664761-27664783 CAGTGCAACTGCAAGGTGGTGGG + Intronic
1094295153 12:28897512-28897534 CAGTTGAAGTGGAAGGTGAAAGG - Intergenic
1095644704 12:44529801-44529823 AAGTGTCACTGGAAGGAAGAAGG + Intronic
1095735888 12:45555779-45555801 CAATGGAACTGGAAGGCAGGAGG - Intergenic
1097298188 12:57989753-57989775 CAGTGTAACAGGCAGGAAGATGG + Intergenic
1097548904 12:61041656-61041678 CTGTGGAATGGAAAGGTAGAGGG - Intergenic
1100315091 12:93437828-93437850 CAGGGGAACTGGAATGCTGAAGG + Intronic
1101338261 12:103816508-103816530 CAGTGGACCCTGATGGTAGAAGG - Intronic
1101966549 12:109286160-109286182 AAGTGGAGCAGGAAGTTAGAGGG - Intronic
1102392917 12:112563910-112563932 CAGTGCAACTGGAGTGTTGAAGG - Intergenic
1102511830 12:113421226-113421248 CAGTGGGGCTGGGAGGGAGAAGG - Intronic
1102684326 12:114712790-114712812 ATGTAGAACTGGAAGGTATAGGG + Intergenic
1103235026 12:119364963-119364985 CAGTGGACATGGAAGGCAGTTGG + Intronic
1104307777 12:127624923-127624945 CAGGACAACTGGAAGGTAGGGGG + Intergenic
1104984126 12:132587120-132587142 CAGTGCAGCTGGAGGGTGGACGG + Intergenic
1106619116 13:31356734-31356756 CAATGGAACTGAAAGGGAGGGGG - Intergenic
1106990198 13:35409729-35409751 CAGGGGAAAAGGAAGGCAGAAGG + Intronic
1107189381 13:37560945-37560967 CAGTGCAAATGGAAGGTTTAAGG + Intergenic
1108326410 13:49336708-49336730 TAGTGGCCCTGGAAGGAAGATGG - Intronic
1108874589 13:55029540-55029562 CGGTGGAACTGGAATGGAAATGG - Intergenic
1109396106 13:61761994-61762016 CACAGAAACTGGAAGCTAGAGGG + Intergenic
1111489761 13:88956514-88956536 CATTGGAAATGGAAAGAAGATGG + Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1112378892 13:98869841-98869863 CAGTGGCACAGGAAGGAACAAGG - Intronic
1112816061 13:103274878-103274900 CTTTGGAGCTGGAAGGTTGAGGG + Intergenic
1114808155 14:25862126-25862148 CATTGGAAGTGGAGGGAAGATGG + Intergenic
1115733135 14:36293687-36293709 CATTGGAACTAGATGGTAAATGG + Intergenic
1116523800 14:45880446-45880468 AAGGGGAACTGGAAGGGGGATGG - Intergenic
1117070025 14:52047952-52047974 GAGTGGAACTGGTAGGTCTAAGG - Intronic
1117457542 14:55912905-55912927 TAGTGGAGGTGGAAGGTAGATGG + Intergenic
1121555255 14:94831662-94831684 CAGTGGGAATGGAGGGCAGAAGG + Intergenic
1121666852 14:95679057-95679079 CAGTGTAACTGAAAGGAACAAGG - Intergenic
1121695510 14:95908927-95908949 CAGTGGAAGTGGCAGGTAGGCGG + Intergenic
1122018294 14:98815967-98815989 CCTGGGAACTGGAATGTAGATGG - Intergenic
1122027694 14:98889464-98889486 CAGTGGGGCTGGAGTGTAGAGGG + Intergenic
1122148398 14:99707967-99707989 CAGTGGAACAGGAAGACAGAAGG - Intronic
1122636281 14:103131203-103131225 GAGGGGAGCTGGAAGGTGGAGGG + Intronic
1123648901 15:22463325-22463347 CAGTGGATGTGGAAGGGACAGGG - Intronic
1123729435 15:23132360-23132382 CAGTGGATGTGGAAGGGACAGGG + Intronic
1123747603 15:23329842-23329864 CAGTGGATGTGGAAGGGACAGGG + Intergenic
1124279965 15:28353693-28353715 CAGTGGATGTGGAAGGGACAGGG + Intergenic
1124302734 15:28557918-28557940 CAGTGGATGTGGAAGGGACAGGG - Intergenic
1125637979 15:41205259-41205281 CATTGGAACAGGAGGGTAGAGGG + Intronic
1126179670 15:45772959-45772981 CAGCGGATCTGGAAGGACGAAGG - Intergenic
1126750021 15:51867096-51867118 CAGTGTGACTGGAATGGAGAGGG + Intronic
1127475261 15:59327021-59327043 CAGAGGAACTGGAACCTAGGTGG + Intronic
1128058777 15:64720145-64720167 CTGTGCCACTGGAAGGTAGAAGG - Intergenic
1128126040 15:65193764-65193786 GAGGGGAACAGGCAGGTAGATGG - Intergenic
1128536114 15:68491851-68491873 CAGGGGGGCTGGAAGGAAGAGGG + Intergenic
1128569877 15:68726277-68726299 CAGTGGACCAGGAAGCAAGAGGG + Exonic
1130943735 15:88534520-88534542 CAGTGGAACCAGAAGGTACTGGG + Intronic
1132143307 15:99412199-99412221 CAGCAGCACTGGGAGGTAGATGG + Intergenic
1132212784 15:100036771-100036793 CGGTAGAGATGGAAGGTAGATGG - Intronic
1134203167 16:12215599-12215621 CAGTGGAACAGGCAGGCAGGTGG + Intronic
1135922475 16:26663564-26663586 AAGGGGAACTGGAAGGAAGGAGG + Intergenic
1136063955 16:27746470-27746492 CAGAGGAACTGACAGGTGGAGGG + Intronic
1140955917 16:79865161-79865183 CAGAGGCACTGGAAGGGAGATGG - Intergenic
1141494137 16:84395274-84395296 CAGTGACACTGGAGGGGAGAGGG - Intronic
1143156138 17:4837635-4837657 CAGTGGAAGTGGATGGGACAAGG + Intronic
1143393897 17:6576746-6576768 CAGTGGGTCTGAAAGGCAGAAGG - Intergenic
1144059994 17:11574760-11574782 CAGTGGGATTGGAGGGAAGATGG + Intergenic
1144094243 17:11885302-11885324 GAGTGTAACTGGAACATAGAGGG + Intronic
1144508202 17:15851598-15851620 CAGAGGACGTGGAAGGTACAGGG - Intergenic
1145119840 17:20248231-20248253 CAGAGGATCTGGAAGGTGCAAGG - Intronic
1145172325 17:20669232-20669254 CAGAGGATGTGGAAGGTACAGGG - Intergenic
1146370710 17:32264359-32264381 CAGGGGAACTGGAAGGAGAAGGG - Intergenic
1146427531 17:32756300-32756322 CTTTTGAACTGGCAGGTAGAAGG - Intronic
1146562729 17:33885056-33885078 CAGTGGAGCTGGTAAGTAGGGGG - Intronic
1147793817 17:43028810-43028832 CAGGGGAGCTGGAGGGCAGAAGG + Exonic
1148712090 17:49689365-49689387 CAGTGGAGATGGAAGGAAGTAGG - Intergenic
1148868904 17:50643977-50643999 CAGGGGCACTGGAGGGCAGAGGG + Intronic
1149109135 17:53005848-53005870 CAGTGGAGTTGGAAGGGAGAAGG + Intergenic
1149894078 17:60415438-60415460 CAGTGATTCTGGAAGTTAGATGG - Intronic
1150919593 17:69469254-69469276 AAGTGGAAGAGGAAGGTAGAGGG - Intronic
1151143068 17:72013974-72013996 TAGAGGAACTGGAGGGTGGAGGG - Intergenic
1151210994 17:72543593-72543615 CAGGGGACATGGAAGGGAGAGGG - Intergenic
1151920388 17:77150382-77150404 CAGGGTATCTGGAAGGGAGAGGG - Intronic
1155282430 18:24253489-24253511 CAGGGGAACTGCAATGGAGAAGG + Intronic
1155820438 18:30368954-30368976 CACTGTGACTGGAAGATAGAGGG - Intergenic
1156580599 18:38370452-38370474 CAGTGAATCTGGAAGGCAGGAGG + Intergenic
1157242631 18:46025390-46025412 CAGTGGAGCTGGAAGAGAGTGGG - Intronic
1157486469 18:48090795-48090817 CAGTGGAACTGGAAGGTAGATGG - Intronic
1157847942 18:51021161-51021183 CAGGGGAATTGGGAGGTACAGGG - Intronic
1158086204 18:53654494-53654516 CAGTGGAGCTGAATGGTGGAGGG - Intergenic
1158551810 18:58442560-58442582 CAGTGGGGCTGGAAGGAAGCTGG - Intergenic
1158785638 18:60708726-60708748 CAGTGGAAATGGTAGCTATATGG - Intergenic
1158818605 18:61132359-61132381 CAGTAGAGCTGGAAGCTAGATGG - Intergenic
1159406582 18:68010470-68010492 CAGTGGTTCGGGAAGGGAGACGG - Intergenic
1161307610 19:3576657-3576679 CCGTGAAACTGGGTGGTAGAGGG + Intronic
1163160412 19:15461027-15461049 CAGTGAAGGTGGGAGGTAGAGGG - Intronic
1165447438 19:35864271-35864293 CACTTGAACTGGGAGGTGGAGGG - Intronic
1165776922 19:38410089-38410111 CAGGGGACCTGGAAGGAGGAAGG + Exonic
1166088808 19:40494882-40494904 CAGGGTAACTGGAAGGGTGAAGG - Exonic
1166590393 19:43992640-43992662 CAAGGGACCTGAAAGGTAGAAGG - Intronic
1166742703 19:45123924-45123946 CAGTAGACCCTGAAGGTAGATGG - Intronic
1167379084 19:49128284-49128306 CACTGGGACTGGAAGTTTGAAGG - Intronic
1167623142 19:50569638-50569660 TAGTGGACCGGGGAGGTAGAGGG - Intergenic
1168521118 19:57051288-57051310 CAGAAGTTCTGGAAGGTAGAGGG - Intergenic
926027934 2:9560889-9560911 CTGTGGAACTGGAGGGTAATTGG - Intergenic
926148190 2:10409654-10409676 GGGTGGAACAGGAAGGTGGAAGG - Intronic
926634201 2:15163287-15163309 GAGTGGGACTAGAAGGGAGAAGG + Intergenic
926887724 2:17613189-17613211 CAGTGGAACAAGAAGGTCTATGG + Intronic
927391461 2:22600133-22600155 CTGTGGAACTAGGAGGTGGAGGG + Intergenic
927486548 2:23492040-23492062 CAGAGGAACTGGAGGGAAAAAGG - Intronic
929916618 2:46142141-46142163 CAGTGGAGGTGGAAGGTGGTAGG - Intronic
929956123 2:46460060-46460082 CTGTGGGCCTGGAAGGTGGAAGG - Intronic
931889384 2:66654115-66654137 CTGTGGAAATAGAAGGTAGATGG + Intergenic
932105588 2:68938270-68938292 CAGTGGAACTAGATGCTTGAAGG - Intergenic
935644112 2:105318885-105318907 CCCTGGAAGTGGAAGGGAGAGGG - Intronic
935691983 2:105740397-105740419 CAGGGGAACTGGAGAGCAGAAGG + Intergenic
938715952 2:134022028-134022050 AAGAGGAACTGAAAGTTAGATGG + Intergenic
939704199 2:145431721-145431743 CATTGAAATTGGAAGGTAAACGG + Intergenic
940250364 2:151669112-151669134 TAGTTGAACTACAAGGTAGAGGG - Exonic
943101871 2:183496627-183496649 TAGTGGAAGTGGAATGGAGATGG + Intergenic
943458109 2:188133045-188133067 CAGTGGAACTGGGAAGAAGATGG + Intergenic
946156827 2:217812475-217812497 CAGTGATACTGGAAGCCAGAAGG + Intronic
1169653619 20:7896846-7896868 GAATGGAACAGGAAGGCAGAGGG - Intronic
1170587528 20:17745944-17745966 CAGTGCAACAGGAAGCAAGATGG + Intergenic
1170903245 20:20486776-20486798 CCGTGAAACTGGAATGCAGAGGG - Intronic
1172600271 20:36178352-36178374 CAATGGGACTGGCAGGAAGAAGG - Intronic
1172754912 20:37276760-37276782 CTCTGGAAATGGATGGTAGACGG + Intergenic
1173228644 20:41177116-41177138 CAGTGGTACCAGAAGGTAGATGG + Intronic
1174118176 20:48242286-48242308 CATTGTCACTGGAAGGGAGATGG + Intergenic
1175003072 20:55651073-55651095 CAGTATAGCTGGAAAGTAGAAGG - Intergenic
1175106442 20:56618393-56618415 CCGTGGAGCTGGAAGGCAGGTGG - Intergenic
1175135157 20:56817914-56817936 CAGTGGAACAGAAAGACAGATGG - Intergenic
1175292973 20:57890636-57890658 CAGCAGACCTGGGAGGTAGAAGG - Intergenic
1177739744 21:25139771-25139793 CAGTAGATCTGGAAAGTAAATGG - Intergenic
1178273573 21:31216085-31216107 CACTTGAACTGGGAGGCAGAGGG + Intronic
1178566654 21:33692851-33692873 CACTTGAACTGGGAGGCAGAGGG - Intronic
1179151968 21:38816607-38816629 CAGTGGAACTGTAAGCTTCACGG + Intronic
1179373405 21:40827966-40827988 CAGAGGAATTGGATGGAAGAAGG + Intronic
1181567131 22:23745895-23745917 GAGTGCGACTGGAGGGTAGAGGG - Intronic
1183645629 22:39124372-39124394 CAGTGAAGCTGGGAGGTGGACGG + Intronic
1184969215 22:48003221-48003243 CAGGGGACCTGGAAGGAAGGTGG + Intergenic
1185007993 22:48296149-48296171 CAGTGCAAGTGGTATGTAGAGGG + Intergenic
951099366 3:18668848-18668870 AAGTGGAAGAGGAAGGCAGAAGG - Intergenic
952168354 3:30776722-30776744 CAGTCTAACTAGAAGGAAGAGGG - Intronic
953162758 3:40436665-40436687 CACAGGAACTGGAAGGCACAAGG + Intergenic
954482971 3:50818661-50818683 CACTGGGACAGGAAGGGAGAGGG + Intronic
955227374 3:57072235-57072257 CAGTGGAATTGCTAGGTATATGG - Intronic
956311204 3:67882584-67882606 CAGTAGCAAGGGAAGGTAGAAGG - Intergenic
956644785 3:71444891-71444913 CATGGGGACTGGAGGGTAGAGGG + Intronic
958552449 3:95634662-95634684 TAGTGGAAAAAGAAGGTAGAAGG - Intergenic
958728299 3:97932838-97932860 CAGTGGATCTGGAAAGAAGATGG - Intronic
958803802 3:98785571-98785593 CAGTGAAGCTGGAAAGTAGCAGG + Intronic
959674851 3:109022990-109023012 AAAGGGAACTGGAAGGAAGAAGG + Intronic
960690699 3:120343051-120343073 AAGTGGACAGGGAAGGTAGACGG + Intronic
964073579 3:152665476-152665498 CAGTGGTACTGTGAGGTTGATGG + Intergenic
964210387 3:154220376-154220398 TACTGGAAATGGAAGGGAGATGG + Intronic
964362483 3:155913111-155913133 CAGAGGAAGTGGTAGGAAGAGGG - Intronic
966241168 3:177756787-177756809 GTGTGGAACTGTCAGGTAGAAGG - Intergenic
966624850 3:182004844-182004866 CTGTGGAGCTGGCAGGAAGAAGG - Intergenic
967230423 3:187332636-187332658 CATTTTAACTGGAAGGCAGAGGG - Intergenic
968778379 4:2559811-2559833 CAGTGGAACAGCAAGGCAAAAGG - Intronic
969303871 4:6313972-6313994 CAGGGGAACTGCAATGGAGAAGG - Intergenic
969360496 4:6660360-6660382 CACTGGGACTGGGAGGAAGAAGG + Intergenic
970820267 4:20204175-20204197 CAGTAGGACTGGATGGAAGAAGG + Intergenic
971443388 4:26715284-26715306 ATGTGGAAGTTGAAGGTAGAAGG - Intronic
972349056 4:38218978-38219000 GAGTGGAACTGAAGGGTAGTAGG + Intergenic
974429769 4:61780640-61780662 CAGTGGGAATGGATGGAAGAAGG - Intronic
976226761 4:82800252-82800274 CAGTGGAACATGAAGCTGGAGGG + Intergenic
977094683 4:92725215-92725237 CACTTGAACTGGGAGGTGGAGGG + Intronic
980896754 4:138867695-138867717 GAGTGCAACTGGAAAGGAGAAGG - Intergenic
982018006 4:151174881-151174903 CAGTGGAGCTGAAGGGTAGGTGG + Exonic
983000086 4:162403518-162403540 CAATGGAAATGGAAGGCTGAAGG - Intergenic
984021098 4:174485669-174485691 CAGGGGAGCTACAAGGTAGAAGG + Intergenic
986105780 5:4658129-4658151 AAGTGGAAATGGGAGGCAGAAGG - Intergenic
989412775 5:41139793-41139815 CACTGGCACTGGAGGGAAGAAGG - Intergenic
990972480 5:61524273-61524295 TAGTGAAACTGCAAGGGAGAAGG - Intronic
991145123 5:63292983-63293005 CAGTTGGAATGGAAGGTTGAGGG - Intergenic
993602242 5:89941520-89941542 CAGTGGTAAAGGAAGGGAGAGGG + Intergenic
993621457 5:90173112-90173134 CAGTGGAAATGGAAGGAACCAGG - Intergenic
993863115 5:93159786-93159808 CAATGGAGCTGGCATGTAGAGGG + Intergenic
995051266 5:107707233-107707255 CACTTTCACTGGAAGGTAGAAGG + Intergenic
995728024 5:115202894-115202916 TAAAGGAACTGGAAGTTAGAAGG - Intergenic
996776856 5:127142173-127142195 CAGTGGAAATGGAAGCTTGTAGG - Intergenic
997032139 5:130142802-130142824 CAGTGGGACTGGAAGGGCCAAGG + Intronic
998184752 5:139969731-139969753 GGGTGGAACTAGAAGCTAGAGGG - Intronic
998681265 5:144470243-144470265 CAGTGGGACTGCAAGGTCAAAGG + Intronic
999079436 5:148828958-148828980 AAGTAGAACTGGAAGGTGGGTGG - Intergenic
999234532 5:150082505-150082527 CAGTGCAACTGCCAGGAAGAGGG + Intronic
999653171 5:153787294-153787316 CACTGGAACTGGGAGGTCCAGGG - Intronic
1001873970 5:175183156-175183178 CACTGGACAAGGAAGGTAGATGG + Intergenic
1002606059 5:180383437-180383459 CGGTGGAGCAGGAAGGTAGAAGG - Intergenic
1003203551 6:3986710-3986732 CAGTGGAGATAAAAGGTAGATGG - Intergenic
1005118074 6:22360344-22360366 AAGTGGAAGTGGCAGGTAGTGGG + Intergenic
1005993608 6:30918734-30918756 CAGTAGAACTGGAAAGGGGAAGG - Intronic
1006461009 6:34158073-34158095 CTGAGGAAGTGGAAGGGAGAGGG + Intergenic
1006993417 6:38235494-38235516 CAGTGGTACTGGGAGCCAGATGG - Intronic
1008627148 6:53327827-53327849 GAGAGGAAATGGAAGGTAAAAGG - Intronic
1011993241 6:93550557-93550579 CAGGGGAAATGGGAGGTAAAGGG + Intergenic
1012788013 6:103657211-103657233 CAGTGGATCTGGAAGTTGGCTGG - Intergenic
1013525364 6:110969066-110969088 CAGTGGAAATGGAAGACAGAAGG - Intergenic
1014480684 6:121932753-121932775 CAGAGGGACTGGAAGGTCAAGGG + Intergenic
1015036937 6:128667431-128667453 CTGTGGTAGTTGAAGGTAGAGGG + Intergenic
1022762843 7:33375672-33375694 CAGTTGAACTGGGAGGCAGAGGG - Intronic
1023854763 7:44176022-44176044 AAGGGGAACTGGATGTTAGAGGG - Intronic
1025055375 7:55760725-55760747 AAGTGGAAGAGGGAGGTAGAAGG + Intergenic
1025183522 7:56837953-56837975 CAGTGGAGCAGAAAGATAGAAGG - Intergenic
1026501654 7:70947860-70947882 CAGTGGCACTGGTAGTCAGATGG - Intergenic
1027634179 7:80648890-80648912 CAGTGAAGATGGAAGGAAGAAGG + Intronic
1028357920 7:89931838-89931860 CAGTGGTATTGGAAGGAAAATGG - Intergenic
1030880543 7:114873067-114873089 CAGTGGAAAGGGAAGGCAGTTGG - Intergenic
1031739221 7:125407764-125407786 AAGTGGAAAAGGAAGGCAGAAGG + Intergenic
1033086252 7:138344756-138344778 CAGTGCAAATGGAAGGTTTAAGG + Intergenic
1034677803 7:152903872-152903894 CAGTAGAACTGGAAGGCACCTGG + Intergenic
1034944174 7:155251208-155251230 CTGGGGCACTGGAAGGCAGATGG + Intergenic
1035477563 7:159154046-159154068 CAGTGGACCTTGAACGAAGAGGG - Intergenic
1037747551 8:21659043-21659065 CAGTGGAGCTGGAGTGGAGAGGG - Intergenic
1038124808 8:24661510-24661532 GGGAGGAACTGGGAGGTAGAAGG - Intergenic
1039618576 8:38976045-38976067 CAGTGGACTTGGCAGGTACAGGG - Intronic
1039741683 8:40388686-40388708 CAGTGGAGCAGAAAGGAAGAAGG - Intergenic
1039804208 8:40984793-40984815 CAGTGGATCTGGGAGGAAGTAGG - Intergenic
1039895516 8:41714089-41714111 CTGAGGGACTGGAAGGTAGCAGG + Intronic
1042485080 8:69339153-69339175 CTGTGGAACTGGCAAGTAGCTGG - Intergenic
1042741150 8:72048346-72048368 CTGTAGAACTTGAGGGTAGAGGG + Intronic
1044619555 8:94175688-94175710 TTGTGGAAGTGAAAGGTAGAAGG + Intronic
1046966293 8:120169234-120169256 CTGTGGAACTGCAAGGTTAAAGG + Intronic
1047987349 8:130248633-130248655 TGGTGGAAATGGAAGGTAAAGGG + Intronic
1048286397 8:133145173-133145195 CAGAGGAAGAGGAAGGCAGAAGG + Intergenic
1048871994 8:138806829-138806851 CAGTGGAACAGGATGGAAGATGG + Intronic
1049016144 8:139921594-139921616 AAGGGGAGCTGGCAGGTAGAGGG + Intronic
1050366295 9:4876831-4876853 CAGTGTAGATGGGAGGTAGAGGG + Intronic
1050980598 9:12008863-12008885 CTGTAGAACTGCAAGGTGGAAGG + Intergenic
1051103432 9:13549354-13549376 CAGATTAACTTGAAGGTAGAAGG + Intergenic
1051765962 9:20524024-20524046 CAGGGGAAGTGGCAGGGAGAAGG + Intronic
1052067153 9:24036093-24036115 CAGTTCTACTGGAAGGCAGAAGG + Intergenic
1052323155 9:27190166-27190188 CAGTGGGACTGGAGGGTACTAGG + Intronic
1052660170 9:31419326-31419348 TAGGGGAACTGGAAAGGAGACGG - Intergenic
1053884024 9:42626160-42626182 CAGTGGTAATGGAAGATAAAAGG - Intergenic
1053888644 9:42668134-42668156 CAGTGGTAATGGAAGATAAAAGG + Intergenic
1054223044 9:62433606-62433628 CAGTGGTAATGGAAGATAAAAGG - Intergenic
1054227666 9:62475581-62475603 CAGTGGTAATGGAAGATAAAAGG + Intergenic
1056089193 9:83187743-83187765 GAGGAGAAATGGAAGGTAGAGGG - Intergenic
1056251308 9:84751125-84751147 GAGTGGCACTGGAAGGGAGCAGG - Intronic
1056667238 9:88590469-88590491 GAGTGGAACTGGAAAGGGGATGG - Intergenic
1056839133 9:89983893-89983915 CAGTGGAAAAGGCAGGTAGACGG + Intergenic
1058602621 9:106686811-106686833 AAGGGGAACTGGCAGGGAGATGG + Intergenic
1058776631 9:108290582-108290604 CAATGGAACCAGAAGCTAGAGGG + Intergenic
1059205213 9:112458081-112458103 CAGTGGCACTAGAAGGTAGATGG - Intronic
1059502690 9:114768518-114768540 CAATGAACCTGGAAGGTAGTGGG + Intergenic
1059593019 9:115684094-115684116 CACTGGAAATGGAAGCTACATGG - Intergenic
1059669005 9:116475878-116475900 GAGTGTAACTGGAATGTGGAAGG - Intronic
1060213224 9:121723160-121723182 CTGTGGCTCTGGAAGGAAGAGGG + Intronic
1060803855 9:126562810-126562832 CAGTGGAGCTTGAAGGCTGAGGG - Intergenic
1061573735 9:131493386-131493408 GAGCGGAACTGGAAGGAGGAAGG + Intronic
1062204418 9:135328079-135328101 CAGGGGAATAGGAAGGTAAAGGG + Intergenic
1186255255 X:7711301-7711323 CAGAGGAAGTGGAAGCTACAGGG - Intergenic
1186924816 X:14321971-14321993 CAGTTGACCTGGAGGGGAGAAGG - Intergenic
1187449711 X:19385880-19385902 CCATGTAACTGGAAGGTACAGGG + Intronic
1187542779 X:20214466-20214488 CAGCAGAACTGGATGCTAGAAGG - Intronic
1191780242 X:64856731-64856753 CAGTGTAACTGAAAGGGGGATGG - Intergenic
1192220602 X:69195145-69195167 ATGTGGGACTGGAAGGTGGAGGG + Intergenic
1192365167 X:70466052-70466074 CAGTGGAAATGGAAGCTAATTGG - Intronic
1194597692 X:95879016-95879038 AAGTGGAACTGGAAGGTAAAAGG + Intergenic
1195384517 X:104301553-104301575 TAGTGGAAGTGGAAGGGAAAAGG + Intergenic
1195958537 X:110360810-110360832 CAGTGGGAATGGAAGGAAAATGG + Intronic
1196640132 X:118049998-118050020 CAGTGGAACTGCATGGTGTATGG - Intronic
1197131681 X:123012815-123012837 TACTGTAACTGGTAGGTAGAAGG + Intergenic
1197461889 X:126752854-126752876 CAGGAACACTGGAAGGTAGACGG + Intergenic
1197734826 X:129843176-129843198 CAGGGAAACGAGAAGGTAGAAGG + Intronic
1199490855 X:148399024-148399046 CAGTGGGACCAGTAGGTAGAAGG - Intergenic
1200015415 X:153158767-153158789 CAATGGTGCTGGAAGATAGATGG - Intergenic