ID: 1157491526

View in Genome Browser
Species Human (GRCh38)
Location 18:48127121-48127143
Sequence CCCCATTTGCAAAATGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 727
Summary {0: 1, 1: 3, 2: 22, 3: 140, 4: 561}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157491526_1157491531 -4 Left 1157491526 18:48127121-48127143 CCATCCCCATTTTGCAAATGGGG 0: 1
1: 3
2: 22
3: 140
4: 561
Right 1157491531 18:48127140-48127162 GGGGAAACTGTAGCACAGAGAGG 0: 1
1: 9
2: 160
3: 1184
4: 3853
1157491526_1157491533 21 Left 1157491526 18:48127121-48127143 CCATCCCCATTTTGCAAATGGGG 0: 1
1: 3
2: 22
3: 140
4: 561
Right 1157491533 18:48127165-48127187 AAGTAACTAGTCCAAGGCCACGG 0: 1
1: 2
2: 8
3: 39
4: 202
1157491526_1157491532 15 Left 1157491526 18:48127121-48127143 CCATCCCCATTTTGCAAATGGGG 0: 1
1: 3
2: 22
3: 140
4: 561
Right 1157491532 18:48127159-48127181 GAGGTTAAGTAACTAGTCCAAGG 0: 1
1: 50
2: 427
3: 1708
4: 4427

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157491526 Original CRISPR CCCCATTTGCAAAATGGGGA TGG (reversed) Intronic
900427995 1:2589186-2589208 CCCCACTTGCAGAGTGGGGCAGG + Intronic
901588886 1:10322362-10322384 CCCCATCTACATAATGGGGTTGG + Intronic
901809571 1:11759834-11759856 CCTCATATGTAAAAGGGGGATGG - Intergenic
902233524 1:15043397-15043419 CCCCTTATGTAAAATGGGGCAGG - Intronic
902244032 1:15107545-15107567 CCTCATTTGTAAAATGAGTATGG + Intronic
902407454 1:16192454-16192476 CCCCATCTGCAAAATGGGGACGG - Intergenic
902623468 1:17663748-17663770 CCCCATCTGTAAAATGGGGTGGG - Intronic
902744707 1:18465911-18465933 CCCCATCTGTAAAATGGGTGGGG - Intergenic
903137726 1:21320286-21320308 TCTCATTTATAAAATGGGGATGG + Intronic
903177501 1:21589817-21589839 CCCCATCTGTACAATGGGCAGGG - Intergenic
903189016 1:21646054-21646076 CCTCATCTGTAAAATGGGGATGG + Intronic
903292210 1:22321447-22321469 CCCCTTTTGTGAAAGGGGGATGG - Intergenic
903497990 1:23784014-23784036 CCTCATCTGTAAAATGGGAATGG - Intronic
903740355 1:25555089-25555111 CCTCATCTGTAAAATGGGGGTGG + Intronic
903812413 1:26042091-26042113 CCCCATCTGTCAAATGGGGACGG - Intronic
903817792 1:26077664-26077686 TCTCATCTGTAAAATGGGGATGG - Intergenic
903885100 1:26536510-26536532 CCCCATCTGTAACATGGGGTGGG - Intronic
903898083 1:26621627-26621649 CCCCATCTCTAAAATGGGGAAGG - Intergenic
904047524 1:27617390-27617412 CCCCATGTGTAAAATGGGGCTGG + Intronic
904054901 1:27663537-27663559 CCCAGATTGTAAAATGGGGAAGG - Intergenic
904273188 1:29363678-29363700 CTGCATCTGTAAAATGGGGATGG - Intergenic
904318934 1:29684035-29684057 CCCCATCTATAAAATGGGGATGG + Intergenic
904382675 1:30121944-30121966 GCTCATTTGCAAAGTGGGGAAGG - Intergenic
904388471 1:30163152-30163174 CCTCCTTTGGAAAACGGGGATGG - Intergenic
904533581 1:31184376-31184398 CCACATTTGTTAAATGGAGAAGG + Intronic
904763723 1:32824928-32824950 CCTCATTTACAAAATGGGAAAGG - Intronic
904882927 1:33714390-33714412 CCTTATCTGCAAAATAGGGATGG - Intronic
904917725 1:33982455-33982477 CCTCATTAGCAAACTGTGGAAGG + Intronic
904944346 1:34188482-34188504 CTTCATCTGCAAAGTGGGGATGG - Intronic
905095515 1:35466803-35466825 CCCTATTTCCAAAATGGAAAAGG + Intronic
905270914 1:36786896-36786918 CCTCATCTGGAAAATGGGGTTGG - Intergenic
905531035 1:38678842-38678864 CCTCATCTGCACTATGGGGATGG + Intergenic
905827090 1:41034074-41034096 CCTCATGTGCAAACTGGAGATGG - Intronic
906002075 1:42435139-42435161 CTCCATCAGCAACATGGGGAAGG + Intronic
906559790 1:46748082-46748104 CCCCATCTGGAAAATAGAGATGG - Intergenic
907289797 1:53406484-53406506 CCCCATGTGTAAAATGGAGATGG - Intergenic
907305110 1:53508987-53509009 CCCCCTCTGTAAAGTGGGGATGG + Intronic
907331464 1:53674490-53674512 CCACATGTGTAAAATGGGGACGG + Intronic
907878580 1:58520383-58520405 TCCCATTTTCAAATTGGGCAAGG - Intronic
908703674 1:66928114-66928136 CCACATTTATAAAAAGGGGAAGG + Intronic
908983030 1:69981902-69981924 CCTCATCTATAAAATGGGGATGG - Intronic
909115574 1:71531041-71531063 TTCCATTTGTAAAATGGGGTGGG - Intronic
910226753 1:84943739-84943761 TCCCACCTACAAAATGGGGAGGG + Intronic
910508708 1:87979464-87979486 CCCCAATTACAGAATGTGGATGG - Intergenic
910743504 1:90547880-90547902 CCTCATCTGTAAAATGGGGCTGG + Intergenic
910803006 1:91164202-91164224 CCCCCTTTGTAAAATGGGGTTGG - Intergenic
911198160 1:95016921-95016943 CCCCTTTTGCAAAATTGCAAGGG - Intronic
911498266 1:98656783-98656805 CCTCATCTGTAAAATGGGGATGG + Intergenic
911532839 1:99065984-99066006 CTCAAATTGCAAAATGGGGAGGG - Intergenic
911708117 1:101038994-101039016 CAGCATGTGCAAAATGGTGATGG - Intergenic
912346673 1:108969358-108969380 CCCCAGGAGCAATATGGGGAGGG - Intergenic
913355565 1:117917560-117917582 CCTCATCTCTAAAATGGGGATGG - Intronic
915892163 1:159782374-159782396 CCCCATCGACAACATGGGGAAGG - Exonic
916578443 1:166087365-166087387 CCTCCTTTGCAAAATGGAGATGG - Intronic
916673844 1:167049672-167049694 CCTCATCTGTAAAATGGAGAGGG + Intergenic
919927641 1:202200575-202200597 TGCCATTTCCAACATGGGGAAGG - Intronic
920092893 1:203466683-203466705 CCTCATCTGTAAAGTGGGGATGG + Intergenic
920689072 1:208131967-208131989 CCCCGTTTGACAAATGAGGAAGG - Intronic
923755263 1:236785839-236785861 CCCCACCTTCAAACTGGGGAGGG + Intergenic
924673554 1:246152809-246152831 CCACATCTGCAAAATGGGGATGG + Intronic
1062843959 10:690334-690356 CCCCATCTGTGAAAAGGGGATGG + Intergenic
1064241401 10:13632786-13632808 CACGATTTGGAAATTGGGGAAGG - Intronic
1065182397 10:23139798-23139820 CCCCATCTCCAAACTAGGGATGG - Intergenic
1065319474 10:24495731-24495753 GCCCAGCTGCAATATGGGGATGG + Intronic
1067229116 10:44394764-44394786 CCTCACTGGCGAAATGGGGATGG - Intergenic
1067303802 10:45039342-45039364 CCCTATTTGAAAAATGGTGCTGG + Intergenic
1067348506 10:45455528-45455550 ACCCAGGTGCAAAATGGGGGGGG + Exonic
1067585772 10:47475159-47475181 CCTCATTTGTACAATGGGGGTGG + Intronic
1067897316 10:50197629-50197651 TCTCATTTGCAAAATGGGAATGG - Intronic
1067951656 10:50744391-50744413 TCTCATTTGCAAAATGGGAATGG + Intronic
1068709920 10:60122604-60122626 CTGCATTTTCAAACTGGGGATGG + Intronic
1068785551 10:60968614-60968636 TCTGATTTTCAAAATGGGGAGGG + Intronic
1068936550 10:62640593-62640615 CACACTGTGCAAAATGGGGATGG - Intronic
1069849905 10:71397737-71397759 CCCCATTTGGACAGTGGGGATGG + Intronic
1070394764 10:76002497-76002519 CTACATCTGTAAAATGGGGATGG + Intronic
1070626466 10:78054514-78054536 CCTCATCTGCAAAAGCGGGAAGG - Exonic
1070658576 10:78288714-78288736 CCCCATTTTACAGATGGGGAAGG - Intergenic
1070770962 10:79082141-79082163 GCCGCTTTGCAAAATGAGGAAGG - Intronic
1071040074 10:81296887-81296909 CCTCATTTAAAAAATGGGAAAGG - Intergenic
1071277153 10:84065729-84065751 CTCCATCTGCAAAATGGTGGTGG - Intergenic
1071400282 10:85261955-85261977 CCTCATTTGCAAAATAAGGTAGG + Intergenic
1072170070 10:92849820-92849842 CCTTATTTGTAGAATGGGGAGGG + Intronic
1072592445 10:96839187-96839209 CCCAATTTTAAAAATGGGCAAGG - Intronic
1072620059 10:97073798-97073820 TCTCATCTGCAACATGGGGATGG + Intronic
1072626033 10:97112575-97112597 CCTCATCTGTGAAATGGGGATGG - Intronic
1072733378 10:97863224-97863246 CCTCACCTGTAAAATGGGGATGG + Intronic
1072772178 10:98151359-98151381 CCTCATTTGTAAAATGGAGGTGG + Intronic
1073178076 10:101568731-101568753 CTTCATCTGCAAAATGGGGATGG + Intergenic
1073541904 10:104321751-104321773 ACCCATCTGCAAAACAGGGATGG - Intronic
1073584658 10:104698204-104698226 CCACATCTGTAAAATGGGGCTGG - Intronic
1074102666 10:110365728-110365750 CCTCATCTGTAAAATGGGAATGG + Intergenic
1074446402 10:113524688-113524710 ACCCATCTGTACAATGGGGATGG - Intergenic
1074596945 10:114876453-114876475 CCTTATCTGTAAAATGGGGATGG + Intronic
1074892209 10:117745025-117745047 CCTTATTGGCAAAATGAGGATGG + Intergenic
1074921323 10:118016820-118016842 CCTCATCTGTAAAATGGAGATGG + Intronic
1075025884 10:118982725-118982747 CCTCATCTGCAAAATGGGAGAGG - Intergenic
1075247805 10:120839582-120839604 CTTCATTTACAAAATGGGGTTGG + Intergenic
1075659051 10:124180761-124180783 CCCCATCTGTAAATTGGGGTGGG - Intergenic
1076516753 10:131049965-131049987 CCCCATTTGTTAGGTGGGGAAGG - Intergenic
1077886482 11:6391280-6391302 CTCCATTTCCAAACTGGGGCTGG - Intronic
1078083842 11:8222026-8222048 CCCCATTTCCCAGATGAGGATGG + Intergenic
1078527608 11:12112058-12112080 CCCCATCTCTAAAATGGGGAGGG - Intronic
1078557573 11:12342729-12342751 CCTCCTGTGGAAAATGGGGATGG - Intronic
1078850196 11:15156681-15156703 CTCCATCTGTAGAATGGGGATGG + Intronic
1079032357 11:16995123-16995145 CCTCATCTGAAAAATGGGGATGG - Intronic
1079637452 11:22761750-22761772 CCCCATCTGTAAAATGGAAATGG - Intronic
1079963779 11:26955483-26955505 CATCATTTGCAAAATGTTGATGG - Intergenic
1080846153 11:36028895-36028917 CCTCATCTGCAAAATGGAAATGG + Intronic
1080911225 11:36601083-36601105 CTCCATTTATAAAATGGGGATGG - Intronic
1081650248 11:44818907-44818929 CCCCATTTGCCAAATGGCCTAGG + Intronic
1081679022 11:44988918-44988940 CCTCACCTGCAAAATGGAGATGG + Intergenic
1083237937 11:61363847-61363869 TCTCATCTGTAAAATGGGGAAGG + Intronic
1083889262 11:65587843-65587865 CCTCATCTGTAAAGTGGGGAGGG + Intronic
1084539470 11:69776877-69776899 CCCCATTTGCAAAATGACATGGG + Intergenic
1084551278 11:69843633-69843655 CCCCATTTTAAAAATGAGGAGGG + Intergenic
1084966642 11:72748078-72748100 CCTCATGTGGAAAATGGGAATGG + Intronic
1084980367 11:72825613-72825635 CCAGATTTGCAGGATGGGGAGGG + Intronic
1085391811 11:76185966-76185988 CCCCATTTGTAAAATGGGAGTGG - Intergenic
1085620335 11:78033036-78033058 CCTCATCTGCAAAATGAGGAGGG + Intronic
1085640160 11:78188441-78188463 TCCCATCTGTGAAATGGGGATGG - Intronic
1086013226 11:82131398-82131420 CCCTGTTTGAAAAATGGGGCGGG + Intergenic
1086400136 11:86454601-86454623 CCCAATCTGTAAAATGAGGATGG - Intronic
1089042780 11:115469373-115469395 TTCCATTTATAAAATGGGGAAGG - Intronic
1090358320 11:126155565-126155587 TTCCATCTGTAAAATGGGGATGG - Intergenic
1090720174 11:129465409-129465431 CCCATTTTCCAAAATTGGGAAGG - Intergenic
1091003832 11:131933947-131933969 CCTCATTTTTAAAATTGGGATGG - Intronic
1091157710 11:133388955-133388977 CCTCATCTGCAACATGGGGATGG - Intronic
1091627793 12:2136341-2136363 CCCCATTTTAAAGATGAGGAAGG + Intronic
1091901477 12:4147507-4147529 CCTCATTTGCAAAACAAGGATGG + Intergenic
1092039776 12:5374026-5374048 CCTCATCTGTAAGATGGGGATGG - Intergenic
1092364962 12:7870252-7870274 CCCCATCTGCAAAATGAGCAAGG + Intronic
1094069816 12:26400874-26400896 CCTCATCTGTAAAATGGGGAGGG + Intronic
1094179829 12:27580425-27580447 CCACATCTGTAAAATGGGGATGG + Intronic
1095395131 12:41754190-41754212 CCCCTTCTGCCAAATGAGGATGG + Intergenic
1095481358 12:42639278-42639300 CCCTATTTGTAAAATGAGGAGGG - Intergenic
1096470293 12:51871396-51871418 CCACATTAGCAAAATGGTGGGGG + Intergenic
1096670375 12:53195013-53195035 CCTCATCTGTAAAATAGGGATGG + Exonic
1097500241 12:60392466-60392488 CCCCACCTACAAGATGGGGAAGG + Intergenic
1097614543 12:61868232-61868254 CCTCATCTACAAAATGGGGATGG - Intronic
1098457008 12:70685851-70685873 TCCTATCTGAAAAATGGGGAAGG - Intronic
1098615921 12:72522092-72522114 CCTCATCTGTAAAATGGAGATGG - Intronic
1101415863 12:104507507-104507529 CCCCATTTGTAAAATGGTAATGG + Intronic
1101422754 12:104562958-104562980 CCCCATCTGTGAAATGGGTATGG + Intronic
1101659724 12:106754887-106754909 CTCCATCTGTAAAATGGGGTGGG + Intronic
1101841579 12:108331249-108331271 TCCCATCTGTGAAATGGGGATGG - Intronic
1101842354 12:108337355-108337377 CACCATCTGTAAAATGGGGTGGG - Intronic
1102016652 12:109652435-109652457 CCTCATCTGTAAAATGGGGCGGG + Intergenic
1102131978 12:110538750-110538772 CCTCATCTGCAAAACGGGGATGG + Intronic
1102171412 12:110845464-110845486 CCCCATCTGTAAAATGAGGATGG + Intergenic
1102469247 12:113150294-113150316 CAGCATCTGTAAAATGGGGAGGG + Intronic
1102514717 12:113438659-113438681 CTGCATCTGTAAAATGGGGATGG - Intergenic
1102560225 12:113756789-113756811 TCCCATCTGTAAAATGGGGCTGG - Intergenic
1102801690 12:115740670-115740692 CTCCATCTGTAAAATGGGGGTGG + Intergenic
1103475694 12:121216961-121216983 CCACTTCTGCCAAATGGGGATGG - Exonic
1103822952 12:123712787-123712809 CCCCGTCTGGACAATGGGGACGG - Intronic
1103956078 12:124577615-124577637 CCTCATCTGTAAAATGGGGCTGG + Intergenic
1104152118 12:126093905-126093927 TCTCATCTGCTAAATGGGGATGG - Intergenic
1104157515 12:126148165-126148187 CTCCATCTGGAAAATGAGGATGG - Intergenic
1104199012 12:126568956-126568978 CCTGATGTGGAAAATGGGGAAGG + Intergenic
1104379586 12:128295434-128295456 TCTCATCTGTAAAATGGGGATGG - Intronic
1104481115 12:129109344-129109366 TCTCCTCTGCAAAATGGGGATGG + Intronic
1104614201 12:130254919-130254941 CCCCATTCGCAAACAGGTGAGGG - Intergenic
1105484489 13:20813362-20813384 TCCCATTAGGAAAATGGGCAAGG + Intronic
1106074426 13:26445450-26445472 CCTCATTTATAAAATGGAGATGG + Intergenic
1107303531 13:38993144-38993166 TCTCATCTGTAAAATGGGGATGG + Intergenic
1107422667 13:40263379-40263401 CCTCATTTGAAAAATGGAAATGG + Intergenic
1107631654 13:42349212-42349234 CCTCATCAGCAAAATGGGGATGG - Intergenic
1107849251 13:44553686-44553708 CCCCATTTAAAAAAAGGGAAAGG + Intronic
1107998820 13:45888157-45888179 CCTCATCTGCAAAAGAGGGATGG - Intergenic
1108687399 13:52832597-52832619 CCACATCAGCAAAATGGGAATGG + Intergenic
1108705287 13:52979941-52979963 CCTTATTTGCAAAATGTAGATGG + Intergenic
1109374281 13:61469520-61469542 TACCATTTGCAAAATTGTGACGG + Intergenic
1109470634 13:62799472-62799494 CCCCACTTTCAAGATGGGGAAGG + Intergenic
1110434604 13:75465098-75465120 CCTCATTTATAATATGGGGATGG - Intronic
1111861733 13:93715730-93715752 TCTCATGTGCAAAATGGGAATGG + Intronic
1112373758 13:98819548-98819570 CCACATTTGCAAAATGAAGTAGG + Intronic
1113677320 13:112215595-112215617 CCCTATTCACAAAACGGGGATGG - Intergenic
1114262668 14:21049606-21049628 GCTCATTTGCAACATGAGGAAGG - Intronic
1114411354 14:22503532-22503554 TCTCATCTGTAAAATGGGGATGG + Intergenic
1115823718 14:37240816-37240838 CCACATTTTCAAAATTTGGAGGG - Intronic
1116001968 14:39253416-39253438 CCTAATTTGAAAAATGGGGAGGG - Exonic
1116541536 14:46107726-46107748 CCTCATTTTCAAGCTGGGGAAGG - Intergenic
1116815367 14:49578988-49579010 CCTCATTTGTAAAATGGGGACGG + Intronic
1117219953 14:53593575-53593597 GCCAATTTGCAAAATGGAGAAGG - Intergenic
1118145701 14:63133358-63133380 CCCAATTTTAAAAATGGGCAAGG + Intergenic
1118584188 14:67336695-67336717 CCTCATCTGCAAAGTGGAGATGG + Intronic
1118595180 14:67429903-67429925 CTTCATTTGTAAAATGAGGAAGG - Intergenic
1118609181 14:67526853-67526875 CCCCTTTTACAAAGAGGGGAGGG + Intronic
1118666912 14:68080176-68080198 TCCCATTTGCAAAATAAGGATGG + Intronic
1118718241 14:68575504-68575526 CCCCATTTGAAAAATTGAAATGG + Intronic
1118747064 14:68781839-68781861 CCCCATTTTACAGATGGGGAAGG - Intergenic
1118769377 14:68931649-68931671 CCACATCTGTAAAATGGGGATGG + Intronic
1119036166 14:71231764-71231786 CCCCACCTTCAAACTGGGGAGGG + Intergenic
1119643736 14:76333978-76334000 CCCCATCTGTAAAATGGGGCAGG + Intronic
1119684524 14:76620792-76620814 CCCCATCTTTGAAATGGGGAGGG + Intergenic
1119812935 14:77538978-77539000 CTTCATCTGCAAAATGGGAATGG + Intronic
1120011406 14:79419740-79419762 CCTCATTGACAAAATGAGGATGG + Intronic
1120885012 14:89445243-89445265 CCCCATCTGTAAAATGGGGATGG + Intronic
1120943649 14:89973621-89973643 CCACATTTGCAAAATGGGAGAGG - Intronic
1120983301 14:90310382-90310404 CCTCATTTGTAAAATGAAGAGGG + Intronic
1121319856 14:92985894-92985916 TCCTATCTGTAAAATGGGGAGGG - Intronic
1121495632 14:94389898-94389920 CCCTATCTGTAAAATGGGGATGG + Intronic
1121702257 14:95963489-95963511 ACTCATCCGCAAAATGGGGATGG - Intergenic
1121904246 14:97725016-97725038 CCCTATTTATAAAATGTGGATGG + Intergenic
1121969318 14:98342038-98342060 CCTCAAATGAAAAATGGGGATGG - Intergenic
1122074870 14:99229530-99229552 CTCCATCTGCAAAATGGGGATGG + Intronic
1122104969 14:99446144-99446166 CCTCACTTATAAAATGGGGACGG + Intronic
1122151930 14:99730330-99730352 CCCCATCTGTGAAATGGGGGTGG - Intergenic
1122236489 14:100333353-100333375 CCCTACTTGCAAAATAAGGATGG + Intergenic
1123762713 15:23445099-23445121 TCACATCTGTAAAATGGGGATGG - Intronic
1123800503 15:23814853-23814875 CCTCATTTGCTAAATGGAGATGG + Intergenic
1124334494 15:28846852-28846874 TCACATCTGTAAAATGGGGATGG - Intergenic
1124486070 15:30117759-30117781 CCTCATCTGTAAAATTGGGATGG + Intergenic
1124757514 15:32420842-32420864 CCTCATCTGTAAAATTGGGATGG - Intergenic
1124841094 15:33242923-33242945 CCTCATTTGTAAAATGGAGAGGG - Intergenic
1125732385 15:41900509-41900531 CCCCATCTGTAGAATGGGGAGGG - Exonic
1126778609 15:52119660-52119682 CCCCATTTGTAACATGGGATGGG - Exonic
1126928176 15:53614764-53614786 CCTCATTTACAAAATGAGGTGGG - Intronic
1127295197 15:57602776-57602798 CCTCATCTGAAAAATGGGGCAGG + Intronic
1127310097 15:57744853-57744875 CCACATCTGCAGAATGGGGCTGG - Intronic
1128346007 15:66852779-66852801 CCCCTTCTGTGAAATGGGGACGG - Intergenic
1128547340 15:68577358-68577380 ACTCATCAGCAAAATGGGGACGG + Intergenic
1128700452 15:69800222-69800244 CCCCTTCTGCAAAATAGGGGTGG - Intergenic
1128725703 15:69987023-69987045 CCCCATCTGTGAAATGAGGAGGG - Intergenic
1128904695 15:71456522-71456544 TCCCATCTGTGAAATGGGGATGG - Intronic
1129052765 15:72796742-72796764 CCCCATCTGCAGAATGGGGATGG + Intergenic
1129229398 15:74188498-74188520 CCCCACTTGACACATGGGGAAGG - Intronic
1129385711 15:75195284-75195306 CCCCAGATGCAAAAGGGAGAAGG + Intergenic
1130174480 15:81554094-81554116 CCCCATTAGCAACATGCAGAAGG - Intergenic
1130430933 15:83846293-83846315 CTCCATTTGTTAAATGGGGAGGG - Intronic
1130926177 15:88387592-88387614 CCTTATCTGTAAAATGGGGATGG + Intergenic
1130960554 15:88656026-88656048 TCCTATTTGTAAAATGAGGAAGG + Exonic
1131386965 15:92015796-92015818 CCCCATTTGCTCAATCAGGAAGG + Intronic
1131515918 15:93076710-93076732 CTTCATCTGCAAAATGAGGATGG - Intronic
1131737574 15:95350144-95350166 CCTCATCTGGAAAATGAGGAGGG + Intergenic
1131747258 15:95462431-95462453 CCCAAGTTGCAATGTGGGGACGG - Intergenic
1132175662 15:99711931-99711953 CCTCATCTGGAAAATGGGGATGG + Intronic
1132244051 15:100280743-100280765 TCCGATTTGTCAAATGGGGATGG - Intronic
1132343348 15:101091772-101091794 TCCCATGTGCACAATGGGGATGG - Intergenic
1133293639 16:4738931-4738953 ACCCACTTCCAAAATGGAGACGG + Intronic
1133296171 16:4753540-4753562 CCCCATCTGCAGGATGGAGATGG - Intronic
1133333963 16:4994756-4994778 CGACCTGTGCAAAATGGGGAAGG - Intronic
1133411093 16:5569571-5569593 CCTCATCTGTGAAATGGGGATGG - Intergenic
1134095600 16:11416446-11416468 CCTCATCTGCAGAATGGGAATGG + Intronic
1134260200 16:12644990-12645012 CTTCATCTGTAAAATGGGGAAGG - Intergenic
1134448570 16:14349008-14349030 CCTCACCTGCAAAATGGGGCAGG - Intergenic
1134557961 16:15182476-15182498 TCCCATTTGTAAAATCAGGAAGG - Intergenic
1134630056 16:15750014-15750036 CCCCATTTTCCATGTGGGGAAGG - Intronic
1134632546 16:15767292-15767314 CCCTATCTGCAAAACGGAGATGG + Intronic
1134693450 16:16206027-16206049 TTCCATCTGCAAAATGGGGTCGG + Intronic
1134785035 16:16934525-16934547 CCTCAAGTGTAAAATGGGGATGG + Intergenic
1134788140 16:16963476-16963498 CCCCACTTACAAAATGGGGGTGG + Intergenic
1134918497 16:18094079-18094101 TCCCATTTGTAAAATCAGGAAGG - Intergenic
1134978400 16:18588673-18588695 TTCCATGTGCAAAATGGGGTCGG - Intergenic
1135169100 16:20167219-20167241 CCCCATCTGTAAAATGGGGTAGG + Intergenic
1135421008 16:22305527-22305549 CCTCACTTGCAAAGTGGTGATGG + Intronic
1135762880 16:25151664-25151686 CCCCATCTTCAAAAAGGGGGTGG - Intronic
1135856996 16:26020925-26020947 CCATATATGTAAAATGGGGATGG + Intronic
1136061771 16:27731504-27731526 CCCCATCTGTAAAATGGAGCTGG - Intronic
1136372317 16:29844140-29844162 CCTCATCTGTAAAATGGGGGTGG + Intronic
1136688161 16:32008289-32008311 CCCCATCTGTAAAATGGGGATGG - Intergenic
1136788765 16:32951844-32951866 CCCCATCTGTAAAATGGGGATGG - Intergenic
1136863164 16:33714656-33714678 CTACATTTGGAAAATGGGGATGG - Intergenic
1136881048 16:33902090-33902112 CCCCATCTGTAAAATGGGGATGG + Intergenic
1137699314 16:50484912-50484934 CCCTGTCTGTAAAATGGGGAGGG - Intergenic
1137768795 16:50998020-50998042 CCCCAACTGCAAAATGGGGGCGG - Intergenic
1138048130 16:53747509-53747531 ACCCAGTTAAAAAATGGGGAAGG - Intronic
1138139833 16:54558644-54558666 CCTCATCTGTAAAATGGGGATGG + Intergenic
1138139987 16:54559801-54559823 CCTCATCTGTAAAATGGGGATGG - Intergenic
1138305050 16:55966740-55966762 CCCCATCTATAAAGTGGGGAGGG - Intergenic
1138555264 16:57767152-57767174 CATCATCTGTAAAATGGGGATGG - Intronic
1138598220 16:58040772-58040794 CCTCATCTACAAAATGGGGATGG - Intronic
1139365245 16:66428618-66428640 CCCCATCTGGAACATGGGGAAGG + Intronic
1139824348 16:69745336-69745358 CCCCATCTGTAAAATGGAGACGG - Intronic
1140324966 16:73992657-73992679 CCCAATTTTTAAAATGGGCAGGG + Intergenic
1140838805 16:78819978-78820000 CAACATCTGTAAAATGGGGATGG + Intronic
1140989953 16:80201144-80201166 CCTCAACTGCAAAATGGGAATGG - Intergenic
1141096655 16:81167821-81167843 CCTCATCTGCAAGATGGGGGGGG + Intergenic
1141309290 16:82897543-82897565 CCTCATCTATAAAATGGGGATGG - Intronic
1141310761 16:82911542-82911564 CTCCATCTGTAAAATGGGGATGG + Intronic
1141475514 16:84270526-84270548 CCCCATCTGAAAAGTAGGGAAGG - Intergenic
1141713756 16:85715364-85715386 CCACATTTGTAAGATGGGGCTGG - Intronic
1141755147 16:85986049-85986071 CCCCATTTCACAGATGGGGAAGG - Intergenic
1141883005 16:86872254-86872276 AGCCATTTGCTAAATGTGGAAGG - Intergenic
1141937259 16:87249163-87249185 CTCCATTTGCAGAAAGGGCATGG - Intronic
1142236056 16:88923095-88923117 CCCAATTCGCCAAATGTGGAGGG + Intronic
1203090962 16_KI270728v1_random:1213333-1213355 CCCCATCTGTAAAATGGGGATGG - Intergenic
1203124656 16_KI270728v1_random:1562809-1562831 CTACATTTGGAAAATGGGGATGG - Intergenic
1143258598 17:5582452-5582474 CCCCATCTGCCACATGGGGAGGG + Intronic
1144006822 17:11107992-11108014 CCCCATTTGGGAAATCAGGACGG + Intergenic
1144138774 17:12324758-12324780 CCTGATTTGCAAAAAGGTGAGGG + Intergenic
1144409677 17:14988508-14988530 CCTCATCTGTAAAATGGAGATGG - Intergenic
1144754534 17:17671173-17671195 CCTCATCTGTAAAATGGGGCTGG + Intergenic
1144764913 17:17727413-17727435 CCCCATCTGTGAAATGGGCAGGG - Intronic
1144765869 17:17732134-17732156 CTTCATCTGTAAAATGGGGATGG - Intronic
1144995355 17:19264516-19264538 CCTCATTTGTAAAATGGAAATGG - Intronic
1145000659 17:19302290-19302312 TCTCATCTGCAGAATGGGGACGG - Intronic
1145255641 17:21320824-21320846 CCTCATCTGCAAATTGGGGCAGG + Intergenic
1145320973 17:21767124-21767146 CCTCATCTGCAAATTGGGGCAGG - Intergenic
1145853822 17:28132937-28132959 TTTCATCTGCAAAATGGGGATGG - Intronic
1145868745 17:28256802-28256824 CCTAATCTGTAAAATGGGGATGG - Intergenic
1145898483 17:28474548-28474570 TCCCATTTGACAAATGGGGAAGG + Intronic
1146091893 17:29887557-29887579 CCTCATCTGTAAAATGAGGATGG + Intronic
1146176903 17:30670943-30670965 CCTCATTTATAAAATGAGGATGG + Intergenic
1146501594 17:33369451-33369473 TCCCATTTACAAAAAGGGAAAGG - Intronic
1146973777 17:37093855-37093877 CCTCATCTGTAAAATGGGGGTGG - Intronic
1147149151 17:38503993-38504015 CCACATCTGTAAAATGGGGATGG - Intronic
1148340783 17:46872365-46872387 CCTAATCTGTAAAATGGGGACGG + Intronic
1148849233 17:50546856-50546878 TCTCATTTGTAAAATGGGCAGGG + Intronic
1148867083 17:50634439-50634461 CCTCATCTGTAAAATGGGAAGGG - Intergenic
1148988610 17:51646217-51646239 TCCCATCTGTAAACTGGGGATGG + Intronic
1149715455 17:58784821-58784843 CCCAATTTAAAAAATGGGTAAGG - Intronic
1150802551 17:68292908-68292930 CCAGATCTGTAAAATGGGGATGG + Intronic
1151701082 17:75742891-75742913 CTCCATCTGTAAAATGGGTAAGG + Intronic
1152227315 17:79098464-79098486 CTTCATCTGCAAAATGGGGAGGG - Intronic
1152585553 17:81187997-81188019 CCCTGTCTGCAAAAGGGGGAAGG + Intergenic
1153050650 18:900485-900507 ACTGATTTGCAATATGGGGATGG + Intergenic
1153170369 18:2309519-2309541 CTCCATCTGCAAAATGGAGCTGG - Intergenic
1153680126 18:7492541-7492563 CCTCATTTGTAAAATGGGGATGG + Intergenic
1155038625 18:22046090-22046112 CCCCATTTATATAATAGGGATGG + Intergenic
1155346278 18:24860264-24860286 CAGCATCTGTAAAATGGGGATGG + Intergenic
1155967454 18:32049346-32049368 CATCATTTGTAAAATGGGGATGG + Intronic
1156232884 18:35172123-35172145 CCCCATTTGCCATATGAGGAAGG + Intergenic
1156348587 18:36283136-36283158 CCTCATTTCTAAAATGGAGATGG - Intergenic
1156384703 18:36594584-36594606 CCTCATCTGCACAATGGGGATGG + Intronic
1157491526 18:48127121-48127143 CCCCATTTGCAAAATGGGGATGG - Intronic
1157528255 18:48401571-48401593 CCCCATCTGCAGTATGGGGATGG + Intronic
1157562213 18:48656365-48656387 CCCCATCAGTAAAATGGGGATGG + Intronic
1158667876 18:59449210-59449232 CCTCATCTATAAAATGGGGATGG + Intronic
1158911401 18:62066357-62066379 CCTCATCTGTAAAATGGAGATGG + Intronic
1159442758 18:68502848-68502870 CCTTGTCTGCAAAATGGGGATGG - Intergenic
1160086513 18:75781744-75781766 CCCCATGTGCAAACTGGGGCTGG + Intergenic
1160720025 19:592950-592972 CCCCAATTGCACGGTGGGGATGG + Intronic
1161084392 19:2327928-2327950 CCTCATTTGTCAAATGGGGCTGG - Intronic
1161394090 19:4035485-4035507 CTGCATTTGTAAAATGGGGCTGG + Intronic
1161616907 19:5276019-5276041 CCTCACATGTAAAATGGGGATGG - Intronic
1161631843 19:5360925-5360947 CCCCATCTGTAAAATGGGGCTGG - Intergenic
1161980519 19:7627916-7627938 CCACATTTGCCAACTGGGGCAGG - Intronic
1162107416 19:8378429-8378451 CTGCATTTGGAAAATGGGGATGG + Intronic
1162416774 19:10543462-10543484 CCTCATGTGCAAAATAGGGCTGG - Intergenic
1162448954 19:10742807-10742829 CCCCATCTGCAAAACAGGGTTGG + Intronic
1162552064 19:11363627-11363649 CCTTATCTGAAAAATGGGGATGG + Intronic
1162981916 19:14245967-14245989 CCTCATTTATAAAATGAGGATGG - Intergenic
1164052113 19:21592563-21592585 CTTCATCTGCAAAATGGAGATGG - Intergenic
1164438883 19:28256524-28256546 CCCCATTTCCAAGCTGGGGTTGG + Intergenic
1164587301 19:29484055-29484077 CATCATCTGCAAAATGGGGCTGG - Intergenic
1164647260 19:29868317-29868339 CCTCATTTGCAAAATGGGAATGG - Intergenic
1165906195 19:39196352-39196374 CCCCCTCTGCAGAGTGGGGAGGG + Intergenic
1166066471 19:40362260-40362282 CTCCATCTGCAAAATGGGCATGG - Intronic
1166108454 19:40609128-40609150 TCTCATTGGTAAAATGGGGATGG + Intronic
1166156953 19:40920906-40920928 CTCCATCTATAAAATGGGGATGG + Intergenic
1166166020 19:40989380-40989402 CTCCATCTATAAAATGGGGATGG + Intergenic
1166651530 19:44578892-44578914 CCCCATTTTCCAGATGAGGATGG - Intergenic
1167095347 19:47372502-47372524 CCCCATTTGTAGATTGGAGATGG - Intronic
1167457609 19:49605673-49605695 CCCCATCTGTAAAATGGGGATGG - Intronic
1167649313 19:50720727-50720749 CCCCCTCTGGAAAATGGGGATGG - Intergenic
1167659828 19:50790176-50790198 CCCCATCGGTACAATGGGGATGG + Intergenic
1167660345 19:50792452-50792474 TCCCATCTGCACAGTGGGGATGG + Intronic
1167740941 19:51324622-51324644 ACTCCTTTGCAAAATGGGGATGG + Intronic
1168397390 19:56060248-56060270 CCCCATCTGTGAAATGGGGGCGG + Intronic
1168467795 19:56618283-56618305 CCTCATCAGCAAAATGAGGATGG + Intronic
1168490498 19:56804840-56804862 CCTCATCTGTAAAATGGGGCTGG - Intronic
925016780 2:533647-533669 CCCCCTTTTCAAAATGGGGGAGG + Intergenic
925189861 2:1874289-1874311 CCCCATCTGTGAAATGGGCACGG + Intronic
925862801 2:8196592-8196614 CACCATTTTCAAAATGGATAGGG - Intergenic
926049943 2:9738238-9738260 CCTCATCTGTGAAATGGGGATGG - Intergenic
926088500 2:10035142-10035164 TCTCATCTGTAAAATGGGGATGG - Intergenic
926363540 2:12112627-12112649 TCGCATTTGTAAAGTGGGGATGG + Intergenic
926404120 2:12532536-12532558 TCTCATTTGCAAAAAGGGAATGG + Intergenic
926549674 2:14286717-14286739 CTGTATTTGGAAAATGGGGATGG - Intergenic
926886203 2:17601210-17601232 CCTTATTTGTAAAATGGGGGAGG - Intronic
927042519 2:19243923-19243945 TCCCAGTTGAAAAATTGGGAAGG - Intergenic
927600062 2:24432899-24432921 CCTCATTTGCAAAATGCTGGGGG - Intergenic
927687006 2:25178048-25178070 CCTCATTTGAACAATGGGGGCGG + Intergenic
927853227 2:26512902-26512924 CCCCATCTCACAAATGGGGAGGG + Intronic
928201498 2:29250295-29250317 CCTCATTTGTAAAACGAGGATGG + Intronic
928498824 2:31865361-31865383 TCTCATTTGTAAAATGTGGAGGG - Exonic
928587836 2:32779466-32779488 CCCAATTTTAAAAATGGGTAAGG - Intronic
929670524 2:43873674-43873696 TCTCCTATGCAAAATGGGGATGG - Intronic
931188096 2:59973284-59973306 CCTCATCTGTAAAATGGGGATGG - Intergenic
931486150 2:62694708-62694730 CCTCATCTGTAAAATGGGAATGG - Intronic
931633658 2:64323034-64323056 CACCAGCTGCAAAATGGGGGTGG + Intergenic
931808737 2:65833730-65833752 CTCCATTTGCAAAGTAGGCATGG - Intergenic
932449427 2:71800133-71800155 CTTCATTCACAAAATGGGGATGG - Intergenic
934687602 2:96333298-96333320 CCCCGTCTATAAAATGGGGAAGG - Intergenic
934717663 2:96552863-96552885 CCCCATCTCCACAATGAGGAAGG - Intergenic
934934439 2:98454449-98454471 TCTCATCTGTAAAATGGGGAAGG + Intronic
935129404 2:100250071-100250093 CCCCATCTGCAAAATGAGGAGGG + Intergenic
935170938 2:100611145-100611167 CCCCTCATGGAAAATGGGGATGG + Intergenic
935359272 2:102233674-102233696 TCTCATCTGTAAAATGGGGATGG + Intronic
936287566 2:111192567-111192589 CCCCATCTAAAAAGTGGGGATGG - Intergenic
936434011 2:112487641-112487663 TCTCATCTGTAAAATGGGGATGG + Intronic
937342201 2:121098482-121098504 CCCCATCTGTAAAATGGAGATGG + Intergenic
937491837 2:122377592-122377614 CCTTATTTGCAAAATGAGGAGGG + Intergenic
937841916 2:126532976-126532998 CCCACTTTGCAAAATGTAGATGG - Intergenic
940888361 2:159011101-159011123 TCTCATCTGTAAAATGGGGATGG - Intronic
941049853 2:160720678-160720700 CCCCACCTGTAAAATGGAGATGG + Intergenic
941635089 2:167927536-167927558 CTTCATTTTTAAAATGGGGATGG + Intergenic
942268388 2:174249666-174249688 CCTCACTTGTAAAATGGGGATGG - Intergenic
943306292 2:186266535-186266557 CCCCATTTAAAAAATGGTGTTGG - Intergenic
943936544 2:193924133-193924155 CCACATTTGACAAATGGTGATGG + Intergenic
944611132 2:201409150-201409172 CCTCATCTGTAAAATGGAGAAGG + Intronic
944652344 2:201843718-201843740 CTCCATTTGCATTTTGGGGAAGG - Intronic
944988996 2:205212947-205212969 CCCCATCTGTAAAATGGCGATGG - Intronic
945112062 2:206369340-206369362 CCTCATTTGTGAAATGAGGAAGG + Intergenic
945182323 2:207104609-207104631 CCTCATCTAGAAAATGGGGAGGG - Intronic
946046099 2:216822372-216822394 CCTAATCTGGAAAATGGGGATGG - Intergenic
946326610 2:218987744-218987766 CCTCATTTGTAAAGTGGGTATGG + Intergenic
946465860 2:219911518-219911540 CCTCATTTGCAAAATAAAGATGG + Intergenic
946547099 2:220756275-220756297 CCCCATTTACAAATTGTAGAGGG + Intergenic
946748634 2:222870863-222870885 CCCCTTTTGGACAATGAGGAGGG + Intronic
947351163 2:229246879-229246901 AGCAATTTGCAAAATGGAGAAGG + Intronic
948295023 2:236854213-236854235 CCCTATCCGTAAAATGGGGATGG - Intergenic
948447064 2:238041001-238041023 CCCCATCTGGAAAATGAGAAGGG + Intronic
948685352 2:239666432-239666454 CCCCATTTGTAGAATGACGATGG + Intergenic
948907520 2:240986851-240986873 CCCCATCTGTGAAGTGGGGAAGG + Intronic
1168803029 20:655645-655667 CCCCATCTATCAAATGGGGATGG - Intronic
1170608057 20:17888491-17888513 ACACATTTTCAAAAAGGGGAGGG + Intergenic
1172116802 20:32577879-32577901 CCTCATCTGGAAAATGGGAATGG - Intronic
1172298332 20:33829998-33830020 CCTCATTTGTAAAATGGGAGTGG - Intronic
1172330885 20:34075391-34075413 CCCCATATGCCAAATGAGGATGG - Intronic
1172870980 20:38135482-38135504 CCCCATTCACACAAAGGGGAAGG - Intronic
1173153176 20:40585094-40585116 CCCCATCTGTAAAATAGGGATGG + Intergenic
1173153770 20:40590212-40590234 CCTTATTTGAAAAATGGGGAGGG - Intergenic
1173556858 20:43972607-43972629 CCTCATCTGTTAAATGGGGATGG - Intronic
1173605135 20:44326566-44326588 TCCCATCTGTTAAATGGGGATGG - Intergenic
1173644009 20:44622427-44622449 CCTCATTTGTAAGATGAGGACGG + Intronic
1173778683 20:45735586-45735608 CCCCATTTAAAAAATGGACAAGG + Intergenic
1173912404 20:46680022-46680044 CCCCATCTGTAAAATGGGTATGG + Intronic
1173958621 20:47053979-47054001 CCCCATTTGTAAAATGGGGATGG + Intronic
1174067261 20:47874629-47874651 TTTCATCTGCAAAATGGGGACGG + Intergenic
1174157036 20:48522242-48522264 TTTCATCTGCAAAATGGGGACGG - Intergenic
1174187728 20:48719078-48719100 TCCCATCTGTAAAATGGGCATGG - Intronic
1174341914 20:49902574-49902596 CCCCATATGTAAGATGGAGATGG + Intergenic
1174365464 20:50053726-50053748 TCTCATCTGTAAAATGGGGATGG + Intergenic
1174385501 20:50186535-50186557 CCCCATCTGCCAAGTGGGGCTGG - Intergenic
1174563246 20:51446100-51446122 CCCCATCCGTAAAATGGGAAGGG + Intronic
1175019405 20:55828337-55828359 CCTAATCTGCAACATGGGGATGG + Intergenic
1175259423 20:57665213-57665235 CTTCATCTGCAAAATGGGCATGG - Intronic
1175364613 20:58443940-58443962 CTCCGTTTGCAAAATGCGGTTGG + Intronic
1175465749 20:59190506-59190528 CCAGATCTGCAAAATGGGCAAGG - Intergenic
1175709557 20:61208307-61208329 CCTCATCTACAAAATGGGGGTGG + Intergenic
1176096618 20:63347278-63347300 GCCCATCTGCAAAACGGGGAGGG - Intronic
1178089091 21:29142796-29142818 CCTCCTCTGCAAAATGGGAAGGG - Intronic
1178153252 21:29820695-29820717 CCCCTTTTCAAAAATGAGGATGG - Intronic
1178482282 21:32989942-32989964 GGTCATTTGCAAAATGGGGATGG + Intergenic
1178883205 21:36464776-36464798 CCCCATGTGTAAAAAGGGGATGG - Intronic
1179029244 21:37705368-37705390 CCTCATTTGTTAAATGGGAATGG + Intronic
1179511608 21:41877475-41877497 CCTCATTTGCAAAGTGTGGATGG - Intronic
1179518373 21:41925597-41925619 CCCCATTTGCCAAATGGACGGGG + Intronic
1179988091 21:44932277-44932299 CCCCATCTCTATAATGGGGACGG - Intergenic
1181849740 22:25741629-25741651 CCCCACTTGTAAAGTGGGGCTGG + Intergenic
1181907041 22:26206474-26206496 CCTTATTTTCAAAATGGGGATGG - Intronic
1181940780 22:26474747-26474769 CCCAATTTAAAAAATGGGCAGGG + Intronic
1181956086 22:26589189-26589211 CCCCATCTGTAAAAGGGGAAGGG + Intronic
1181987218 22:26808529-26808551 CCCCATCCTTAAAATGGGGATGG - Intergenic
1182086381 22:27563917-27563939 CCCCATCTGTAAAATGAAGAGGG + Intergenic
1182096055 22:27626808-27626830 CCTCATCTGCAAAATGGAGTTGG - Intergenic
1182473254 22:30561455-30561477 CCCCATTTGGTAGATGGGAAAGG + Intronic
1182823786 22:33244373-33244395 CCTCATCTGCACAATGGGGATGG - Intronic
1183255156 22:36757211-36757233 CCTCATTTGTAAAAGGGGGATGG + Intergenic
1183346497 22:37311187-37311209 CCCCATCTGTAAAATGGGCATGG - Intronic
1183359710 22:37377116-37377138 GCCCATTTGCAAGATGCAGAAGG + Intronic
1183404528 22:37623887-37623909 CCCCAGTTGTGAAAAGGGGATGG - Intronic
1183414761 22:37675854-37675876 CCACATCTGTAAAATGGGGGTGG + Intronic
1183424664 22:37733115-37733137 CCCCTTCTGAAAAATGGGGATGG - Intronic
1183666939 22:39251579-39251601 CCCCATTTGTGAAATGGGGGTGG - Intergenic
1183739088 22:39660236-39660258 TCCCATTTGCAAAATGGCGGTGG + Intronic
1183740492 22:39666138-39666160 CCTCTTCTGCAAAATGGGTAAGG + Intronic
1184088574 22:42280668-42280690 CCCTAGTTGTAAAATGGAGATGG - Intronic
1184094463 22:42309128-42309150 CCTCATTTGCAGAGTGGGCATGG - Intronic
1184568775 22:45309600-45309622 CCTCATTTGCAGAAAGGGGGCGG - Exonic
1184813653 22:46854266-46854288 CCTCATTTGTAAAATGGGGATGG + Intronic
1184930306 22:47675998-47676020 CCCAAATTGAAAAATGGGCAAGG - Intergenic
949393314 3:3587369-3587391 CTCCATTTGCAGAAGGGGAATGG - Intergenic
949405211 3:3706684-3706706 CCCAATATCCAAAATGGGAATGG + Intronic
949577621 3:5353931-5353953 CCCCAGTTGTTAAATGGGTAGGG + Intergenic
949934132 3:9103460-9103482 CCTCATTTGTGAAATGGTGATGG - Intronic
950099665 3:10349060-10349082 CCTCATTTGTAAAATGGCTATGG - Intronic
950154651 3:10712528-10712550 CCTCAACTGCAAAATGGGGATGG - Intergenic
950198911 3:11029012-11029034 CCCCTTCTGGAAAATGGAGAAGG - Intronic
950438632 3:12994633-12994655 TCCCATCTGCGAACTGGGGACGG - Intronic
950521382 3:13499949-13499971 CCTCATCTGTAAAATGGGGATGG + Intronic
950669030 3:14514153-14514175 CCTCATCTGTAAAATGGGGCTGG + Intronic
950711034 3:14812968-14812990 TCCCATCTATAAAATGGGGATGG - Intergenic
951410217 3:22354192-22354214 ACTCAGTTGGAAAATGGGGATGG - Intronic
951589442 3:24247434-24247456 CCCCAACTGTAAAATGTGGATGG - Intronic
951977246 3:28526073-28526095 CCTCATATGTAAAATGGGGATGG + Intronic
951987882 3:28641137-28641159 CCCATTCTGGAAAATGGGGATGG - Intergenic
953312655 3:41894677-41894699 CCTCATCTGTAAAATTGGGATGG - Intronic
953861749 3:46550216-46550238 CCTCATCTGCAAATTAGGGATGG + Intronic
953975106 3:47376489-47376511 CTACATTGGTAAAATGGGGAAGG + Intergenic
954897884 3:53992716-53992738 CCCCAATAGAAAAATGGGAAAGG - Intergenic
954914671 3:54138718-54138740 CCCCAAATGCAGAATGAGGATGG - Intronic
955098782 3:55826623-55826645 AGCCTTTTGTAAAATGGGGAGGG - Intronic
956093481 3:65692562-65692584 CCTTATCTACAAAATGGGGATGG - Intronic
956170893 3:66432568-66432590 CCCCATCTGTAAAATGGGGACGG - Intronic
956733761 3:72219957-72219979 CCTCATCTGTAAAATGGGGCAGG + Intergenic
956740984 3:72275878-72275900 CCTCTTCTGTAAAATGGGGATGG - Intergenic
956741720 3:72280732-72280754 CTTCATCTGTAAAATGGGGATGG - Intergenic
956986406 3:74706424-74706446 TCTCATCTGCAAAATGGGAAGGG + Intergenic
957385049 3:79485661-79485683 CTGTATCTGCAAAATGGGGATGG - Intronic
959361596 3:105400873-105400895 TCCCATCTGTAAAATGGGGAAGG + Intronic
959720733 3:109485002-109485024 CCCCATTTTTAACATGTGGAAGG + Intergenic
959810171 3:110608807-110608829 CCACATTAACAAAATGAGGAAGG + Intergenic
960167599 3:114421318-114421340 CCCCATTTCTATAATGGGGAAGG + Intronic
961210284 3:125120286-125120308 CCCCAAGTTCAAAATGGGGGTGG + Intronic
961457122 3:127029786-127029808 CCCCATCTGAAAGCTGGGGATGG - Intronic
961818226 3:129562047-129562069 TCCCATCTGTAAAATGGGGAGGG + Intronic
963833445 3:150033098-150033120 CCCCAATTGCAAAATGCAGCAGG - Intronic
964057026 3:152473297-152473319 CCCCATTAGGAAAAAGGGCAAGG + Intergenic
964775778 3:160275062-160275084 CCTCATTTGTAAAATGGGGCTGG + Intronic
966890763 3:184406012-184406034 CCTCATCTGCAACATAGGGATGG - Intronic
968282047 3:197484638-197484660 CCCCACTTTGGAAATGGGGAGGG - Intergenic
969063345 4:4456954-4456976 CCTCATTTGTAAAATGAGGGAGG + Intronic
969267088 4:6071584-6071606 TCCCATTTGCAGACTTGGGAAGG - Intronic
969520618 4:7675825-7675847 CCCCATCTCTAAAATGGGGATGG - Intronic
969578484 4:8050309-8050331 CCCCTTCTGCACCATGGGGATGG - Intronic
970006051 4:11411933-11411955 TCCCATCTGAAATATGGGGATGG + Intronic
970795976 4:19914058-19914080 CTCCATTTACAAAATGAGGGAGG + Intergenic
971036895 4:22703387-22703409 CCTTATTTGCAAAATGAGAACGG + Intergenic
971159891 4:24122975-24122997 CCCCAGTTCTCAAATGGGGAAGG + Intergenic
971306501 4:25487146-25487168 CCCCAGGAGCAATATGGGGAGGG - Intergenic
971493840 4:27242821-27242843 CCCAAGCTGTAAAATGGGGAGGG + Intergenic
972654332 4:41050372-41050394 TCTCATCTGTAAAATGGGGATGG - Intronic
973847957 4:54932307-54932329 CCCCAGTTGAAGAATGGAGAAGG - Intergenic
973960213 4:56102393-56102415 CCTCATTTGTAAAATGAAGAAGG - Intergenic
975193078 4:71489427-71489449 TCCCATCTGCAACATCGGGATGG + Intronic
976150706 4:82088605-82088627 CCCTATTTGCTAAATGGTGCTGG - Intergenic
976218693 4:82738871-82738893 CCTCATCTGTAAAATGGGGTTGG - Intronic
976382041 4:84410611-84410633 CCCCAATTGCACAATGGGAAAGG - Intergenic
978847423 4:113290763-113290785 CCTCATTTGAAAAATGGAAATGG - Intronic
979973216 4:127163537-127163559 CCTCATTTGTAAATTGGGGAAGG - Intergenic
982032585 4:151315376-151315398 CTCCATTTCCAAAATTGGAAAGG + Intronic
982461335 4:155672741-155672763 CTCAATTTTCAAAATTGGGAAGG - Intronic
985209428 4:187576463-187576485 CCACAGTTGCAAAAAGGAGAGGG + Intergenic
986592994 5:9390920-9390942 CCACATCTGCAAAATGGCAAAGG - Intronic
986633583 5:9798579-9798601 CCCCATCTGTAAAATGCTGAGGG + Intergenic
986856808 5:11878841-11878863 CATCATTTGCAAGGTGGGGAAGG + Intronic
987333540 5:16878021-16878043 CTCCATCTGTAAAATGGGAATGG - Intronic
988190080 5:27919106-27919128 ACCCAATTACAAAATGGGGCAGG + Intergenic
989344393 5:40412772-40412794 TCCCATGTGTAAAATGGGAAAGG + Intergenic
990200755 5:53370375-53370397 CCCTATTTACTAAATGGTGACGG + Intergenic
990510629 5:56486400-56486422 CCTCATCTGTAAAATGGGGAGGG - Intergenic
990821862 5:59850371-59850393 GCCCATTTGTAAAATGAGCATGG + Intronic
991439481 5:66631827-66631849 CCCCTTTGGTAAAATGGGGATGG - Intronic
992712613 5:79475186-79475208 CCTCATCTTCAAAAGGGGGATGG - Intronic
993520595 5:88894954-88894976 CCCTTTTTGTAAAATGGGGAAGG + Intronic
993693017 5:91026040-91026062 TCTCATTTTTAAAATGGGGATGG - Intronic
993969765 5:94404873-94404895 CCTCATTTATAAAATGGTGAGGG + Intronic
994294828 5:98078387-98078409 CCTTATTTGTAAAATGGAGATGG - Intergenic
995742409 5:115368828-115368850 CCCCATCTTCAATCTGGGGAAGG + Intergenic
996017538 5:118557269-118557291 CCCCAGGTGCTGAATGGGGATGG - Intergenic
996293448 5:121882553-121882575 CCCCATTTTCAAAATGCAGCTGG + Intergenic
996347043 5:122498833-122498855 TCCCACTTGTAAAATGGGGATGG - Intergenic
996699297 5:126434428-126434450 GGCCATTTGGAATATGGGGAGGG - Intronic
996816548 5:127580224-127580246 CCCAATTTTAAAAATGGGCAAGG + Intergenic
996824442 5:127665403-127665425 CCTCATCTGTAAAATGGGCATGG + Intergenic
997398370 5:133582344-133582366 CCTCATCTGCAAAATGAGGTAGG + Intronic
998480224 5:142457025-142457047 CTCCACTTGTAAAATGAGGATGG - Intergenic
998906461 5:146910548-146910570 CCTCATCTGCAAAAGGGTGATGG + Intronic
999095850 5:148977590-148977612 CCTCATCTGTAAAATGGGGTTGG - Intronic
999437324 5:151573108-151573130 CCCCATTTCAAAGATGTGGAAGG + Intergenic
999438140 5:151580353-151580375 CCCCATTTGTGAAATGGGGCTGG + Intergenic
999670658 5:153956667-153956689 GCCCATTTGCAAACTGGTGTAGG - Intergenic
999861278 5:155649299-155649321 CCTCATCTGTAAAATGGGGATGG + Intergenic
1000104671 5:158048080-158048102 CCTCATCTGCAAAATGGAGACGG + Intergenic
1000327259 5:160181819-160181841 CCCCATTTGTAACATGAGGCAGG - Intergenic
1001037387 5:168307164-168307186 CCTCATCTGCAGAATGGAGATGG - Intronic
1001165816 5:169365890-169365912 TCTCATTTGAGAAATGGGGAGGG - Intergenic
1001308026 5:170589982-170590004 CCCCCTCTGCAAAATGGGAATGG + Intronic
1002026498 5:176399443-176399465 TCTCATTTGAAAAATGGGGCTGG + Intronic
1004234942 6:13866803-13866825 TCCCATCTGCAAAATGGGAGTGG + Intergenic
1005363143 6:25051701-25051723 CCCTATCTGCAAAATGGTCACGG - Intergenic
1006793208 6:36716901-36716923 GCTCATTTGTAAAATGGGGTGGG - Intronic
1006810275 6:36815967-36815989 TCCCATTTGAAAAGTGGGTATGG - Intronic
1006969139 6:38022589-38022611 CCTCATTTGAAAAATGGAGTGGG - Intronic
1007162730 6:39805300-39805322 CCTCATCTGTAAAATGGTGATGG + Intronic
1007452438 6:41950478-41950500 TCTCATTTGCAAAAGGAGGATGG + Intronic
1007918019 6:45579262-45579284 CCTCATCTGTAAAATGGGGATGG - Intronic
1008062492 6:47013355-47013377 CCTCATCTGTAAACTGGGGAAGG - Intronic
1008476125 6:51937715-51937737 CTCCATCTGTAAAATGGGCATGG + Intronic
1008561201 6:52726698-52726720 ACCTATTTACAAACTGGGGAAGG - Intergenic
1009558547 6:65207784-65207806 CCCCATTTAAAAAATGGTGATGG + Intronic
1010188911 6:73174739-73174761 CCTCACTGGCAAACTGGGGATGG + Intronic
1011350850 6:86422107-86422129 CTTCATTTGCAAAATGGTGTGGG + Intergenic
1012862141 6:104572521-104572543 CCTCATCTGTAAAATGGGTATGG + Intergenic
1013139054 6:107312521-107312543 CCCCATCTGTTAAATGGGGATGG + Intronic
1013290089 6:108712370-108712392 CCTCATCTGTAAAATGGGGGAGG + Intergenic
1013409217 6:109869252-109869274 TAACATTTGCAAACTGGGGAAGG - Intergenic
1013501935 6:110760784-110760806 CCTCATCTGTATAATGGGGATGG - Intronic
1015531758 6:134227687-134227709 CCTCAACTGTAAAATGGGGATGG - Intronic
1015621531 6:135137003-135137025 CCCCATCTGCAGAATGGGTTGGG + Intergenic
1016510592 6:144838651-144838673 CTTTATTTGTAAAATGGGGAGGG - Intronic
1016840025 6:148516701-148516723 CCTCATTTTCGAAATGAGGATGG - Intronic
1017131513 6:151112129-151112151 CCTTAATTACAAAATGGGGAAGG - Intergenic
1017598549 6:156056718-156056740 ACCCATTTAAAAAATGGGCAAGG - Intergenic
1017706637 6:157129678-157129700 TCACATTTGCAAAAAGGAGATGG - Intronic
1017998205 6:159553423-159553445 TCCCACTTGGAAAATGGGCAAGG - Intergenic
1018284226 6:162219653-162219675 ACCCATTTGTGAAATGGAGAAGG - Intronic
1019176487 6:170161895-170161917 CCCCATTTAAAAAGTGGAGATGG - Intergenic
1019567459 7:1691515-1691537 CCTCATCTGTAAAATGGGCAGGG + Intronic
1019609961 7:1931325-1931347 CCTCATCTGGAGAATGGGGAGGG + Intronic
1020026689 7:4904698-4904720 TCTCAGTTGCTAAATGGGGAAGG - Intergenic
1020373361 7:7458729-7458751 ACTCATCTGAAAAATGGGGATGG - Intronic
1021982319 7:26066889-26066911 CCTCATCTGTAAAATGGGGATGG - Intergenic
1022270805 7:28805790-28805812 TCCCATCTGTAAAATGGGGCTGG + Intronic
1022673316 7:32476270-32476292 CCTACTCTGCAAAATGGGGATGG - Intergenic
1023633252 7:42184011-42184033 CCTCTTCTGTAAAATGGGGAGGG + Intronic
1023821714 7:43984312-43984334 CCCTATCTGTAAAATGAGGATGG - Intergenic
1023991764 7:45132919-45132941 CCCCATTTTACAAATGAGGAAGG - Intergenic
1024194508 7:47045842-47045864 CCTCACTTGCAAAATGAGGATGG + Intergenic
1024949822 7:54848749-54848771 CCCAATTTTAAAAATGGGCAAGG - Intergenic
1025794302 7:64723618-64723640 CTGCATTTGCAAAATGAGGAAGG + Intergenic
1026537389 7:71251165-71251187 ACCCAATAGCAAAAGGGGGAGGG - Intronic
1026827475 7:73593583-73593605 TTCAATCTGCAAAATGGGGATGG - Exonic
1026915139 7:74115621-74115643 CTCCATTTGCAAAGAGCGGATGG + Intronic
1026935877 7:74254945-74254967 CCTCCTCTGCAAAATGGGGTGGG - Intergenic
1027163252 7:75817372-75817394 CTCCTGTTGCAACATGGGGATGG - Intronic
1028154585 7:87415251-87415273 CCCTTTTTGGAAAATTGGGATGG + Intronic
1029047055 7:97640738-97640760 CTCCATTGCCTAAATGGGGAGGG - Intergenic
1029349714 7:100004518-100004540 CCTCATCTGTAAAATAGGGATGG - Intergenic
1029734974 7:102460600-102460622 CCTCCTTTGTAAAATGGAGAAGG - Intronic
1029749976 7:102537731-102537753 CCCTATCTGTAAAATGAGGATGG - Intergenic
1029767926 7:102636837-102636859 CCCTATCTGTAAAATGAGGATGG - Intronic
1030046802 7:105504548-105504570 CCTCATTTGTAAAATGAAGATGG - Intronic
1030676410 7:112390379-112390401 CCTCATCTGTAAAATGGGGATGG + Intergenic
1031052387 7:116956856-116956878 TCCCATATGCAAGATGGGGCTGG + Intronic
1032322539 7:130898016-130898038 CCTCATCTGTGAAATGGGGATGG - Intergenic
1032518857 7:132527409-132527431 CCTCATCTGCTCAATGGGGATGG - Intronic
1032698481 7:134358289-134358311 TCTCATCTGTAAAATGGGGATGG + Intergenic
1033724866 7:144104158-144104180 CCCCATCTGCAAAATGGGGTGGG - Intergenic
1033755270 7:144393806-144393828 CTCCAAGTGCAAAATGAGGAGGG + Intergenic
1034544802 7:151782717-151782739 CCTCATCTGTAAAATGAGGATGG + Intronic
1035625472 8:1067555-1067577 TCCCATCTGGAAAATGGGCATGG - Intergenic
1036729509 8:11249971-11249993 CCTCATCTGAAAAATGGGGATGG - Intergenic
1037287241 8:17314415-17314437 CTTCATTTTTAAAATGGGGAAGG + Intronic
1037744412 8:21631398-21631420 CCTCATTTGTAAAATGGGAATGG + Intergenic
1038331223 8:26611048-26611070 CCCCATCTGCAAAATAGAAATGG - Intronic
1038477563 8:27878786-27878808 CCTCATTTGAAAAACAGGGATGG + Intronic
1039229045 8:35422802-35422824 TCCCTTTTGGAAAAAGGGGATGG + Intronic
1039426383 8:37489870-37489892 CCCCATTGGCAAGATGAGGGTGG - Intergenic
1041675541 8:60534833-60534855 CCCCACTTAGAGAATGGGGAAGG - Intronic
1041748761 8:61236766-61236788 CCTCATTTGTAAAATGAGGTCGG - Intronic
1042217991 8:66445651-66445673 CACCATGTGGAAAAGGGGGAAGG + Intronic
1042804885 8:72760424-72760446 CCCCATTTTTCAAATGGGGCAGG + Intronic
1043736783 8:83757937-83757959 CCCTATTTTCAATATTGGGATGG + Intergenic
1043758105 8:84029743-84029765 CCCCATCTCCAAGGTGGGGAAGG + Intergenic
1044128738 8:88493081-88493103 CCTCATTTGCAAAGTGGGGCTGG - Intergenic
1044409533 8:91868152-91868174 CCCCACCTTCAAACTGGGGATGG + Intergenic
1044843722 8:96360135-96360157 CCTGATCTGTAAAATGGGGAGGG - Intergenic
1044954852 8:97469418-97469440 CCTCATCTGTAAAATGGGGACGG + Intergenic
1045147073 8:99357959-99357981 CTTCATTGGTAAAATGGGGATGG + Intronic
1045955350 8:107899405-107899427 TCCCATTTACTAAGTGGGGAGGG - Exonic
1046565341 8:115892389-115892411 TCCCATTTATAAAATGGGGATGG - Intergenic
1047411596 8:124628794-124628816 CCCCATCTTTAAAATGAGGATGG - Intronic
1047521961 8:125601770-125601792 TCTCATCTGCAAAATGGTGATGG + Intergenic
1047761365 8:127957100-127957122 CCACATGTGCAAAATAGGGATGG - Intergenic
1047765926 8:127989888-127989910 CCTCATTAGTAAAATAGGGATGG + Intergenic
1047774642 8:128059755-128059777 CCCCATGTGTAAAATGGGGATGG - Intergenic
1047797263 8:128270463-128270485 CCTCATTTGTAAAATGGAGATGG - Intergenic
1048017669 8:130512138-130512160 CCCCATGTGGAATGTGGGGAAGG - Intergenic
1048456932 8:134586907-134586929 CCTCATTGGTAAAATGGGGATGG + Intronic
1048973923 8:139660795-139660817 TCCCATCTGGAAAATGGGAATGG - Intronic
1049001309 8:139827103-139827125 GCCCATTTCTAAAATGGGGAAGG + Intronic
1049216558 8:141410963-141410985 CCCCATTTGTCAGATGGGGAAGG + Intronic
1049245323 8:141559377-141559399 CCTCATCTAGAAAATGGGGACGG - Intergenic
1049826105 8:144669687-144669709 GCCCATTTGAAAAATGGGACAGG + Intergenic
1049933604 9:479486-479508 CCACATTTTCCAAATGGGGACGG + Intronic
1050162612 9:2734060-2734082 ACCCATTTGAATAATGGAGATGG - Intronic
1051141470 9:13984098-13984120 CCTCATCTGGAAAATAGGGATGG - Intergenic
1051577815 9:18637286-18637308 CCCCATTTGAGAACTGGAGAGGG + Intronic
1053020814 9:34692659-34692681 CCTTATTTGTAAAATGGGAATGG + Intergenic
1053313095 9:37031807-37031829 CCCTATCTGCCCAATGGGGAGGG - Intronic
1053446905 9:38159594-38159616 CCTCATTTGTTAAATGGGGATGG - Intergenic
1054760661 9:69001347-69001369 CCACATTTGAAAAATGTGGGGGG - Intronic
1054784720 9:69199889-69199911 CCCTATTTGTAAAATGGGGATGG + Intronic
1055553347 9:77451234-77451256 CCTCATTGGTAAAATGAGGAGGG + Intronic
1056282407 9:85054389-85054411 CCTCCTTTGTAAAATGGGGTTGG + Intergenic
1056944501 9:90983100-90983122 TCCCCTTTGCAGAATGGTGATGG - Intergenic
1057184990 9:93052520-93052542 TCCCATCTGTAAAATGGGGATGG + Intergenic
1057525822 9:95799936-95799958 ACCCAATTGGAAAATGGGCAAGG + Intergenic
1057824918 9:98365018-98365040 TCTCATTTGTAAAATGGGCAGGG + Intronic
1057847908 9:98539545-98539567 CCCCTTCTACAAAATGAGGAGGG + Intronic
1057898494 9:98929178-98929200 CCAAATATGCAAAAAGGGGAAGG - Intergenic
1058120634 9:101134969-101134991 CCTCATCTGCAAAATGGGGAAGG - Intronic
1058420050 9:104824795-104824817 CCTCATCTCTAAAATGGGGATGG - Intronic
1058609391 9:106758342-106758364 GCCCATTTGAAAATTGGGAATGG - Intergenic
1058730634 9:107846641-107846663 CTACATCTGTAAAATGGGGATGG - Intergenic
1058805445 9:108586799-108586821 CCTCATGTGTGAAATGGGGATGG - Intergenic
1058907438 9:109493352-109493374 CCCCCTCTGTAAAATGGGGCTGG + Intronic
1059401206 9:114071566-114071588 CCCCACTTTCAAGCTGGGGAGGG + Intronic
1059515863 9:114894609-114894631 CCTCATCTGCAACATGGGAATGG + Intronic
1059651454 9:116319518-116319540 CTCCATTTGAAAAAGGGGGTGGG + Intronic
1059930604 9:119256693-119256715 CCTCATCTGTAAAATGGGGTGGG + Intronic
1060588308 9:124800427-124800449 CCTCATCTGCCAAATGGGCAGGG - Intronic
1060694725 9:125698695-125698717 CGGCATTTGTAAAATGGGGACGG + Intronic
1060975673 9:127763648-127763670 TCCCATCTGCAAAATGGGGAGGG + Intronic
1061806717 9:133141041-133141063 CCCCATCTGTCAAATGGGCAAGG - Intronic
1061847824 9:133397805-133397827 CCTCATCTGTAAAGTGGGGATGG + Intronic
1061894559 9:133640438-133640460 GCCCATCTGTAAAATGGAGATGG + Intronic
1186555859 X:10557582-10557604 CCTCATCTGCAGAATGAGGATGG + Intronic
1187378431 X:18778551-18778573 CCCAATTTGCAAAATGGGGATGG - Intronic
1188269413 X:28120182-28120204 CTGCTTTTGCAATATGGGGAAGG + Intergenic
1189150962 X:38706184-38706206 CCTCATTTACAAAATGGTGAGGG + Intergenic
1189346729 X:40247578-40247600 CCCCATCTGTAAAATGGGGATGG + Intergenic
1190115647 X:47624789-47624811 CCTCATCTGCAAAATGAGAATGG + Intronic
1190397306 X:49998162-49998184 CATCATCTGTAAAATGGGGAGGG - Intronic
1190489405 X:50966347-50966369 CCTCATTTGTAAAATGGAGATGG + Intergenic
1192157936 X:68760283-68760305 CCTCATCTGTAAAATGGGGATGG + Intergenic
1193268272 X:79499034-79499056 CCCCATTTGATAAATGGTGCTGG + Intergenic
1193602437 X:83524271-83524293 CCCCATCTGCAAAATGAGCAAGG - Intergenic
1193843060 X:86433058-86433080 CCTAATCTGTAAAATGGGGATGG + Intronic
1193931491 X:87558285-87558307 TCTCATTTGTAAAATGAGGACGG + Intronic
1195203025 X:102567553-102567575 CCTCATTTGCAAAATGGGGTTGG + Intergenic
1195676689 X:107512182-107512204 CCCCATCTGTGAGATGGGGAGGG + Intergenic
1196794295 X:119489877-119489899 CCTCATCTGTAAAATGGGGAGGG + Intergenic
1197172397 X:123448965-123448987 CCTCCTCTGAAAAATGGGGATGG - Intronic
1197587889 X:128372126-128372148 CCTCACTTGTAAAATGTGGATGG - Intergenic
1197721763 X:129750191-129750213 GCACATTTGTAAAATGGGGATGG - Intronic
1197808280 X:130417640-130417662 TCCCATAGGGAAAATGGGGAGGG + Intergenic
1198030253 X:132747642-132747664 TCCCATTTGTACAAGGGGGAGGG + Intronic
1198399681 X:136256802-136256824 CCTCATCTGTAAAATGAGGATGG - Intergenic
1198439506 X:136648661-136648683 CCACATCTGAGAAATGGGGATGG + Intronic
1199513063 X:148644429-148644451 CCTCATCCGCAAAATGAGGATGG + Intronic
1199722850 X:150555015-150555037 CCTCATCTGCAAAAGAGGGATGG + Intergenic
1200204286 X:154304605-154304627 CCCCATTAAGAAAATGGGGGAGG + Intronic