ID: 1157487039

View in Genome Browser
Species Human (GRCh38)
Location 18:48095358-48095380
Sequence CCTATTTGAGAGGAGAGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 166}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157487036_1157487039 15 Left 1157487036 18:48095320-48095342 CCAGAAGTCTGGTGGTCAGAGCA 0: 1
1: 0
2: 0
3: 16
4: 196
Right 1157487039 18:48095358-48095380 CCTATTTGAGAGGAGAGCCCTGG 0: 1
1: 0
2: 1
3: 19
4: 166
1157487034_1157487039 23 Left 1157487034 18:48095312-48095334 CCTTCAAGCCAGAAGTCTGGTGG 0: 1
1: 0
2: 0
3: 16
4: 162
Right 1157487039 18:48095358-48095380 CCTATTTGAGAGGAGAGCCCTGG 0: 1
1: 0
2: 1
3: 19
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157487039 Original CRISPR CCTATTTGAGAGGAGAGCCC TGG Intronic
900518212 1:3093249-3093271 CCGATGTCAGAGCAGAGCCCAGG + Intronic
900905325 1:5552940-5552962 CCAGGTGGAGAGGAGAGCCCAGG + Intergenic
903529410 1:24018699-24018721 CCTTGTTGAAAGGAGAGCACTGG - Intergenic
904469688 1:30728684-30728706 CTTATTTGGGAGGTGATCCCAGG - Intergenic
904769404 1:32872427-32872449 CCCGTTTGGGAGAAGAGCCCCGG + Intronic
905221473 1:36450736-36450758 CCTATAACAGAGGAAAGCCCAGG + Intergenic
906348393 1:45035971-45035993 TCTATTGGAGAGGGGAGCTCAGG + Intronic
906750190 1:48251858-48251880 TTTATTTCAGAGGAGATCCCAGG - Intergenic
907340203 1:53729892-53729914 CTTATTTGAGTGCAAAGCCCAGG - Intronic
909346311 1:74591510-74591532 CCTTTTTCAGAGGACTGCCCTGG - Intronic
916000592 1:160611576-160611598 GCTCTTTCAGAAGAGAGCCCAGG - Intronic
916031445 1:160880958-160880980 CCTATTGGAGAGGACAGCTGGGG - Intronic
920539389 1:206766728-206766750 CCCACTTGAGAGGATAGCCAAGG - Intergenic
1063919872 10:10921696-10921718 TCAGCTTGAGAGGAGAGCCCAGG + Intergenic
1064305731 10:14164357-14164379 GCTACATGAGAGGAGAGCACAGG - Intronic
1069054743 10:63832805-63832827 CCTAGTTGAGAAGAGGGCCCAGG + Intergenic
1072201716 10:93166055-93166077 TTTATTTGAGAGGTGATCCCAGG + Intergenic
1072465316 10:95657067-95657089 CCTATTTCCGAGGTGTGCCCGGG - Intergenic
1073692532 10:105826099-105826121 ACAATTTGAGAGTAGATCCCAGG - Intergenic
1074048841 10:109864637-109864659 CCCCTTTGAGAAGAGACCCCTGG - Intergenic
1075624080 10:123949142-123949164 CCTATTTGAGAGTTCAGGCCCGG + Intergenic
1078327836 11:10394982-10395004 CATGTTTGAGAAGAGAGCCATGG + Intronic
1082810148 11:57474676-57474698 ACTTTTTTAGAGGAGAGCACTGG - Intronic
1085398028 11:76217326-76217348 CCTATATAAGAGGGGACCCCAGG - Intergenic
1086155683 11:83663256-83663278 CAGATCTGAGAGTAGAGCCCTGG + Intronic
1086614253 11:88795860-88795882 CCTATTGTGTAGGAGAGCCCTGG + Intronic
1087890268 11:103530298-103530320 ACTATTTGAGAAAAGAGCCTAGG + Intergenic
1089295984 11:117468597-117468619 CCACTTTCTGAGGAGAGCCCTGG + Intronic
1089413961 11:118271482-118271504 GGCATTTGAGAGGTGAGCCCAGG + Intergenic
1089636560 11:119817463-119817485 CCTTCTTGAGAGGAGACCACAGG - Intergenic
1090900765 11:131028859-131028881 CCCATCTGAGAGAAGAGACCCGG - Intergenic
1091206458 11:133824533-133824555 TAAATGTGAGAGGAGAGCCCAGG - Intergenic
1091855921 12:3740113-3740135 CCTAGTTGAAAGGAGAGCCCTGG - Intronic
1094102035 12:26775083-26775105 TCTATTTGGGAGGTGATCCCAGG - Intronic
1095519542 12:43046284-43046306 CCTACTTGAGAGTAGAGGGCAGG + Intergenic
1096138907 12:49225986-49226008 CCTATGTAAGAGCAGGGCCCAGG + Intronic
1097445347 12:59664791-59664813 CCTATTTGAGAGAAGAGAGAGGG + Intronic
1099148031 12:79072859-79072881 CCTATTTGAGGGCAGAGACTTGG - Intronic
1101654402 12:106707404-106707426 GCTTTGTGAGAAGAGAGCCCAGG + Intronic
1102667918 12:114591956-114591978 TCTATTTGAGAGGTGACCCCTGG + Intergenic
1103024681 12:117563920-117563942 TTTATTTGAGAGGTGATCCCAGG - Intronic
1104241895 12:126998080-126998102 AGTATTAGACAGGAGAGCCCAGG - Intergenic
1105768264 13:23582014-23582036 CCTATGTGATAAGAGAGCCAGGG + Intronic
1107663046 13:42659054-42659076 GCTATGGGAGAGGAGAGCACAGG - Intergenic
1109987692 13:70011661-70011683 CCCATTTGAGAGAAAAGACCAGG + Intronic
1111046699 13:82823194-82823216 GCTGTTTTAGAGGTGAGCCCCGG - Intergenic
1114591224 14:23866510-23866532 TCTATTTCAGAGGCGACCCCAGG - Intergenic
1114881291 14:26789176-26789198 CCTATTTGAGAGAAGAGAAGGGG - Intergenic
1115889494 14:38011084-38011106 CCTGTGTGAGAGGGGAGCCATGG + Intronic
1117464798 14:55982487-55982509 CATATTTGAGAGGAGAGAGGTGG + Intergenic
1118686926 14:68300504-68300526 TTTATTTGAAAGGAGAGCGCTGG - Intronic
1121467142 14:94123252-94123274 CTTATTTGGGAGGTGATCCCAGG + Intergenic
1124794579 15:32764544-32764566 CCTATGTGAGGGTAGAGGCCTGG - Intergenic
1125521368 15:40349522-40349544 ACTATTTGAGTCTAGAGCCCGGG - Intergenic
1126693468 15:51306123-51306145 CCTTTATGAGAGGAGTGCTCAGG + Intronic
1129125640 15:73438625-73438647 TTTATTTGAGAGGCGATCCCAGG + Intergenic
1134274316 16:12762122-12762144 GCTAATTGAGAGGACAGCCTGGG + Intronic
1135192755 16:20368185-20368207 GCTATTGGAGAAGAGAGACCAGG + Intronic
1137009106 16:35306144-35306166 CCATTTTGAGAGAAGAGCCCTGG + Intergenic
1137022978 16:35448969-35448991 CCATTTTGAGAGAAGAGCCCTGG + Intergenic
1139345364 16:66299689-66299711 CCTATTTGAGAGGTGAGTTTTGG - Intergenic
1140572787 16:76128302-76128324 CCTACTTGAGAGCAGAGGGCGGG - Intergenic
1141144474 16:81519373-81519395 TCAATTTGAGAGCAGAGCCTGGG + Intronic
1141865722 16:86748642-86748664 CATATTTGGGAGGTGATCCCTGG + Intergenic
1141946096 16:87311036-87311058 CCTTTGTGGGAGCAGAGCCCAGG + Intronic
1143364047 17:6394172-6394194 CCCATTTGACATCAGAGCCCAGG + Intronic
1144703657 17:17353859-17353881 CCTAGGTGGGAGGAGAGCCTCGG + Intergenic
1147056859 17:37841417-37841439 CTTATTTGGGAGGTGATCCCCGG + Intergenic
1147861548 17:43526995-43527017 TCTATTTAACAGGAGAGCACCGG + Intronic
1148130613 17:45260569-45260591 CATCTGTGAGAGGAGAGCCGTGG - Intronic
1148848027 17:50540623-50540645 CCTATTTGACAAGTGACCCCAGG - Intronic
1152319502 17:79600571-79600593 CCCATTTGTGAGGAGACCCCCGG + Intergenic
1157487039 18:48095358-48095380 CCTATTTGAGAGGAGAGCCCTGG + Intronic
1158559619 18:58503053-58503075 CTTATTTGAGAGGGGATCCCAGG - Intronic
1159648412 18:70947679-70947701 CCTATTTGAGAGTAGAGGGTAGG + Intergenic
1162420147 19:10561492-10561514 GCTTGTTGAGAGGAGAGCTCAGG - Intronic
1164324956 19:24183000-24183022 TCTATTTGTGAAGTGAGCCCAGG + Intergenic
1167070372 19:47218551-47218573 CATTTCTGAGAGCAGAGCCCTGG + Intergenic
925669331 2:6294303-6294325 CCTATATGAGAGCAGGGCCTGGG + Intergenic
926227575 2:10979171-10979193 CCTAGTAGAGAGGAGAGAGCTGG + Intergenic
929337861 2:40772741-40772763 GCTTTTTGAGAAGAGAGCACAGG - Intergenic
931769936 2:65488821-65488843 TGTATTTGAGAGGCGACCCCAGG + Intergenic
935166706 2:100575544-100575566 CCTACTTCAGAGAAGAGCCCAGG - Intronic
935645529 2:105330344-105330366 CTTATTTGAGAAGGGAGGCCTGG + Intergenic
935736006 2:106107147-106107169 CAGCTTTGAGAGCAGAGCCCCGG - Intronic
935960547 2:108421723-108421745 CCTAGCTGAGAGCAGAGCACTGG + Intergenic
937091480 2:119209290-119209312 TTTATTTGGGAGGAGAGCTCAGG - Intergenic
937912994 2:127085219-127085241 CCTGCTGGAGAGCAGAGCCCAGG + Intronic
939713684 2:145556559-145556581 CATATTTCAGGGGAGAGGCCTGG - Intergenic
942235316 2:173898389-173898411 GTTATTTGAGAGGAGAGCAGGGG + Intergenic
943682333 2:190781610-190781632 CCTCTTTTAGAGGCGAGCTCTGG + Intergenic
945195111 2:207230301-207230323 CCAATTTGAGAGGAGAGGCTAGG - Intergenic
1168960190 20:1863830-1863852 CTTATTTGAGATGTGACCCCAGG + Intergenic
1169430454 20:5531602-5531624 GCTATTTGATAGGAGAGCTCTGG + Intergenic
1170539586 20:17374591-17374613 TTCATTTGAGAGGAGATCCCAGG + Intronic
1171214345 20:23341563-23341585 CTTATTTGAGAGGTGATCCCAGG + Intergenic
1171374815 20:24685345-24685367 TTTATTTGGGAGGTGAGCCCAGG - Intergenic
1172636099 20:36410944-36410966 TCTATTTGGGAGGTGATCCCAGG - Intronic
1173038849 20:39440962-39440984 CATATGTCAGAGGAGAGGCCTGG + Intergenic
1176454199 21:6894117-6894139 CATATTTCTGAGGAGATCCCGGG - Intergenic
1176832373 21:13759165-13759187 CATATTTCTGAGGAGATCCCGGG - Intergenic
1180623382 22:17177305-17177327 CCTTTTTGAGAGGAGCACCTTGG - Intergenic
1181319682 22:21994868-21994890 CCTATTGCAGAGGAGAGGCGAGG - Intergenic
1183739789 22:39663192-39663214 CCTAGACTAGAGGAGAGCCCAGG - Intronic
950164521 3:10784100-10784122 CCTGTTAGAGAGTAGAACCCTGG - Intergenic
950288155 3:11761450-11761472 CCTCTATGAGTGGAGAGCCCAGG - Intergenic
950690457 3:14651981-14652003 CCTGTTTGAGGGGAGAGGTCAGG - Intronic
951950806 3:28198559-28198581 CTTATTTGGGAGGTGATCCCGGG - Intergenic
953265243 3:41380719-41380741 CCTCATAGAGATGAGAGCCCAGG - Intronic
954443967 3:50536658-50536680 CCTAGTGGAGAGGAGAGACAGGG - Intergenic
956722256 3:72128482-72128504 TTTATTTGGGAGGAGAGCTCAGG - Intergenic
958887934 3:99749506-99749528 TCTCTTTGAGAGTAGAGCTCTGG - Intronic
961953400 3:130773847-130773869 GGTATTGGAGAGGAGAGGCCTGG - Intergenic
962412171 3:135150892-135150914 GCAGTTTGAGAGGAGAGCCCAGG - Intronic
963329529 3:143898726-143898748 CCTACTTGAGAGTAGAGGGCAGG + Intergenic
964378788 3:156075206-156075228 CTTATTTGGGAGGAGATTCCAGG + Intronic
971467417 4:26978402-26978424 CCTATTTAATAGGAGAGTGCTGG + Intronic
974807091 4:66894583-66894605 CCTCTTTGGGAGGGGAGGCCTGG - Intergenic
977432114 4:96943356-96943378 CCTTTTTGTGAGGACACCCCAGG - Intergenic
977896188 4:102368189-102368211 CCTAGTTGAGAGTGGAGCCAGGG + Intronic
979954816 4:126939774-126939796 CCCGTTTGAGGGTAGAGCCCTGG + Intergenic
981628053 4:146783916-146783938 ACCATTTGAGAGTAGAGTCCTGG - Intronic
984455454 4:179961282-179961304 CCTAGCTGAGAGGAGATGCCCGG - Intergenic
984865164 4:184274879-184274901 CCTAGTTGAGAAGAGGGCTCAGG - Intergenic
986042858 5:4010658-4010680 CCTATGTCAGGGGAGAGCCAGGG + Intergenic
986177270 5:5363272-5363294 TCTATTTGAGAGCTGAGACCAGG + Intergenic
986440078 5:7773090-7773112 CTTATTTGAGAGGTGAGCCACGG + Exonic
987968834 5:24915163-24915185 CCAACTTGAGAGGAGAGGGCAGG - Intergenic
990062714 5:51671944-51671966 CATATATGAGAGGAAAGCTCAGG - Intergenic
990352119 5:54929283-54929305 TTAATTTGAGAGGTGAGCCCAGG + Intergenic
991004872 5:61818169-61818191 CCTAGTTGTGAGTAGAGCCCAGG - Intergenic
992466909 5:77015260-77015282 CCTAGTTGAGAAGAGGGCTCAGG - Intergenic
995335451 5:110993294-110993316 CCTATTTGAGGGTGGAGGCCGGG + Intergenic
996101924 5:119452868-119452890 CCTGCCTGAGAGGAGAGGCCAGG + Intronic
999730384 5:154473036-154473058 CCTCTTTGGGAAGAGAGCCTTGG - Intergenic
999981529 5:156962501-156962523 CATATTTGAAATGAGAGACCTGG - Intronic
1000412916 5:160952596-160952618 ACTATTTCATAGGAGACCCCTGG - Intergenic
1001587274 5:172841544-172841566 CCTATTCGAGATGAGAGGCCTGG + Intronic
1004597951 6:17118729-17118751 CCTATTTGGGAGGAGAACAGTGG + Intronic
1006574808 6:35037434-35037456 CTTATTTGGGAGGTGATCCCAGG + Intronic
1006937986 6:37731834-37731856 CATCTTTAAGAGGAGAGGCCAGG + Intergenic
1007758681 6:44118533-44118555 CTCATTTCACAGGAGAGCCCTGG + Intronic
1008364236 6:50657564-50657586 CCTTTTTGAGGGTAGAGCCTAGG - Intergenic
1012345985 6:98186688-98186710 TTTATTTGAGAGGAGACCCCAGG - Intergenic
1014965265 6:127740060-127740082 GCCATTGGAGAAGAGAGCCCTGG + Intronic
1016388689 6:143553686-143553708 CCTAGTTGAGAAGAGGGCTCAGG + Intronic
1017330973 6:153198015-153198037 CCTATTTGAAGGGAAAGCCTCGG - Intergenic
1017970829 6:159311286-159311308 CCCATCTCAGAGGACAGCCCAGG + Intergenic
1019884607 7:3893020-3893042 CCAATTTGAGCGGGAAGCCCAGG + Intronic
1020353822 7:7255048-7255070 GCTATTAGGGAGGAGAGCTCAGG + Intergenic
1021249443 7:18306027-18306049 TTTATTTGGGAGGAGATCCCAGG + Intronic
1022417748 7:30192373-30192395 TCTATTTGGGAGGTGATCCCAGG - Intergenic
1023684898 7:42723846-42723868 CTTATTTGGGAGGTGACCCCAGG - Intergenic
1023863722 7:44229194-44229216 CCTCTTTGTGAGGAGGGCCCTGG - Intronic
1024517614 7:50272736-50272758 CTTATTTAAGAAGGGAGCCCAGG - Intergenic
1024711923 7:52025518-52025540 CCTGTCTGAGAGGAAAACCCTGG + Intergenic
1030076653 7:105742840-105742862 CCTGTTTTGGAGGAGGGCCCAGG - Intronic
1031597374 7:123663381-123663403 TCTATTTGAGAGGAACGCCTGGG + Intronic
1033937848 7:146610252-146610274 CCTAGGAGAGAGCAGAGCCCTGG + Intronic
1035476846 7:159149856-159149878 CCTTTTTGAGAGATGAGGCCCGG + Intergenic
1035629020 8:1094158-1094180 CCCATTTGGGAACAGAGCCCTGG + Intergenic
1035725051 8:1819060-1819082 CCTATTTGATGATAGAGCCCAGG + Intergenic
1039503716 8:38036216-38036238 ATTATTTGAAAGGAGAGGCCAGG + Intronic
1039886058 8:41654387-41654409 CCTCTTGGAGAGGCGAGCCAGGG - Intronic
1040008692 8:42642841-42642863 CCCATGAGAGAGCAGAGCCCTGG - Intergenic
1040884138 8:52241115-52241137 CCTATGCGAGAGGCAAGCCCAGG - Intronic
1041466841 8:58165809-58165831 CCTATCTGGGATGAGAGGCCGGG + Intronic
1042818366 8:72903203-72903225 TTTATTTGAGAGGTGATCCCTGG + Intronic
1047516211 8:125556787-125556809 TCTGTTTGTGAGGAGAGGCCAGG - Intergenic
1049347777 8:142147906-142147928 CTTACTTGGGAGGTGAGCCCTGG + Intergenic
1051709835 9:19920462-19920484 TTTATTTGGGAGGAGATCCCAGG + Intergenic
1054793104 9:69274160-69274182 CCTATGTGAGAGGTGATCCGAGG - Intergenic
1056888552 9:90468135-90468157 CGTATTTGAGAGATGAGCCCAGG + Intergenic
1058510967 9:105716225-105716247 CTTATTATAGAAGAGAGCCCTGG + Intronic
1061897086 9:133653858-133653880 CCCATTTGCCAGGACAGCCCTGG - Intronic
1186850354 X:13574006-13574028 TTTATTTGAGAGGTGACCCCAGG + Intronic
1187283425 X:17880556-17880578 CCTATTTGGGAGGTGATTCCAGG + Intergenic
1187555812 X:20350106-20350128 CTTATTTGAGAGATGATCCCAGG + Intergenic
1187622802 X:21077480-21077502 TTTATTTGAGAGGTGATCCCAGG + Intergenic
1187830959 X:23380589-23380611 TGTATTTGGGAGGTGAGCCCAGG + Intronic
1188035060 X:25308017-25308039 CCTATTTGAGAGTGGAGGGCAGG - Intergenic
1188403647 X:29779438-29779460 CCTATTTGAGAGGGGAGGGAGGG + Intronic
1188559913 X:31455918-31455940 CCAATTTGGTAGTAGAGCCCAGG - Intronic
1195382568 X:104284733-104284755 CTTATGTGGGAGGAGAGGCCAGG - Intergenic
1196244517 X:113384667-113384689 CCTATTTGTGAGGAAAGCCAAGG + Intergenic
1197647454 X:129033342-129033364 CCTATTGCAGAGGAAAGCCTTGG - Intergenic
1200903874 Y:8461512-8461534 TCTTATTGAGAGCAGAGCCCAGG - Intergenic