ID: 1157493613

View in Genome Browser
Species Human (GRCh38)
Location 18:48139987-48140009
Sequence CAGAGCACGTGGAAGCCCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 105}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157493608_1157493613 -3 Left 1157493608 18:48139967-48139989 CCTTCCCGGTTCAGGTCAGCCAG 0: 1
1: 0
2: 0
3: 8
4: 107
Right 1157493613 18:48139987-48140009 CAGAGCACGTGGAAGCCCGCTGG 0: 1
1: 0
2: 0
3: 12
4: 105
1157493600_1157493613 15 Left 1157493600 18:48139949-48139971 CCCACCTCTGGCTCCCCGCCTTC 0: 1
1: 0
2: 3
3: 40
4: 489
Right 1157493613 18:48139987-48140009 CAGAGCACGTGGAAGCCCGCTGG 0: 1
1: 0
2: 0
3: 12
4: 105
1157493599_1157493613 16 Left 1157493599 18:48139948-48139970 CCCCACCTCTGGCTCCCCGCCTT 0: 1
1: 0
2: 3
3: 50
4: 397
Right 1157493613 18:48139987-48140009 CAGAGCACGTGGAAGCCCGCTGG 0: 1
1: 0
2: 0
3: 12
4: 105
1157493597_1157493613 26 Left 1157493597 18:48139938-48139960 CCTTCTCAGCCCCCACCTCTGGC 0: 1
1: 0
2: 11
3: 98
4: 742
Right 1157493613 18:48139987-48140009 CAGAGCACGTGGAAGCCCGCTGG 0: 1
1: 0
2: 0
3: 12
4: 105
1157493610_1157493613 -8 Left 1157493610 18:48139972-48139994 CCGGTTCAGGTCAGCCAGAGCAC 0: 1
1: 0
2: 0
3: 11
4: 116
Right 1157493613 18:48139987-48140009 CAGAGCACGTGGAAGCCCGCTGG 0: 1
1: 0
2: 0
3: 12
4: 105
1157493602_1157493613 11 Left 1157493602 18:48139953-48139975 CCTCTGGCTCCCCGCCTTCCCGG 0: 1
1: 0
2: 1
3: 37
4: 403
Right 1157493613 18:48139987-48140009 CAGAGCACGTGGAAGCCCGCTGG 0: 1
1: 0
2: 0
3: 12
4: 105
1157493607_1157493613 0 Left 1157493607 18:48139964-48139986 CCGCCTTCCCGGTTCAGGTCAGC 0: 1
1: 0
2: 0
3: 16
4: 481
Right 1157493613 18:48139987-48140009 CAGAGCACGTGGAAGCCCGCTGG 0: 1
1: 0
2: 0
3: 12
4: 105
1157493595_1157493613 27 Left 1157493595 18:48139937-48139959 CCCTTCTCAGCCCCCACCTCTGG 0: 1
1: 1
2: 7
3: 67
4: 606
Right 1157493613 18:48139987-48140009 CAGAGCACGTGGAAGCCCGCTGG 0: 1
1: 0
2: 0
3: 12
4: 105
1157493605_1157493613 2 Left 1157493605 18:48139962-48139984 CCCCGCCTTCCCGGTTCAGGTCA 0: 1
1: 0
2: 1
3: 44
4: 823
Right 1157493613 18:48139987-48140009 CAGAGCACGTGGAAGCCCGCTGG 0: 1
1: 0
2: 0
3: 12
4: 105
1157493606_1157493613 1 Left 1157493606 18:48139963-48139985 CCCGCCTTCCCGGTTCAGGTCAG 0: 1
1: 0
2: 0
3: 19
4: 216
Right 1157493613 18:48139987-48140009 CAGAGCACGTGGAAGCCCGCTGG 0: 1
1: 0
2: 0
3: 12
4: 105
1157493601_1157493613 14 Left 1157493601 18:48139950-48139972 CCACCTCTGGCTCCCCGCCTTCC 0: 1
1: 0
2: 5
3: 74
4: 840
Right 1157493613 18:48139987-48140009 CAGAGCACGTGGAAGCCCGCTGG 0: 1
1: 0
2: 0
3: 12
4: 105
1157493609_1157493613 -7 Left 1157493609 18:48139971-48139993 CCCGGTTCAGGTCAGCCAGAGCA 0: 1
1: 0
2: 1
3: 15
4: 125
Right 1157493613 18:48139987-48140009 CAGAGCACGTGGAAGCCCGCTGG 0: 1
1: 0
2: 0
3: 12
4: 105
1157493598_1157493613 17 Left 1157493598 18:48139947-48139969 CCCCCACCTCTGGCTCCCCGCCT 0: 1
1: 0
2: 7
3: 87
4: 1106
Right 1157493613 18:48139987-48140009 CAGAGCACGTGGAAGCCCGCTGG 0: 1
1: 0
2: 0
3: 12
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157493613 Original CRISPR CAGAGCACGTGGAAGCCCGC TGG Intronic
900327037 1:2113449-2113471 CAGGGCAGGTGGAAGCCAGCAGG + Intronic
900891513 1:5453099-5453121 CAGATCACCTGGAAGCCCTCAGG + Intergenic
900902782 1:5528102-5528124 CAGAGCTCTTGGCAGCCGGCGGG + Intergenic
903519123 1:23934095-23934117 CTGAACACGTGGAAGCCAGCAGG - Intergenic
905243314 1:36595505-36595527 CAGAGGAGGAGGAAGCCGGCGGG - Intergenic
908148301 1:61271553-61271575 CAGAGCAGCTGGCAGCCCCCAGG + Intronic
908354846 1:63319189-63319211 CAGAGTACATGGTACCCCGCTGG - Intergenic
918180331 1:182081707-182081729 CAGAGCACATGGGAGCACACAGG + Intergenic
923384740 1:233454929-233454951 CAGAGCTTGTGGCAGCCCCCAGG - Intergenic
1062883365 10:996857-996879 CAGTGCACTTTGAAGCCTGCAGG - Intronic
1066080797 10:31928831-31928853 CAGGGCACGTCGGAGCGCGCCGG + Intronic
1069711134 10:70489277-70489299 CAGAGCACCTGGGACCCCACTGG - Intronic
1072430946 10:95369959-95369981 CAGAGCATGAGGAAGCCAGCAGG - Intronic
1073096907 10:100985402-100985424 CTGAGAACGTGGAATCCCACGGG + Exonic
1076554736 10:131313715-131313737 CAGAGCATCAGGAAGCCCGGAGG - Intergenic
1077110245 11:859099-859121 CAGGGCACGTGTGAGCCCGGGGG - Intronic
1082243316 11:49892552-49892574 CAGAGGGCGGGGAAGCCCGAGGG - Intergenic
1085048283 11:73365896-73365918 CAGAGCAGGTTGAAGCCATCTGG - Exonic
1085517446 11:77119624-77119646 CACAACACGTGGAAGGCCTCAGG - Intronic
1086062914 11:82718607-82718629 CAGAGCATGGGGAAGTCCGTTGG + Intergenic
1089651681 11:119918516-119918538 CAGAACACGTGGATGACCACAGG - Intergenic
1090563902 11:127965141-127965163 GAGAGCACCTGGAAGGCCTCCGG - Intergenic
1090629457 11:128633493-128633515 CAGAGCCCGGGGAAGCCCCCAGG - Intergenic
1092140733 12:6181795-6181817 CAGGGCATGGGGAAGCCAGCAGG + Intergenic
1096181154 12:49551139-49551161 CAGAGCACCTGGGAGCCCTGTGG - Intronic
1096622649 12:52874228-52874250 CTGGGAACCTGGAAGCCCGCGGG + Intergenic
1107982067 13:45743461-45743483 CTAAGCACCTGGAAGCCTGCAGG - Intergenic
1109542293 13:63794952-63794974 CAAAGCACATGGAAGTCAGCTGG - Intergenic
1113546247 13:111153531-111153553 CAGAGGAGGTGGCAGCTCGCCGG + Intronic
1117320009 14:54612820-54612842 CAGAGAAAGTGAAAGCCGGCCGG + Intronic
1120169726 14:81236376-81236398 CAGGCCACGTGGGAGCCCACAGG - Intergenic
1121713739 14:96058117-96058139 CACAGCACGTGGGAGCCAGGTGG - Intronic
1122411837 14:101529548-101529570 CAGAGCCCCTGGCAGCCCACCGG + Intergenic
1123036386 14:105473674-105473696 CAGAGCACCAGGAAGCCCGTGGG + Intronic
1123069918 14:105637640-105637662 CAGAGCACCTGGAGGCCCGTAGG + Intergenic
1123094940 14:105762584-105762606 CAGGGCACCCGGAAGCCCGTAGG + Intergenic
1126143411 15:45455358-45455380 CAGAGCAGGTGGAAAGCCGGGGG + Intergenic
1129351742 15:74959389-74959411 CAGCGCGCGTCGCAGCCCGCCGG + Intronic
1130233314 15:82113075-82113097 CAGAGCACCAGGAAGCCTGTGGG + Intergenic
1132339009 15:101066265-101066287 CAGAGCAAGGGGAAGCCCCCTGG + Intronic
1139842248 16:69891015-69891037 AAGAGCACGTGGAAGCCATCTGG - Intronic
1142848551 17:2693591-2693613 CAGAGGACGTGGGAGCTCGGTGG + Intronic
1147606452 17:41776418-41776440 CAGAGGAGGCGGAAGCCAGCTGG + Intronic
1148048990 17:44759941-44759963 CAGAGCCCCAGGAAGCCCACGGG + Intronic
1151885430 17:76920739-76920761 TTGAGCACGTGGAAGGCCACTGG + Intronic
1152013833 17:77736552-77736574 CAAAGCACGCGGCAGCCTGCTGG - Intergenic
1152735715 17:81995924-81995946 CAGAGCCCAGGGAAGCCCTCCGG - Intronic
1157187648 18:45554170-45554192 CATATCACGTGGAAGCCAGTGGG - Intronic
1157493613 18:48139987-48140009 CAGAGCACGTGGAAGCCCGCTGG + Intronic
1163228238 19:15979880-15979902 CAGACCACATGGAGCCCCGCAGG - Intergenic
1163611324 19:18303414-18303436 CAGAGCAAGAGGAGGCCGGCTGG - Intergenic
1165917199 19:39268157-39268179 CAGAGCAGGTGGAATCCTCCTGG + Intergenic
924963714 2:57285-57307 CAGAGCCTGTGGAAGCCAGGAGG + Intergenic
929037617 2:37709572-37709594 CTGAGCACCTGGAGGCCCTCAGG + Intronic
938135547 2:128753607-128753629 CAGAGCCAGAGGAAGCCAGCTGG + Intergenic
946201858 2:218075279-218075301 CAGAGCATGTGGGAGCCAGAAGG + Exonic
948795149 2:240398862-240398884 CAGGCCACGGGGCAGCCCGCAGG + Intergenic
1170972187 20:21126243-21126265 CAGGGCACGCGGAAGACCCCCGG - Intronic
1172447463 20:35000713-35000735 CAGAGCAGGTGCAGGCCTGCTGG + Intronic
1173522534 20:43710453-43710475 CAGAGCACGGGAAAGCCCCTCGG + Intronic
1173827898 20:46058852-46058874 CAGAGCACGGAGAAGGCGGCTGG - Intronic
1176089561 20:63312893-63312915 CAGATCACGTGGACGCCCCTGGG + Exonic
1181121528 22:20670788-20670810 CAGCGCCCGAGGAGGCCCGCAGG + Intergenic
1182476740 22:30580672-30580694 CAGCGCAGGAGGAAGACCGCAGG - Exonic
1183213035 22:36462596-36462618 CTCAGCAGGTGGAAGCACGCTGG - Intergenic
1184710666 22:46247598-46247620 CACAGCCCCTGGAAGCCAGCTGG + Intronic
1184826050 22:46952047-46952069 CAGGGCACGTGGATGTCCACAGG + Intronic
1185122075 22:48977325-48977347 CAGAGCACCGGGCAGCCCCCAGG + Intergenic
954301145 3:49701483-49701505 CGGAGCACGTCGAAGCTGGCGGG - Exonic
962283992 3:134071627-134071649 CAGAGCCCCTGGAAGCCCTCTGG - Intronic
962733900 3:138306949-138306971 GAGAGCACGTGGCAGACAGCAGG - Intronic
962950997 3:140218822-140218844 CAGAGTATGTGGAATCCCCCAGG + Intronic
972656420 4:41067836-41067858 CAGAGCAAGTGGAAGAGCCCAGG + Intronic
979561096 4:122103049-122103071 GAGAGAAAGTGGAAGCACGCAGG + Intergenic
983949853 4:173627324-173627346 CAGACCACATGGAAGCCAGAGGG - Intergenic
984811279 4:183798028-183798050 CAGCGGATGTGGAAGCCCGAGGG - Intergenic
991581462 5:68159847-68159869 TTGAGCACCTGGAGGCCCGCGGG + Intergenic
992048908 5:72925779-72925801 CAGGCCACGTGGGAGCCCACTGG - Intergenic
995896843 5:117022877-117022899 CAGAGCGCCTGGAAGGCTGCAGG - Intergenic
998042772 5:138963396-138963418 CAGAGCCAGTGGAATCACGCAGG + Intronic
998456369 5:142276971-142276993 CAGAGCTCTTGGAAGCTCCCTGG + Intergenic
1005821119 6:29600080-29600102 CAGGGGACATGGAAGCCTGCAGG + Intronic
1007159396 6:39776701-39776723 AAGAGAATGGGGAAGCCCGCTGG + Intergenic
1019634600 7:2068875-2068897 CAAGGCACGTGGGAGCCTGCAGG + Intronic
1019849609 7:3541310-3541332 CTGAGCAAGTGGAAGCACACAGG - Intronic
1029737450 7:102472637-102472659 CAGAGCTCCCGGAAGCCCGCGGG - Intronic
1033306887 7:140231461-140231483 CCGAGCCAATGGAAGCCCGCGGG + Intergenic
1033367797 7:140684670-140684692 CAGAGCAGGTGGAGTCCTGCAGG + Intronic
1033405800 7:141071334-141071356 CAGAGCCTGAGGAGGCCCGCTGG - Intergenic
1035304401 7:157921960-157921982 CAGGGCACGTGGGAACCCTCTGG + Intronic
1035355878 7:158275983-158276005 CATAGCACGTGTAAGGCGGCGGG - Intronic
1035400584 7:158562736-158562758 CAAAGCTCTTGGAAGACCGCTGG + Intronic
1037180457 8:15998950-15998972 CAGAGCAGGTTGAATCCCCCAGG - Intergenic
1044731023 8:95228864-95228886 CAGAGCAGGTGGAAGAAGGCTGG - Intergenic
1048493731 8:134918421-134918443 CAGGGCAAATGGAAGCCCACTGG + Intergenic
1052799478 9:32954783-32954805 TAGAGCACGTGGAAAACAGCAGG + Intergenic
1061486661 9:130923775-130923797 CAGTACACCTGGAAGCCGGCCGG + Exonic
1062281480 9:135753851-135753873 CCGAGCCTGTGGAAGCCCTCGGG + Intronic
1186421910 X:9433235-9433257 CAGAGCTGGTGGAACCCCGCTGG + Intergenic
1186463378 X:9765720-9765742 CAGAGCGCGTGGAAGGCCCGCGG + Exonic
1190362452 X:49662109-49662131 CAGAGCTCCTGGAAGCCCCAAGG + Intergenic
1190681946 X:52833851-52833873 CAGAGAACGTGGCAGCCCAGAGG - Intergenic
1192205176 X:69090991-69091013 CAGAGCACTTGGAAGAGCGAGGG + Intergenic
1196950996 X:120875485-120875507 CAGGGCCCGTGGAAGGCCTCGGG - Exonic
1196951827 X:120931857-120931879 CAGGGCCCGTGGAAGGCCTCGGG - Exonic
1196952511 X:120936718-120936740 CAGGGCCCGTGGAAGGCCTCGGG - Exonic
1196953196 X:120941579-120941601 CAGGGCCCGTGGAAGGCCTCGGG - Exonic
1196953881 X:120946439-120946461 CAGGGCCCGTGGAAGGCCTCGGG - Exonic
1196954566 X:120951300-120951322 CAGGGCCCGTGGAAGGCCTCGGG - Exonic
1196955249 X:120956160-120956182 CAGGGCCCGTGGAAGGCCTCGGG - Exonic
1196955936 X:120961043-120961065 CAGGGCCCGTGGAAGGCCTCGGG - Exonic
1196956618 X:120965904-120965926 CAGGGCCCGTGGAAGGCCTCGGG - Exonic
1196957300 X:120970764-120970786 CAGGGCCCGTGGAAGGCCTCGGG - Exonic
1196957982 X:120975624-120975646 CAGGGCCCGTGGAAGGCCTCGGG - Exonic
1196958664 X:120980484-120980506 CAGGGCCCGTGGAAGGCCTCGGG - Exonic
1196959345 X:120985344-120985366 CAGGGCCCGTGGAAGGCCTCGGG - Exonic
1202338424 Y:23834353-23834375 CAGAGCACACTGAAGCCCCCTGG + Intergenic
1202532342 Y:25835719-25835741 CAGAGCACACTGAAGCCCCCTGG - Intergenic