ID: 1157496365

View in Genome Browser
Species Human (GRCh38)
Location 18:48160391-48160413
Sequence CAGTATAACAGCAGGCACGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 67}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157496360_1157496365 9 Left 1157496360 18:48160359-48160381 CCCTAACATGGAGCTACCCTAAA 0: 1
1: 0
2: 0
3: 5
4: 109
Right 1157496365 18:48160391-48160413 CAGTATAACAGCAGGCACGCTGG 0: 1
1: 0
2: 0
3: 1
4: 67
1157496363_1157496365 -8 Left 1157496363 18:48160376-48160398 CCTAAAATTAAAGCACAGTATAA 0: 1
1: 0
2: 5
3: 40
4: 492
Right 1157496365 18:48160391-48160413 CAGTATAACAGCAGGCACGCTGG 0: 1
1: 0
2: 0
3: 1
4: 67
1157496361_1157496365 8 Left 1157496361 18:48160360-48160382 CCTAACATGGAGCTACCCTAAAA 0: 1
1: 0
2: 0
3: 9
4: 82
Right 1157496365 18:48160391-48160413 CAGTATAACAGCAGGCACGCTGG 0: 1
1: 0
2: 0
3: 1
4: 67
1157496362_1157496365 -7 Left 1157496362 18:48160375-48160397 CCCTAAAATTAAAGCACAGTATA 0: 1
1: 0
2: 1
3: 29
4: 383
Right 1157496365 18:48160391-48160413 CAGTATAACAGCAGGCACGCTGG 0: 1
1: 0
2: 0
3: 1
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157496365 Original CRISPR CAGTATAACAGCAGGCACGC TGG Intronic
903130440 1:21275869-21275891 CAGTAGCAGAGCAGGCACCCAGG - Intronic
903153497 1:21429253-21429275 CAGTACAACAGCACGCGGGCGGG + Intergenic
907726571 1:57025699-57025721 CAGCAGAACAGCAAGCACCCAGG + Intronic
910195242 1:84633434-84633456 CAGTATAAAAGGAGACACCCAGG - Intronic
910436037 1:87207269-87207291 CAGTCTATCAGCAGTCATGCTGG + Intergenic
910969259 1:92838614-92838636 CAGGATTTCAGCAGGCACACAGG - Intronic
913104372 1:115598253-115598275 CAGTACAAAAGCAGTCAGGCAGG - Intergenic
921393041 1:214636435-214636457 CAGTTTAGCAGCAGGGAAGCAGG + Intronic
1069783171 10:70969514-70969536 CAGGCTGACAGCAGGCAGGCTGG + Intergenic
1071920814 10:90348036-90348058 CAGAATAGCAGGAGGCAGGCAGG + Intergenic
1074235002 10:111576305-111576327 CAGTGTAGCAGCAGGCCCTCTGG - Intergenic
1075545839 10:123353950-123353972 CATTAAAACAGCAGGCAATCAGG - Intergenic
1075700300 10:124464981-124465003 CAGTAAAGCTGCAGGCACACAGG + Intronic
1075740512 10:124693173-124693195 CTGTTGAAAAGCAGGCACGCCGG + Intronic
1076759363 10:132593319-132593341 CAGGATCCCAGCAGGCCCGCAGG - Intronic
1080137127 11:28868287-28868309 CATAATAACAGCATGCATGCAGG - Intergenic
1080756546 11:35205741-35205763 CAGAATAACATCATGCACTCGGG + Intronic
1086324136 11:85681290-85681312 GAGTAGAACAGCAGGCACCTGGG + Intronic
1095444530 12:42270829-42270851 CAGTATCACAGGAAGCAAGCAGG + Intronic
1101003419 12:100378738-100378760 CAGTATAAATGCAGGCCGGCAGG + Intronic
1102585108 12:113917411-113917433 CAGTATAACAGAAGGAGCTCAGG - Intronic
1103705366 12:122868334-122868356 CTGTATACCAGCAGGCAGCCTGG - Intronic
1105663042 13:22520619-22520641 CAATATAACAGAAGGCAGGAGGG + Intergenic
1112614545 13:100989949-100989971 CTGTATAAAAACAGGCAAGCTGG + Intergenic
1121857285 14:97281851-97281873 CAGTCCAAAAGCAGGCAGGCTGG + Intergenic
1129992158 15:79974676-79974698 AAGTATAAGACCAGGCACGGTGG + Intergenic
1130830178 15:87591332-87591354 CAGTATAGCAGCAGCCCCTCTGG + Intergenic
1132116821 15:99143118-99143140 CAGTGTAAGAGCAGGCACCAAGG + Intronic
1140469715 16:75207193-75207215 CCAGATAACAGCAGGCACACAGG - Intergenic
1145058401 17:19717531-19717553 CAGGAAGACAGCAGGCAGGCTGG + Intronic
1148969588 17:51468174-51468196 CACTATAAAAGCAGACATGCTGG - Intergenic
1151325573 17:73377906-73377928 CACAAAAACAGCAGGCAGGCCGG - Intronic
1153473464 18:5471150-5471172 CAGTATAACAGAAAGCACACCGG - Intronic
1156545967 18:37964003-37964025 CAGGGTAACAGCAGGAACACTGG + Intergenic
1157496365 18:48160391-48160413 CAGTATAACAGCAGGCACGCTGG + Intronic
926173498 2:10569082-10569104 AAGGATTAGAGCAGGCACGCTGG + Intergenic
926250602 2:11153576-11153598 AAGTAAAACACCTGGCACGCAGG + Intergenic
926321791 2:11753486-11753508 CAGTTTAACCACAGGGACGCTGG + Intronic
943445182 2:187976441-187976463 AAGTATGACAGCAGTCAGGCTGG + Intergenic
948093605 2:235315993-235316015 CAGGAGAACTGCAGACACGCAGG + Intergenic
1175983467 20:62752880-62752902 CAGGAGAACAGGAGGGACGCGGG + Intronic
1179782246 21:43708940-43708962 CATTATCCCAGCAGGCACGGTGG - Intergenic
1180094708 21:45550606-45550628 CAGGATCACAGCAGCCCCGCCGG + Intergenic
1182123346 22:27800494-27800516 CAGGTCAACAGCAGGAACGCTGG - Exonic
954425931 3:50443116-50443138 CAGCATACCAGCTGGCACGGGGG + Intronic
959065368 3:101651408-101651430 CATCTTAACAGCAGGCATGCAGG - Exonic
963574423 3:147042049-147042071 CGTTATAACGGCAGGCACTCTGG + Intergenic
966311881 3:178602816-178602838 CACTATAACATCAGAAACGCTGG - Intronic
966600774 3:181773091-181773113 CAGTATAGCAGCAGGAAAACAGG + Intergenic
969831880 4:9804567-9804589 CAGCATCACAGTAGGCAGGCAGG - Intronic
969942176 4:10744114-10744136 CAATTTAACAGTAGGCACACCGG - Intergenic
973742319 4:53930047-53930069 CAGCATATCAGGAGGCACTCAGG - Intronic
997362880 5:133306266-133306288 CTGTAGGCCAGCAGGCACGCAGG + Intronic
1007220657 6:40276227-40276249 CAGCTTAGCACCAGGCACGCGGG + Intergenic
1014391598 6:120872101-120872123 CAATATCAGAGCAGGCACCCAGG - Intergenic
1017253715 6:152309830-152309852 CAGTGTAACATCATGCAGGCAGG - Exonic
1019122058 6:169811614-169811636 CAGCTTCACAGCAGGCAGGCTGG - Intergenic
1019763157 7:2829222-2829244 CAGTTTAAAATCAGGCACACAGG + Intronic
1023663136 7:42491228-42491250 CAGAAAACCAGCAGGCATGCAGG + Intergenic
1023850368 7:44146637-44146659 CATTACATCAGCAGGCACGAGGG + Intronic
1025807254 7:64846116-64846138 CGGTATAAAAACAGGCACGTAGG - Intergenic
1039209243 8:35193349-35193371 TAGCATAAAAGCAGGCACACAGG - Intergenic
1039556384 8:38478602-38478624 CAGTAAACCACCAGGCACGGTGG - Intergenic
1046723590 8:117650759-117650781 CAGTGAAGCAGCAGGCACTCTGG - Intergenic
1058442965 9:105027269-105027291 CAATATAGCTGCAGGAACGCTGG - Intergenic
1061744339 9:132728571-132728593 AATTATAACAGCTGCCACGCTGG - Intronic
1195071984 X:101290235-101290257 CAGTAGAAAAGCAGACACCCAGG + Intronic
1198713473 X:139530965-139530987 GAGTCTAACAGCCAGCACGCAGG + Intronic
1201063689 Y:10069812-10069834 GTGCACAACAGCAGGCACGCAGG - Intergenic