ID: 1157492514

View in Genome Browser
Species Human (GRCh38)
Location 18:48134363-48134385
Sequence CTGTCCTAATAGAATGGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 282}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157492514_1157492518 6 Left 1157492514 18:48134363-48134385 CCAACACCATTCTATTAGGACAG 0: 1
1: 0
2: 1
3: 17
4: 282
Right 1157492518 18:48134392-48134414 CTGGTCAGCTAAAACGAAGGAGG 0: 1
1: 0
2: 0
3: 4
4: 64
1157492514_1157492520 20 Left 1157492514 18:48134363-48134385 CCAACACCATTCTATTAGGACAG 0: 1
1: 0
2: 1
3: 17
4: 282
Right 1157492520 18:48134406-48134428 CGAAGGAGGACAGGATTCTCAGG 0: 1
1: 0
2: 0
3: 7
4: 104
1157492514_1157492521 26 Left 1157492514 18:48134363-48134385 CCAACACCATTCTATTAGGACAG 0: 1
1: 0
2: 1
3: 17
4: 282
Right 1157492521 18:48134412-48134434 AGGACAGGATTCTCAGGAAATGG 0: 1
1: 0
2: 3
3: 36
4: 386
1157492514_1157492519 11 Left 1157492514 18:48134363-48134385 CCAACACCATTCTATTAGGACAG 0: 1
1: 0
2: 1
3: 17
4: 282
Right 1157492519 18:48134397-48134419 CAGCTAAAACGAAGGAGGACAGG 0: 1
1: 0
2: 0
3: 9
4: 128
1157492514_1157492517 3 Left 1157492514 18:48134363-48134385 CCAACACCATTCTATTAGGACAG 0: 1
1: 0
2: 1
3: 17
4: 282
Right 1157492517 18:48134389-48134411 TGTCTGGTCAGCTAAAACGAAGG 0: 1
1: 0
2: 1
3: 9
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157492514 Original CRISPR CTGTCCTAATAGAATGGTGT TGG (reversed) Intronic
904367741 1:30026467-30026489 CTTTCCTCATTGAATGGTCTTGG - Intergenic
905191636 1:36239687-36239709 CTTTCCTAATAAAATGTTGGAGG - Intronic
905469201 1:38179119-38179141 CTGCCCCAAAAGAATGATGTAGG - Intergenic
905511537 1:38525228-38525250 CTTTCCCAATTGAATGGTCTTGG + Intergenic
907431339 1:54413881-54413903 CTCACCTGATAGAACGGTGTTGG - Intergenic
907852045 1:58264627-58264649 CTTTCCTAATAGTTTGATGTAGG - Intronic
908604509 1:65781062-65781084 CTGGCTTCATAGAATGGTTTAGG - Intergenic
908988146 1:70051081-70051103 AAATCCTAATATAATGGTGTAGG - Intronic
909176434 1:72367605-72367627 CTGACCTCATAGAATGGGTTAGG + Intergenic
911622234 1:100078439-100078461 CTCTCCTTATAGGATGATGTGGG + Exonic
911833511 1:102584953-102584975 CTTTCCTTATCGAATGGTCTTGG - Intergenic
912081420 1:105942012-105942034 CTGACCTCATAGAATGATTTAGG + Intergenic
912152219 1:106873720-106873742 CTGGCCTAATAGAATGAGTTAGG - Intergenic
912673850 1:111657712-111657734 CTTTCCCAATTGAATGGTCTTGG + Intronic
913024139 1:114818887-114818909 CTTTCCTGATTGAATGGTCTTGG + Intergenic
915613857 1:157018855-157018877 CTTTCCTCATTGAATTGTGTTGG - Intronic
916281600 1:163057706-163057728 CTGTTCCAATAGACTGATGTAGG + Intergenic
917800730 1:178567638-178567660 CTGTCCTCATAGAATGAATTAGG + Intergenic
918809956 1:189103688-189103710 CTGGCTTCATAGAATGATGTAGG - Intergenic
918916824 1:190651804-190651826 CTGTCCTCATTGAATGGTCATGG - Intergenic
919376942 1:196807040-196807062 CTGGCCTCATAGAATGATTTAGG + Intergenic
920384416 1:205558679-205558701 CTGTCCTCATAGAATGAGTTTGG - Intergenic
922381603 1:225034578-225034600 CTGGCCTCATAGAATGATTTTGG + Intronic
922829219 1:228542813-228542835 CTCTCCTATTAGAATGCTGGGGG + Intergenic
924333154 1:242960528-242960550 CTTTCCTTATTGAATGGTCTTGG + Intergenic
924917384 1:248585650-248585672 CTGGCTTCATAGAATGATGTAGG + Intergenic
1065524029 10:26599838-26599860 CTGTCCTAATAGAAGTATGTAGG - Intergenic
1066165273 10:32781294-32781316 CTGTCCTCATAGAATGAGTTAGG - Intronic
1066424556 10:35294747-35294769 CTGGCATAATAGAATGATTTGGG + Intronic
1068122565 10:52798165-52798187 CTGGCTTCATAGAATGGTTTAGG + Intergenic
1068442434 10:57075684-57075706 CTGGCTTCATAGAATGGTTTAGG + Intergenic
1070429912 10:76327479-76327501 CTGGCCTAATATAAGTGTGTAGG - Intronic
1070639403 10:78156487-78156509 CTTTCCTCATTGAATGGTCTTGG + Intergenic
1071910934 10:90232454-90232476 CTGGCTTCATAGAATGATGTAGG - Intergenic
1072789973 10:98310978-98311000 CTGTTCTAATAGAAGGGTCGAGG - Intergenic
1074658982 10:115628911-115628933 CTTTCCTAATTGAATAGTCTTGG + Intronic
1074804398 10:117033663-117033685 CTGCCCTCATAGAATGATTTTGG - Intronic
1076497845 10:130909401-130909423 CTGGCCTCATAGAATGGGGCAGG + Intergenic
1076775469 10:132695022-132695044 CTGGCCTCATAGAATGATTTAGG - Intronic
1078626761 11:12965016-12965038 ATGTTCTAATGAAATGGTGTAGG + Intergenic
1079276601 11:19043621-19043643 CTGGCCTCATAGAATGGGTTAGG - Intergenic
1079687818 11:23383229-23383251 CTGGCCTCATAGAATGAGGTAGG - Intergenic
1079763692 11:24362200-24362222 CTGTCCTCATAGAATGAGCTTGG - Intergenic
1080213368 11:29813321-29813343 CTGGCCTCATAGAATGATTTTGG + Intergenic
1082206883 11:49447417-49447439 CTGTCTTCATAGAATGATTTAGG - Intergenic
1082760233 11:57120273-57120295 CTGTCATAATAAAATGCTGTAGG - Intergenic
1083127138 11:60581479-60581501 CTGGCCTCATAGAATGATTTAGG - Intergenic
1083456850 11:62784934-62784956 CTGGCCTTACAGAATGATGTGGG + Intronic
1083480430 11:62941504-62941526 CTTTCCTACTAGAGTGGTATTGG + Intronic
1083519367 11:63293806-63293828 CTGGCCTAATAGAATGAGTTAGG + Intronic
1083865017 11:65448971-65448993 CTGCCCTAAAAGAAGGGTGGGGG - Intergenic
1086648389 11:89254333-89254355 CTGTCTTCATAGAATGATTTAGG + Intronic
1087679831 11:101207960-101207982 CTGTCCTCATAGAATGAGTTAGG + Intergenic
1089004812 11:115082485-115082507 CTGTATTAATAAAAGGGTGTGGG + Intergenic
1089462967 11:118663473-118663495 CTGTCCTAATGGGGTGGTGGTGG - Intronic
1090495662 11:127209597-127209619 CTGGCCTCATAGAATGGGTTAGG - Intergenic
1090682965 11:129081248-129081270 CTGGCCTCATAGAATGATTTAGG - Intronic
1090742452 11:129677310-129677332 CTGTCCTCATAGAATGGGTTAGG - Intergenic
1091911690 12:4236546-4236568 CTGTCCTTAGAGAATGATTTAGG + Intergenic
1093278156 12:17154506-17154528 CTGTCTTCATAGAATGATTTAGG - Intergenic
1093533639 12:20197506-20197528 CTGGCCTGATAGAATGATTTAGG + Intergenic
1094366816 12:29691793-29691815 CTGTACAAATAGAACTGTGTTGG + Intronic
1094574713 12:31674667-31674689 TTGTTCTATTAGAATGGTGTAGG - Intronic
1101544263 12:105696676-105696698 CTGGCCTCATAGAATGATTTAGG + Intergenic
1102022384 12:109692837-109692859 CTGTCCTAGCAGAAAGGTGAAGG - Intergenic
1104677574 12:130723893-130723915 CTGTCCTCATAGAATGAGTTGGG - Intergenic
1105394241 13:20013930-20013952 CTGGCCTTATAGAATGGGGTGGG + Intronic
1105411154 13:20172783-20172805 CTTTCCTCATTGAATGGTCTTGG - Intergenic
1105435772 13:20376983-20377005 CTGGCCTCATAGAATGATTTGGG - Intergenic
1106335783 13:28782069-28782091 CTGGCTTCATAGAATGATGTAGG + Intergenic
1108768428 13:53663943-53663965 CTGGCCTCAAAGAATGGTTTAGG + Intergenic
1108884970 13:55168802-55168824 CTGTCCTCATAGAATGAGTTAGG - Intergenic
1109100391 13:58176998-58177020 CTGGCCTCATAGAATGGATTTGG + Intergenic
1111643840 13:91005446-91005468 CTGTCTTTCTAGAATGGTTTTGG - Intergenic
1112761891 13:102701021-102701043 CTTTCCTAATAGAAATCTGTTGG - Intergenic
1113169803 13:107487784-107487806 CTGGCCTTATAGAATGGGTTAGG + Intronic
1115346724 14:32350885-32350907 CTGTGCTATTAGAATGGGGTAGG - Intronic
1116386365 14:44335252-44335274 CTGGCCTTATAGAATGGGTTAGG - Intergenic
1116761133 14:49016152-49016174 ATGTCTTAATAGAATTGTCTTGG - Intergenic
1118121007 14:62842795-62842817 CTGTCCTAATAAAAAGTTGTTGG + Intronic
1119840857 14:77791796-77791818 CTATCCTTACAGAATGGTCTTGG + Intergenic
1122185728 14:99993491-99993513 CTGACCTAATAGAATGAGTTTGG + Intronic
1122618608 14:103039250-103039272 CTGGCCTTATAGAATGATTTAGG - Intronic
1123569234 15:21585797-21585819 CTGGCCTAATAGAATGAATTTGG + Intergenic
1123605344 15:22021118-22021140 CTGGCCTAATAGAATGAATTTGG + Intergenic
1124419003 15:29502323-29502345 CTTTCCTTATTGAATGGTCTTGG - Intronic
1126721107 15:51580854-51580876 CTTTCCTAATAGGATGGATTTGG - Intronic
1127189799 15:56517285-56517307 CTGGCCTCATAGAATGATTTAGG - Intergenic
1129584091 15:76844850-76844872 CTGGCCTCATAGAATGATTTTGG - Intronic
1129602216 15:77006704-77006726 CTTTTCTCATAGAATGGTCTTGG + Intronic
1130239157 15:82169338-82169360 TGTTCCTAATAGAATGGTGGTGG + Intronic
1130400080 15:83543505-83543527 CTGGCCTCATAGAATGGGTTTGG + Intronic
1202977587 15_KI270727v1_random:312890-312912 CTGGCCTAATAGAATGAATTTGG + Intergenic
1133701103 16:8309883-8309905 CTGTCCTAAGAGGACTGTGTGGG + Intergenic
1135511934 16:23092916-23092938 CTGTCCTCATTGAATGGTCTTGG - Intronic
1139242198 16:65404508-65404530 CTGACCTCATAAAATGGTTTGGG - Intergenic
1140113526 16:72022933-72022955 CTGTCCTAGGGGAATGTTGTGGG + Intronic
1140417796 16:74788709-74788731 CTGTTCTCAGAGAATAGTGTGGG - Intergenic
1144191210 17:12847927-12847949 CTGTCCTAACAGTATTGTATAGG + Intronic
1144598504 17:16591767-16591789 CTGTCCTCATAGAAAGGGTTAGG - Intergenic
1145231157 17:21174317-21174339 TTGTCCTTGTAGAATAGTGTGGG + Intronic
1149395478 17:56237264-56237286 CTGGCCTCATAGAATGAGGTGGG + Intronic
1150943973 17:69724278-69724300 CTGTAATAATCTAATGGTGTGGG + Intergenic
1153554042 18:6292388-6292410 CTCTCCTAATAGAATAATGTTGG + Intronic
1154298216 18:13169471-13169493 CTGGCTTCATAGAATGATGTAGG - Intergenic
1154984312 18:21534473-21534495 CTGTTCTCTTAGAATGGTCTCGG + Intronic
1155779668 18:29815060-29815082 CTGTCCTCATAGAATGGGTTAGG - Intergenic
1156340922 18:36210144-36210166 CTGTCCTTATAGAATGAGTTAGG + Intronic
1156535278 18:37857764-37857786 CTGGCCTCATAGAATGATTTTGG + Intergenic
1157492514 18:48134363-48134385 CTGTCCTAATAGAATGGTGTTGG - Intronic
1157715476 18:49882875-49882897 CTGGCCTCATAGAATGGAATTGG - Intronic
1158747922 18:60223215-60223237 CTGTCCTTATAGAATGAGTTAGG + Intergenic
1158987808 18:62836597-62836619 CTATCCTCATAGAATGGGTTGGG + Intronic
1161603307 19:5198976-5198998 CTTTCCTAATTAAATGGTCTTGG + Intronic
1166586238 19:43951652-43951674 CCTTCCTAATAGAATTGTCTTGG + Intronic
1166602938 19:44113829-44113851 CCATCCTAATAGAATCGTTTTGG + Intronic
1168136978 19:54358731-54358753 CTGTCCTGGTAGAATCGTTTAGG - Intronic
1168161106 19:54510398-54510420 CTGTCCTGGTAGAATCGTTTAGG + Intronic
925252780 2:2454556-2454578 CTTTCCCAATCGAATGGTCTTGG - Intergenic
926133601 2:10320798-10320820 CTGTGCTAAGAGAATGATCTAGG + Intronic
927237804 2:20891697-20891719 CTGACCTCATAGAATGGGTTGGG + Intergenic
927877350 2:26667216-26667238 CTGTGCTAATAAAATGGAGGTGG - Intergenic
930042419 2:47137483-47137505 CTGGCCTAATAGAATGAGTTAGG + Intronic
930165195 2:48197456-48197478 CTTTCCTGCTAGAATGGTCTGGG - Intergenic
930192777 2:48477492-48477514 CTTTCCTTATTGAATGGTCTGGG + Intronic
930764838 2:55074564-55074586 CTGTCTTCATAGAATGATTTAGG - Intronic
930930660 2:56877690-56877712 CTGTCCTTATAGAATGAATTAGG - Intergenic
933680998 2:85100627-85100649 CTGGCCTCATAGAATGGGTTAGG - Intergenic
934881076 2:97979673-97979695 CTGACCTAATAGAATGCTTGTGG + Intronic
937091861 2:119211898-119211920 CTGTCCTCAGAGAATGGGGGAGG + Intergenic
940395120 2:153180530-153180552 CTGGCCTTATAGAATGTTTTAGG + Intergenic
940705119 2:157095195-157095217 CTGGCCTCATAGATTGGTTTAGG + Intergenic
941419715 2:165268173-165268195 CTGACTTAATAGAATGATTTAGG - Intronic
942632537 2:177966859-177966881 CTGGCCTCATAGAATGGGTTAGG + Intronic
945964002 2:216166075-216166097 CTGTGGTGATAGAATGGTGATGG - Intronic
1170651124 20:18242884-18242906 CTGGCTTCATAGAATGGTTTAGG - Intergenic
1171355215 20:24539356-24539378 CTTTCCCTATTGAATGGTGTTGG + Intronic
1171747943 20:29017883-29017905 CTGTCCTCATAGAATGAGTTTGG - Intergenic
1176350494 21:5790987-5791009 CTGTCCTCATAGAATGAGTTGGG + Intergenic
1176357308 21:5911571-5911593 CTGTCCTCATAGAATGAGTTGGG + Intergenic
1176544815 21:8189057-8189079 CTGTCCTCATAGAATGAGTTGGG + Intergenic
1176563766 21:8372102-8372124 CTGTCCTCATAGAATGAGTTGGG + Intergenic
1176906381 21:14506679-14506701 CTGGCTTCATAGAATGATGTAGG - Intronic
1177112353 21:17043643-17043665 CTGGCTTATTAAAATGGTGTGGG + Intergenic
1178531307 21:33378571-33378593 CTGTCCTAATAGAAGGAAGCTGG - Intergenic
1180395256 22:12326208-12326230 CTGTCCTTATAGAATGAGTTGGG + Intergenic
1180404486 22:12538543-12538565 CTGTCCTTATAGAATGAGTTGGG - Intergenic
1180897151 22:19344624-19344646 CTGTCCTCATAGAATGAAATAGG - Intronic
1181660025 22:24339651-24339673 CTTCCCTAAAATAATGGTGTTGG + Intronic
1203249685 22_KI270733v1_random:105295-105317 CTGTCCTCATAGAATGAGTTGGG + Intergenic
949798920 3:7881704-7881726 CTGTCCTCATAGAATGGGTTAGG - Intergenic
950466162 3:13155610-13155632 CTGGCCTCACAGAATGATGTAGG - Intergenic
951268176 3:20594417-20594439 CTGTCTTCATAGAATGATTTAGG + Intergenic
951859296 3:27233755-27233777 CTGGCCTCATAGAATGGGTTAGG - Intronic
952549087 3:34455648-34455670 CTGGCCTTATAGAATGATTTTGG + Intergenic
953113719 3:39969827-39969849 CTGGCCTAATAGAATGAGTTTGG + Intronic
953894048 3:46780765-46780787 CTGGCCTCATAGAATGGGTTAGG - Intronic
955172032 3:56575836-56575858 CTTTCCCCATTGAATGGTGTTGG + Intronic
957557203 3:81778018-81778040 CTGTCCTAATCAAATGGGGATGG + Intergenic
958817439 3:98931214-98931236 TTCTCCTACTAGTATGGTGTTGG - Intergenic
959037041 3:101379114-101379136 CTTTCCTCATTGAATGGTCTTGG - Intronic
959868231 3:111296172-111296194 CTGGCCTCATAGAATGGGTTTGG + Intronic
962023122 3:131520934-131520956 CTTTCCTCATAGATTGTTGTGGG - Intergenic
963805830 3:149721610-149721632 CTGGCCTAATAGACTGGGTTAGG + Intronic
964521121 3:157568832-157568854 CTTTCCTTATTGAATGGTCTTGG + Intronic
965023296 3:163263871-163263893 CTGTCCTTATAGAATGAGCTGGG + Intergenic
965457640 3:168923768-168923790 CTGTACCAATTGAATGGTGCTGG + Intergenic
967750162 3:193104685-193104707 CTGCCCTCATAGAATGGGTTAGG + Intergenic
968842451 4:3017387-3017409 CTGTCCTAATATCGTGGTGGAGG - Intronic
968874300 4:3257213-3257235 CTGCCCAAATAGAAGGTTGTTGG + Intronic
971061307 4:22974109-22974131 CTGTCCTTATAGAATGAGTTAGG + Intergenic
971904706 4:32711471-32711493 CTGGCCTCATAGAATGATTTAGG + Intergenic
972245980 4:37245408-37245430 GTGTCCTAATAGAAGTGTGCAGG - Intronic
975204400 4:71627830-71627852 CTGGCCTCATAGAATGATTTAGG - Intergenic
976819473 4:89188881-89188903 CTGGCCTCATAAAATGGTTTAGG + Intergenic
977350969 4:95886394-95886416 CTGTCAAAATTAAATGGTGTGGG - Intergenic
979599133 4:122567738-122567760 CTGGCCTAATAGAATGAGTTTGG + Intergenic
980946865 4:139329433-139329455 CTGTCTTTAAAGAGTGGTGTTGG + Intronic
981181197 4:141747551-141747573 CTGTCCTCATAGAATGATTTGGG - Intergenic
981790648 4:148532969-148532991 CTGTCCTCATAGAATGAGTTAGG + Intergenic
982239652 4:153286324-153286346 CTGGCCTAATAGAATGAGTTAGG + Intronic
984720410 4:182967381-182967403 CTGACCTCATAGAATGATTTAGG - Intergenic
986496414 5:8345965-8345987 CTGTACTCATAGAATGGGTTAGG - Intergenic
986899006 5:12408697-12408719 CTGTCCTCATAGAATGAGCTTGG + Intergenic
987423583 5:17748625-17748647 CTTACCTAAAAGAGTGGTGTGGG + Intergenic
988626777 5:32885094-32885116 CTTTCCTTATTGAATGGTCTTGG + Intergenic
988876205 5:35449140-35449162 CTGTCTTCATAGAATGATTTAGG - Intergenic
992021442 5:72628604-72628626 TTGGCCTAATACAGTGGTGTTGG + Intergenic
992428782 5:76686873-76686895 CTTTCTTCATAGAATGGTCTAGG + Intronic
992614688 5:78536624-78536646 CTGTCCTAAAATAATGGAATAGG - Intronic
993362442 5:86994587-86994609 CTGTCCTCATAGAATGACTTAGG + Intergenic
993655026 5:90567317-90567339 CTGGCCTTATAAAATGGTTTGGG + Intronic
993923715 5:93839526-93839548 CTGGCCTTATAGAATGGGTTAGG + Intronic
994893264 5:105667102-105667124 CTGGCCTCATAGAATGGGTTTGG + Intergenic
995628043 5:114100760-114100782 CTGGCCTAATAAAATAGTTTAGG - Intergenic
996141052 5:119909789-119909811 CTGGCTTAATAGAATGATTTGGG + Intergenic
998585741 5:143425122-143425144 CTTTCCTCATTGAATGGTCTTGG - Intronic
998755678 5:145376401-145376423 CTGACCTCATAGAATGAGGTGGG + Intergenic
999022368 5:148181632-148181654 CTGTCTTTATAGCATGGTGCTGG + Intergenic
1000314708 5:160078573-160078595 CTGTGCTAGTAGAAGGCTGTTGG - Intronic
1001733425 5:173978012-173978034 CTGGCCTCATAGAATGATTTAGG + Intronic
1005919368 6:30385799-30385821 CTGTCTTCATAGAATGATTTAGG - Intergenic
1006040486 6:31249455-31249477 CTGGCCTAATAGAATGAGTTAGG - Intergenic
1006048924 6:31325032-31325054 CTGGCCTAATAGAATGAGTTAGG - Intronic
1006477614 6:34267727-34267749 CTGGCCTAATAGAATGTGTTAGG - Intergenic
1007536013 6:42589506-42589528 CTGGCCTAATAGAATGAGTTAGG + Intronic
1008021141 6:46578949-46578971 CTGTCCTCATAGAATGAGTTAGG - Intronic
1009247460 6:61256947-61256969 GTGGCCTAATAGAATGGGTTAGG + Intergenic
1009289157 6:61862824-61862846 CTGGCCTCATAGAATGGGTTAGG + Intronic
1009330470 6:62413311-62413333 CTGCCCTCATAGAATGAGGTTGG - Intergenic
1009493062 6:64315703-64315725 CTGTCCTCATAAAATGAGGTAGG - Intronic
1009591445 6:65676693-65676715 CTGGCCTCATAAAATGATGTTGG - Intronic
1010164802 6:72902846-72902868 CTGGCTTCATAGAATGATGTAGG + Intronic
1010888100 6:81269197-81269219 CTGGCCTCATAAAATGGTTTAGG - Intergenic
1010961363 6:82149488-82149510 CTGGCCTAATATAATGGGTTTGG - Intergenic
1013320519 6:108983510-108983532 CTGTCCTTATTGAGTGGTCTTGG + Intergenic
1014006132 6:116420456-116420478 CTGTCCTAGATGTATGGTGTGGG - Intronic
1014047356 6:116906131-116906153 CTTTCCCCATAGAATGGTTTTGG + Intronic
1014792918 6:125694778-125694800 CTGGCCTCATAGAATGATCTGGG - Intergenic
1017210985 6:151855985-151856007 CCAACCTAATAGAATAGTGTGGG + Intronic
1018959717 6:168439970-168439992 CTTTCCTGATAAAATTGTGTGGG + Intergenic
1019364578 7:626634-626656 CTGTCCTCATAGAATTATTTAGG - Intronic
1019841217 7:3447507-3447529 CTGTCCTAGAAGAATGGGGTGGG - Intronic
1020850174 7:13343221-13343243 CTGTCCTCATAGAATGATTCAGG + Intergenic
1022878082 7:34556169-34556191 CTGTCCTCATAGAATGAGTTGGG - Intergenic
1024548481 7:50541192-50541214 CTGTGGGAATAGCATGGTGTTGG + Intronic
1027524477 7:79249784-79249806 CTGTCCTCATAGAATGAGTTTGG - Intronic
1029334021 7:99885229-99885251 CTGACCTCATAGAATGAGGTAGG - Intronic
1030066237 7:105661334-105661356 CTGGCCTAATAGGGTGGTATTGG + Intronic
1031250468 7:119373550-119373572 CTGGCCTCATAGAATGATTTAGG - Intergenic
1031261633 7:119528296-119528318 CTGGCTTCATAGAATGGTTTAGG - Intergenic
1031472865 7:122188406-122188428 CTTTCCTATTAGAGTGATGTTGG - Intergenic
1032185708 7:129723670-129723692 CTTTCCCTATTGAATGGTGTTGG + Intronic
1034076829 7:148240070-148240092 ATGGCCTAATGGAATGGTTTTGG - Intronic
1035440769 7:158896907-158896929 CTGGCCTCATAGAATGATTTAGG + Intronic
1037055078 8:14430181-14430203 CTGGCTTCATAGAATGATGTAGG - Intronic
1038416545 8:27400528-27400550 CTGGACTAAGAGAATGGTGTTGG + Intronic
1038951215 8:32416438-32416460 ATGCCCTCATAGAATGGTGAGGG - Intronic
1039081149 8:33735209-33735231 CCTACCTAATAGAATGGTCTTGG + Intergenic
1039653445 8:39371250-39371272 CTGGCTTAATAGAATGATTTAGG - Intergenic
1039678732 8:39704193-39704215 CTGTCCTCATAGAATGAGTTAGG - Intronic
1042128779 8:65565737-65565759 CTGTGGTAAGAGAAGGGTGTTGG + Intergenic
1043093160 8:75929802-75929824 CTGTCCTCATAGAATGAGTTAGG - Intergenic
1043234849 8:77850719-77850741 CTGGCCTAATAGAATGAATTAGG + Intergenic
1043311693 8:78868049-78868071 CTGTCCTCATAGAATGAGTTTGG + Intergenic
1043406725 8:79943150-79943172 CTGTCTTTATATATTGGTGTAGG - Intronic
1047137754 8:122100644-122100666 GAGTCCTAAGAGCATGGTGTGGG + Intergenic
1048412860 8:134193639-134193661 CAGTCCTTAAAGAATGGTGAAGG - Intergenic
1050058920 9:1685041-1685063 CTGTCCTTATTGAATCTTGTAGG - Intergenic
1050408322 9:5333655-5333677 CTGTCCTCATAGAATGAGTTAGG - Intergenic
1050414755 9:5404261-5404283 CTGTCCTCATAGAATGAGTTAGG - Intronic
1051861552 9:21630731-21630753 CTGGCCTCATAGAATGATTTAGG - Intergenic
1054933425 9:70660920-70660942 CTGGCCTCATCGAATGATGTAGG - Intronic
1055983238 9:82027578-82027600 CTTTCCTCATTGAATGGTCTTGG + Intergenic
1056349445 9:85734390-85734412 CTGGCCTTATAGAATGAGGTAGG - Intronic
1056974945 9:91244329-91244351 CTGTCATAATAAAATGTTGGGGG + Intronic
1057504862 9:95625806-95625828 CTGTCCTCTTAGCATGCTGTGGG - Intergenic
1060843894 9:126818864-126818886 CTGACCTAATAGAATGAGTTAGG + Intronic
1203466080 Un_GL000220v1:88557-88579 CTGTCCTCATAGAATGAGTTGGG + Intergenic
1203410142 Un_KI270581v1:454-476 CTGTCCTTATAGAATGAGTTGGG - Intergenic
1186206749 X:7208802-7208824 CTGTCCTAAAATCATGGTGTGGG + Intergenic
1186691957 X:11987040-11987062 CTGGCCTCATAGAATGGGTTTGG - Intergenic
1186999941 X:15166339-15166361 ATGAACTAATACAATGGTGTTGG + Intergenic
1187640997 X:21289664-21289686 CTGGCCTCATAGAATGATGTAGG + Intergenic
1187801801 X:23071926-23071948 CTGTCCTCATAGAATGAGTTAGG - Intergenic
1187854141 X:23620596-23620618 ATGTCCTAATACCAAGGTGTAGG + Intergenic
1188834253 X:34936896-34936918 CTGGCCTCATAGAATGGGTTGGG - Intergenic
1190891165 X:54569226-54569248 CTGACCTCATAGAATGGGTTGGG + Intergenic
1191037318 X:56040723-56040745 CTGGCCTAATAGAATGAGTTAGG + Intergenic
1191147307 X:57180769-57180791 CTGGCCTCATAGAATGCAGTGGG - Intergenic
1191616000 X:63169532-63169554 CTGTCCTGATAGTGTGGTGGTGG - Intergenic
1191620298 X:63209391-63209413 CTGTCCTGATAGTGTGGTGGTGG + Intergenic
1191823950 X:65343312-65343334 CTGTCCTCATAGAATGAGTTAGG - Intergenic
1192310440 X:70008646-70008668 CTGACCTCATAGAATGAGGTAGG + Intronic
1192726507 X:73758869-73758891 CTGTCCTCATAGAATGAGTTAGG + Intergenic
1192790279 X:74375223-74375245 CTGACCTCATAGAATGGGTTTGG + Intergenic
1193570226 X:83132261-83132283 CTGGCCTCAAAGAATGGTTTAGG - Intergenic
1193662352 X:84272858-84272880 CTGTCTTCATAGAATGATTTAGG - Intergenic
1193885427 X:86979192-86979214 CTGTCCTCATAAAATGGGATTGG - Intergenic
1194055220 X:89123751-89123773 CTGTCCTCATAGAATGGTTTAGG + Intergenic
1194180681 X:90707848-90707870 CTGGCCTCATAGAATGATTTAGG + Intergenic
1194547398 X:95254509-95254531 CTGGCTTAATAGAATGATTTAGG + Intergenic
1194589664 X:95784062-95784084 CTCTCCTGCTAGAATGGTATGGG - Intergenic
1195121854 X:101762438-101762460 CTGTCCCCACAGAATTGTGTAGG + Intergenic
1195224243 X:102776228-102776250 CTGTCCTCATAGAATGAGTTTGG + Intergenic
1195851769 X:109290653-109290675 CTGGCCTCATAGAATGGCTTTGG + Intergenic
1196497450 X:116337779-116337801 CTGGCCTCATAGAATGATTTAGG - Intergenic
1196730027 X:118931685-118931707 CTGTCCTCATAGAATGAGTTAGG + Intergenic
1196815611 X:119663354-119663376 CTGTCCTCCCAGAATGGTGTGGG - Intronic
1197418509 X:126206955-126206977 CTGACCTCATAGAATGATTTAGG + Intergenic
1198566243 X:137907907-137907929 CTTTCCTCATTGAATGGTCTTGG - Intergenic
1198733056 X:139754474-139754496 CTGGCCTGATAGAATGATTTAGG - Intronic
1199098676 X:143771657-143771679 CTGGCCTAATAGAATGAGTTGGG - Intergenic
1199226706 X:145384408-145384430 CTGGCCAAATAGAATTGTTTTGG + Intergenic
1199304301 X:146249458-146249480 CTGACCTCATAGAATGAGGTTGG - Intergenic
1199818968 X:151425673-151425695 GTGTCCTCATGGCATGGTGTTGG - Intergenic
1199830285 X:151543027-151543049 CTTTCCTCATTGAATGGTCTTGG + Intergenic
1200105193 X:153708161-153708183 CTTTCTTGATAGAATGTTGTTGG + Intronic
1200527341 Y:4290004-4290026 CTGGCCTCATAGAATGATTTAGG + Intergenic
1202391639 Y:24376840-24376862 CTTTCCTTATTGAATGGTCTTGG - Intergenic
1202479146 Y:25293277-25293299 CTTTCCTTATTGAATGGTCTTGG + Intergenic