ID: 1157491179

View in Genome Browser
Species Human (GRCh38)
Location 18:48124871-48124893
Sequence TGCTCTGAGGACAGCAGCGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157491174_1157491179 -7 Left 1157491174 18:48124855-48124877 CCTCTCTCCACCTCTCTGCTCTG No data
Right 1157491179 18:48124871-48124893 TGCTCTGAGGACAGCAGCGGTGG No data
1157491169_1157491179 9 Left 1157491169 18:48124839-48124861 CCCCTTGCAGTTTTCCCCTCTCT No data
Right 1157491179 18:48124871-48124893 TGCTCTGAGGACAGCAGCGGTGG No data
1157491173_1157491179 -6 Left 1157491173 18:48124854-48124876 CCCTCTCTCCACCTCTCTGCTCT No data
Right 1157491179 18:48124871-48124893 TGCTCTGAGGACAGCAGCGGTGG No data
1157491170_1157491179 8 Left 1157491170 18:48124840-48124862 CCCTTGCAGTTTTCCCCTCTCTC No data
Right 1157491179 18:48124871-48124893 TGCTCTGAGGACAGCAGCGGTGG No data
1157491172_1157491179 -5 Left 1157491172 18:48124853-48124875 CCCCTCTCTCCACCTCTCTGCTC No data
Right 1157491179 18:48124871-48124893 TGCTCTGAGGACAGCAGCGGTGG No data
1157491171_1157491179 7 Left 1157491171 18:48124841-48124863 CCTTGCAGTTTTCCCCTCTCTCC No data
Right 1157491179 18:48124871-48124893 TGCTCTGAGGACAGCAGCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157491179 Original CRISPR TGCTCTGAGGACAGCAGCGG TGG Intronic