ID: 1157491237

View in Genome Browser
Species Human (GRCh38)
Location 18:48125294-48125316
Sequence CCTGCTGTGGAAGCCGTGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 121}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157491234_1157491237 -10 Left 1157491234 18:48125281-48125303 CCAGTAAGGGCTTCCTGCTGTGG 0: 1
1: 0
2: 1
3: 15
4: 144
Right 1157491237 18:48125294-48125316 CCTGCTGTGGAAGCCGTGTAAGG 0: 1
1: 0
2: 1
3: 8
4: 121
1157491230_1157491237 13 Left 1157491230 18:48125258-48125280 CCCAGATCTAAGTGGATTCTTAT 0: 1
1: 0
2: 1
3: 10
4: 135
Right 1157491237 18:48125294-48125316 CCTGCTGTGGAAGCCGTGTAAGG 0: 1
1: 0
2: 1
3: 8
4: 121
1157491231_1157491237 12 Left 1157491231 18:48125259-48125281 CCAGATCTAAGTGGATTCTTATC 0: 1
1: 0
2: 0
3: 7
4: 114
Right 1157491237 18:48125294-48125316 CCTGCTGTGGAAGCCGTGTAAGG 0: 1
1: 0
2: 1
3: 8
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157491237 Original CRISPR CCTGCTGTGGAAGCCGTGTA AGG Intronic
900519015 1:3096701-3096723 CCTGCTCCGGAAGCCTTGGAGGG - Intronic
903046463 1:20567651-20567673 CCTGCTGGGAAAGCCGTGGAGGG - Intergenic
907297493 1:53464705-53464727 GCTGCGGTGGAAGCGGTGGAAGG - Exonic
913218217 1:116638394-116638416 ACTGCTGTGGGAGACCTGTATGG - Intronic
914872795 1:151489429-151489451 CCTGCTGGAGAAGCCTTGTAAGG - Intergenic
916658593 1:166900177-166900199 CCTGCTGTGGAGGGCATGAAAGG - Intergenic
1063139265 10:3242065-3242087 CCTGCTCTGCAAGCCATGTCTGG + Intergenic
1069557271 10:69406589-69406611 CCGGCAGTGGAAGCAGTGGATGG - Intronic
1070264051 10:74885698-74885720 CCTGCTGGGGAGGCCTTGAAAGG + Intronic
1074579317 10:114703332-114703354 GCTGCTGTGGCAGCAGAGTAGGG - Intergenic
1074786371 10:116845446-116845468 ACTGCATTGGAAGGCGTGTATGG - Intergenic
1078874418 11:15378970-15378992 CCCACAGTGGAAGCTGTGTATGG + Intergenic
1079638384 11:22773802-22773824 CCTGCTGTGGAAGCGAGGTCAGG - Intronic
1080746461 11:35112549-35112571 CTTTCTGTGGAAGCCGTTTCTGG - Intergenic
1081333315 11:41831337-41831359 ACTGTGGTGGAAGCCGTGGAGGG + Intergenic
1081848225 11:46256484-46256506 CCTGAGGTGGAAGCCATGTGTGG - Intergenic
1093383402 12:18521743-18521765 CCTGCTGTCTAAGCCCTGTGAGG - Intronic
1096527131 12:52217011-52217033 CCTGCTGGGGAAACAGTGAAGGG + Intergenic
1105207088 13:18233908-18233930 CCTGTTGGCGAAGCCGTGGATGG - Intergenic
1105986370 13:25571200-25571222 CCTGCTGGGGAAGCTGTGCATGG + Intronic
1109622115 13:64924754-64924776 CCAGCTGTGGAAGCTGTTTGTGG - Intergenic
1109982374 13:69924855-69924877 CCAGCTGTGGAAGCTGTTTGTGG + Intronic
1113328045 13:109301849-109301871 CCTGCTCTGGGAGCCATGAAAGG + Intergenic
1115457669 14:33623471-33623493 ACTGCAGTGGTAGCCGTGAAGGG - Intronic
1118155417 14:63236237-63236259 CCTGCTGTGTAAGCCAGCTATGG + Intronic
1126215315 15:46147032-46147054 CCAGCTGTGGAAGCTGTTTGTGG + Intergenic
1127377060 15:58394616-58394638 CCTGCTGTGGCTGCCTTGTGTGG - Intronic
1128107468 15:65055274-65055296 CCTGGTGAGGAAGCAGTGTGAGG + Exonic
1129348127 15:74937653-74937675 CCTGCTGTGGGCGCCGAGGAGGG - Intronic
1130183293 15:81652471-81652493 CCAGCTGTGGAAGCCGCTTGTGG + Intergenic
1132652571 16:1028315-1028337 CCCGCTGTGGGACCCGTGTAGGG - Intergenic
1132693828 16:1193368-1193390 CCTGCTGTGGAAGCCGTGCCAGG - Intronic
1134239964 16:12498414-12498436 CTTGCTTGGGAAGCAGTGTAGGG + Intronic
1135054320 16:19218430-19218452 CCTGTTGTGCATGCTGTGTATGG + Intronic
1136276104 16:29180343-29180365 CCTGCAGTGGCAGCCGTGGCTGG + Intergenic
1136591252 16:31219091-31219113 TCTGCTGTGGCAGCTGTGTCTGG - Exonic
1136656393 16:31711744-31711766 CCTGCTGTGGAAGCCTGGACTGG + Intergenic
1136712838 16:32253956-32253978 GCTGCTGTGGAGGCCATGAAAGG - Intronic
1136755078 16:32675473-32675495 GCTGCTGTGGAGGCCATGAAAGG + Intronic
1136813035 16:33194896-33194918 GCTGCTGTGGAGGCCATGAAAGG - Intronic
1136819511 16:33304976-33304998 GCTGCTGTGGAGGCCATGAAAGG - Intronic
1136826074 16:33361511-33361533 GCTGCTGTGGAGGCCATGAAAGG - Intronic
1136831140 16:33460282-33460304 GCTGCTGTGGAGGCCATGAAAGG - Intronic
1136934674 16:34449160-34449182 CTTGCTGTGAAAGCTGTGAAAGG + Intergenic
1136969898 16:34962654-34962676 CTTGCTGTGAAAGCTGTGAAAGG - Intergenic
1138658614 16:58504520-58504542 CCTGCTCTGGATGACATGTATGG + Intronic
1140206312 16:72936636-72936658 GCTGCTGTGGCTGCAGTGTAGGG + Intronic
1140241197 16:73202599-73202621 CCTGCTGTGGAATTCCTGTCTGG - Intergenic
1141700882 16:85641494-85641516 CCTGCCCTGGGAGCCTTGTAGGG + Intronic
1142080483 16:88146405-88146427 CCTGCAGTGGCAGCCGTGGCTGG + Intergenic
1202991613 16_KI270728v1_random:17866-17888 GCTGCTGTGGAGGCCATGAAAGG - Intergenic
1203057220 16_KI270728v1_random:935812-935834 GCTGCTGTGGAGGCCATGAAAGG + Intergenic
1143612051 17:8024348-8024370 CCTGTTGTGGAAGCAGTAGAAGG - Intergenic
1144042073 17:11420872-11420894 CCTGCTATGGAAGCTGGGAAGGG - Intronic
1153549548 18:6247309-6247331 CCTGCTTTGCAGGCGGTGTATGG - Intronic
1155169228 18:23254912-23254934 CATGCTGTGGGGGCTGTGTATGG + Intronic
1155982641 18:32196730-32196752 CCTGCTGGTGAAGCAGTGCAGGG + Intronic
1157491237 18:48125294-48125316 CCTGCTGTGGAAGCCGTGTAAGG + Intronic
1158538972 18:58335386-58335408 ACTGCTGTGGCAGCGCTGTAAGG - Intronic
1160505827 18:79426485-79426507 ACTGCTGTGGGACCCGTGTCGGG + Intronic
1161696670 19:5772625-5772647 CCAGCTGAGGATGCCGTGTGTGG - Intronic
1161871658 19:6875147-6875169 CCTTCTGGGGAAGCGGGGTAGGG + Intergenic
1167650465 19:50725745-50725767 CCTGCAGGGGAAGCCGGGAAGGG + Intergenic
925834860 2:7934717-7934739 ACTGCTGTCTAAGCAGTGTATGG + Intergenic
927826221 2:26311825-26311847 CCTGCAGTGGGGGCCGAGTAGGG + Exonic
929765250 2:44838723-44838745 ACTGCTGTCGATGCCGTGGAAGG - Intergenic
931300626 2:60974677-60974699 TCAGCTGTGGAAGCTGTTTATGG + Intronic
934640207 2:96023365-96023387 GCTGCTGTGGAAACCGAGTGGGG - Exonic
934793438 2:97082035-97082057 GCTGCTGTGGAAACCGAGTGGGG + Intergenic
937651423 2:124323605-124323627 GGTGCTGTGGAAGCTGTGTCAGG - Intronic
942429201 2:175891838-175891860 CCAGCTGGGGAAGCCGGGAAAGG + Intergenic
942877994 2:180825846-180825868 CCTGAGCTGGAAGCCATGTATGG + Intergenic
943441839 2:187935088-187935110 CCTGCATTGGAAGCTGTTTATGG - Intergenic
946199033 2:218060411-218060433 CTTGCTGATCAAGCCGTGTATGG + Intronic
946614714 2:221497110-221497132 CCTGCTGTGGAGGCAGTTTGGGG + Intronic
948266435 2:236638413-236638435 CCTACTCTGGAAGCTGTGTCAGG + Intergenic
1172603964 20:36202221-36202243 CCTGCTGTGGAAGAGCTGGATGG - Intronic
1173310925 20:41895280-41895302 ACTGCTGGGGAAGCCGTATTAGG + Intergenic
1175514353 20:59559508-59559530 CCTGCTGTGGGAGGAGTGCAGGG + Intergenic
1178576272 21:33794835-33794857 CCTGCTGGAGAAGCCCTGTGTGG - Intronic
1180819523 22:18816474-18816496 ACTGCTGTGGGAGACCTGTATGG - Intergenic
1181205749 22:21250919-21250941 ACTGCTGTGGGAGACCTGTATGG - Intergenic
1184724964 22:46338746-46338768 CCTGCAGTGGAAGGAGTGTAGGG + Intronic
1184946660 22:47808708-47808730 CCTGCGGTGGAAGCAATGTGTGG - Intergenic
1203221172 22_KI270731v1_random:44494-44516 ACTGCTGTGGGAGACCTGTATGG + Intergenic
1203269653 22_KI270734v1_random:42327-42349 ACTGCTGTGGGAGACCTGTATGG - Intergenic
949192585 3:1267845-1267867 TCTGCTGAGGAAGCCCTGAATGG - Intronic
951022134 3:17792591-17792613 TCTGCTGTGGAAGCTGGATATGG + Intronic
953780853 3:45869232-45869254 CCTGCTGTGCAAGGAGTGCATGG + Intronic
954083238 3:48224599-48224621 CCAGCTGGTGAAGCGGTGTATGG + Exonic
957775768 3:84756221-84756243 CCCACAGTGGAAGCCGCGTATGG - Intergenic
959476895 3:106822319-106822341 CCTGCAGTGGAAGCTGTTTGTGG + Intergenic
961814644 3:129543252-129543274 CCTGCTGTGGAAGTCGAGGAGGG - Exonic
970455270 4:16217165-16217187 GGTACTGTGGAAGCCGAGTAGGG - Intronic
971723853 4:30282931-30282953 AATGATGTGGAAGCCGTTTAGGG + Intergenic
973025588 4:45265975-45265997 CCTACTGTAGAAACAGTGTAGGG + Intergenic
974686721 4:65241478-65241500 CCTGCAGTGGAAGCCATTTGTGG - Intergenic
975913777 4:79298505-79298527 CCAGCTGTGGAAGCTGCTTATGG + Intronic
985530303 5:430086-430108 CCTGCTGTGGCAGGCGCGTTGGG + Intronic
985935221 5:3092424-3092446 CCTGCTGGGGAGGCCGTGGGTGG - Intergenic
986190292 5:5490880-5490902 CCTGCTGGGGCAGCCCTGCAAGG + Intergenic
988110042 5:26807900-26807922 CCTGCAGTGGAAGCCGCCTGTGG + Intergenic
989264665 5:39459013-39459035 CCTGCTGAAGATGCCGTCTAAGG + Intronic
991370446 5:65913745-65913767 CCTGCTGTGTAATCCCTGCACGG - Intergenic
992511348 5:77438667-77438689 CCTGCAGTGGAAGCTGTTGAGGG + Intronic
992838821 5:80667701-80667723 CCAGCTGTGGAAGCTGTTTGTGG - Intronic
999573984 5:152953445-152953467 CCTGCTGTGCAAGCAGGGTCTGG - Intergenic
1002422966 5:179159226-179159248 CCTTCTGTGGAGGCCTTGCACGG - Intronic
1004471505 6:15933608-15933630 GATGCTTTGGAAGCCATGTATGG - Intergenic
1006511008 6:34521180-34521202 CGTGCTGTGGATGCCGTGTCCGG + Intronic
1018913241 6:168116455-168116477 CCTCCAGTGGAAGCCCTGTCTGG - Intergenic
1020719607 7:11724841-11724863 CCTGCTGTGGAGGCTGAGTGTGG + Intronic
1030981744 7:116193731-116193753 CTTGCTGTGATAGCCGGGTAAGG - Intergenic
1036787411 8:11697456-11697478 CCAGCTGGGGAAGCGGTGTTCGG + Intronic
1037582728 8:20255134-20255156 CTTGCTGTGGAAGCTGTGGCCGG + Exonic
1039641464 8:39227653-39227675 CCTGCTGTGGCTGCTGTGTGGGG - Intronic
1040011631 8:42666005-42666027 CCTGCTGTGGGTGCAGTGTGAGG - Intergenic
1041527514 8:58823774-58823796 CCTGCTCTGGATGCAGAGTATGG + Intronic
1043082446 8:75783919-75783941 CCAGCTGTGGAAGCTGTTTGTGG - Intergenic
1044412333 8:91897552-91897574 CCTACTGTGTGAGCCGTGTGTGG - Intergenic
1045910373 8:107400500-107400522 CCTGCTGAGGAAGCAGTGATTGG - Intronic
1045986708 8:108257496-108257518 CTTACTGTGGAAGGGGTGTAGGG - Intronic
1049013453 8:139903561-139903583 TCTGCTGTGGAAGCAGGGGAGGG - Intronic
1051329817 9:16012284-16012306 CTTGGTGTGGAAGTTGTGTAGGG + Intronic
1055098536 9:72439508-72439530 CCTACTGGGGAAGCCATGTTAGG + Intergenic
1055816628 9:80213698-80213720 CCTGCAGTGGAAGCCGCTTGGGG + Intergenic
1058112086 9:101041721-101041743 CCTCCTGGGGAAGCTGTGTAAGG + Intronic
1062025639 9:134338987-134339009 CCTGCTGTGGATGCCTTGCTTGG + Intronic
1189122788 X:38413030-38413052 CATGCAGTGGAAGCCGTCTTCGG - Intronic
1189297201 X:39927297-39927319 CCTGATGTGGAAACGGTGTGTGG - Intergenic
1191800818 X:65077363-65077385 CCTGCAGTGGAAGCAGAGAAGGG - Intergenic