ID: 1157499019

View in Genome Browser
Species Human (GRCh38)
Location 18:48177210-48177232
Sequence GGGCGAGGGGACCACTTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 95}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157499019_1157499023 -5 Left 1157499019 18:48177210-48177232 CCAGCAAAGTGGTCCCCTCGCCC 0: 1
1: 0
2: 1
3: 9
4: 95
Right 1157499023 18:48177228-48177250 CGCCCTCCTGCTTCACCCTCAGG 0: 1
1: 0
2: 0
3: 40
4: 572
1157499019_1157499029 16 Left 1157499019 18:48177210-48177232 CCAGCAAAGTGGTCCCCTCGCCC 0: 1
1: 0
2: 1
3: 9
4: 95
Right 1157499029 18:48177249-48177271 GGCCTCAGCTTCTAGAACTCAGG 0: 1
1: 0
2: 1
3: 22
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157499019 Original CRISPR GGGCGAGGGGACCACTTTGC TGG (reversed) Intronic
900801354 1:4738920-4738942 GGGCAAGGTGACCACTTAGGAGG + Intronic
902333571 1:15742640-15742662 GGGCGAGGTGCTCACCTTGCAGG - Exonic
904008137 1:27374411-27374433 GGGCAGGAGGACAACTTTGCTGG + Exonic
904080158 1:27867262-27867284 GGGCGGGGGGAGAACTGTGCAGG + Intergenic
917329672 1:173868457-173868479 GGGCGAGGTGACCCCGGTGCAGG - Intronic
923231747 1:231993218-231993240 GAGTGAGAGGTCCACTTTGCAGG + Intronic
1068065613 10:52127030-52127052 AGGCGAGGGGATCACTTAGGAGG + Intronic
1073306315 10:102505496-102505518 GGGCAAGTGGACATCTTTGCTGG + Intronic
1074839694 10:117337766-117337788 GGGCAAGGGAGCTACTTTGCTGG - Intronic
1075728106 10:124620907-124620929 GGTCGATGGGACCAGCTTGCGGG + Exonic
1078100207 11:8325951-8325973 GGGCCAGAGGACCACTCAGCTGG - Intergenic
1078353897 11:10618971-10618993 GGGAGAGGGGACCAGGTTGCAGG + Intronic
1078563009 11:12389611-12389633 GTGGGAGGGGATCCCTTTGCTGG - Intronic
1081960558 11:47133519-47133541 GGGCTGGGGGACCACTGTGCTGG - Intronic
1082109996 11:48264006-48264028 GGGGGAGGTGAGCACTTTGCTGG - Exonic
1083655262 11:64226331-64226353 GCGCGCGGGGACCCCTTTCCAGG - Exonic
1089110972 11:116055761-116055783 GGGCCACGGGACCACTGTGGAGG + Intergenic
1089201225 11:116725796-116725818 GGGCGATGGAGCCACTCTGCAGG - Intergenic
1090085481 11:123646526-123646548 TGGCGAGCGGACCACTAAGCTGG + Intronic
1098041215 12:66355673-66355695 GGGAGAGGGGAAGACTTTGCTGG + Intronic
1099394497 12:82121165-82121187 GGGGGAGGGGACAGCTCTGCTGG - Intergenic
1103855937 12:123972057-123972079 GGGCGAGGGATCCGCATTGCAGG - Intronic
1104386515 12:128355775-128355797 GTGGGAGGGGAGCACTTTGCAGG - Intronic
1104643955 12:130484137-130484159 GGGCCAGGGGTCCACTTCGGGGG - Intronic
1106594141 13:31122685-31122707 GGGCAAGGGGACCCCTGTCCTGG + Intergenic
1114671961 14:24416165-24416187 GGGCAAGAGGCCCAATTTGCTGG + Exonic
1121615118 14:95308613-95308635 GGGAGAGGTGACCACAGTGCAGG - Intronic
1123223339 14:106876958-106876980 GGGAGAGGGGACATCTGTGCAGG - Intergenic
1124721776 15:32116947-32116969 TGGAGAGGGGACCTCTATGCAGG + Intronic
1124890371 15:33726577-33726599 GGGCCTGGGGGCCACTGTGCTGG - Intronic
1126349443 15:47729432-47729454 GGGCCAAGGGACCACTTTGGAGG + Intronic
1141995680 16:87635181-87635203 GGGCAAGGTGAACGCTTTGCTGG - Intronic
1142089146 16:88200837-88200859 GAGGGCGGGGACCCCTTTGCAGG - Intergenic
1143479653 17:7220962-7220984 GGTGGAGGAGACCACTTGGCAGG + Exonic
1144572511 17:16408274-16408296 GGGCAAGGGGACCAGCTGGCTGG - Intergenic
1147915342 17:43882269-43882291 GGGTGAGGGGCCCACCTGGCGGG + Exonic
1147924832 17:43939928-43939950 GGATGAGGGGTCCACTTTCCTGG - Intergenic
1148588652 17:48799153-48799175 TGGCCAGGGGACAACATTGCAGG - Intronic
1148887943 17:50787070-50787092 GAGAGAGGGGACCACGTTGCAGG - Intergenic
1150893633 17:69184031-69184053 GGGCATTGAGACCACTTTGCGGG + Intronic
1151544867 17:74786564-74786586 GGGCGAGGGGACTAGGATGCCGG + Intronic
1152185684 17:78855152-78855174 GGGCGATGGGAGCACTTGCCAGG + Exonic
1157499019 18:48177210-48177232 GGGCGAGGGGACCACTTTGCTGG - Intronic
1161815279 19:6495980-6496002 GGGCGAGGGCACCACGCTGAAGG + Exonic
1163520233 19:17787758-17787780 CAGCGAGGGGACCACTCTGTCGG + Exonic
1164526481 19:29017038-29017060 GGGAGAAGGCACCACTCTGCTGG - Intergenic
1165242848 19:34481685-34481707 GGGCGGAGGGACTCCTTTGCGGG - Exonic
1168260863 19:55193691-55193713 AGGCGGGGGAAACACTTTGCTGG + Intronic
925348946 2:3188061-3188083 GGGCGAGGGGACAAGTATGGGGG - Intergenic
925903397 2:8524546-8524568 GGGGGAGGAGAGAACTTTGCTGG + Intergenic
927824399 2:26298237-26298259 GGGCGAGGGGAGATCTGTGCAGG - Intergenic
927825439 2:26306237-26306259 GGGCGAGGGGAGATCTGTGCAGG - Intergenic
930837110 2:55806046-55806068 AAGCCAGGGGACCACATTGCAGG + Intergenic
932288113 2:70553753-70553775 AGCCGAGGGGACCATTTTACGGG + Exonic
934704291 2:96465767-96465789 CGGCAAGGGCACCACCTTGCAGG - Intergenic
935607531 2:104985609-104985631 GTGAGAGGGGACCAGTTTCCAGG + Intergenic
936685636 2:114823217-114823239 GGGGGAAGGGAACTCTTTGCAGG + Intronic
937917478 2:127106200-127106222 GGGCGAGGGCACCTCCTTGCGGG + Intronic
948631926 2:239307958-239307980 GGGGGATGGGGACACTTTGCTGG - Intronic
948893417 2:240917596-240917618 GGGAGAGGGGTCCTCTGTGCTGG + Intergenic
1170472918 20:16685977-16685999 GGGCAAGGGATCCTCTTTGCTGG + Intergenic
1174035259 20:47664854-47664876 GGGCCAGGGGACCCCTAAGCCGG + Intronic
1175489851 20:59372574-59372596 GAGGGATGAGACCACTTTGCTGG + Intergenic
1175675353 20:60942030-60942052 TGACTAGAGGACCACTTTGCGGG - Intergenic
1179576311 21:42310532-42310554 GGCCGGGGGGACCACAGTGCAGG + Intergenic
1180194249 21:46183707-46183729 GGGGGAGGAGACCAGCTTGCGGG + Exonic
1180194284 21:46183812-46183834 GGGGGAGGAGACCAGCTTGCGGG + Intronic
1183472383 22:38016527-38016549 GGGCGAGGGGGCTGCTTGGCAGG + Intronic
1185370036 22:50456707-50456729 GGGCCAGGGCACCACTTACCTGG + Intronic
950676304 3:14556247-14556269 GGGCCAGGTGAGCACTTTGGTGG - Intergenic
955786390 3:62544769-62544791 GGGGGAGGGAAGCACATTGCAGG + Intronic
956559449 3:70558210-70558232 GGGGGAGGGGACCACATGGTAGG + Intergenic
958977288 3:100682410-100682432 GGGCGCGGTGGCCACGTTGCTGG - Intronic
961340446 3:126213576-126213598 GGGCGAGGGGATCACACCGCGGG + Intergenic
962811209 3:138960769-138960791 AGGCGAGGTGACCAGTGTGCAGG - Intergenic
968582962 4:1403456-1403478 GGGCGCGGGGACCACCCCGCAGG - Exonic
968734378 4:2287802-2287824 GGGCGAGGGGGGCACTCTGAGGG + Intronic
971324781 4:25634876-25634898 GGGAGAGGGGAGCACTTTGCAGG + Intergenic
979531968 4:121778073-121778095 GGGAGAAGTGACAACTTTGCTGG - Intergenic
985714653 5:1448518-1448540 GGGTGAGGGGACCAGTAGGCAGG + Intergenic
986773127 5:10991271-10991293 GGGTAGGGAGACCACTTTGCTGG + Intronic
988510318 5:31859055-31859077 GGGCCACAGGACCACTTGGCAGG - Intronic
989565352 5:42895977-42895999 GGGGCAGTGGACCACTGTGCTGG - Intergenic
997431530 5:133844323-133844345 GGGTGAGGGGCCCCCTGTGCAGG - Intergenic
1001602889 5:172940405-172940427 GTGGGAGGGGAGCACTTTGGAGG - Intronic
1002534874 5:179870541-179870563 GGTCGAGGGGACCCCTAGGCTGG + Intronic
1006598803 6:35212560-35212582 GGGCAAGGGGAGGACTTTGTTGG - Intergenic
1014253691 6:119140618-119140640 AGGCGAGGGAACCAGATTGCAGG - Intronic
1015204204 6:130616673-130616695 GGGCATGGGGAACACTTTGGGGG - Intergenic
1027242463 7:76341024-76341046 GGGCGGGAGGATCACTTTGGTGG - Intronic
1033274513 7:139961227-139961249 AGGCGAGGGGACTAGTTTGGCGG - Intronic
1034635748 7:152566014-152566036 GGGCGAGGGGGCTACCTCGCCGG - Intergenic
1036458461 8:8930359-8930381 GGTCGAGGGGACCACCTAGTGGG + Intergenic
1037985558 8:23288649-23288671 GGGCGAGGGTGCCGCCTTGCTGG + Intronic
1038011711 8:23481335-23481357 TGGCAAGGGGCCCACTTTGATGG + Intergenic
1038584554 8:28777298-28777320 GGGCCACGGAACCACTGTGCTGG - Intronic
1039881825 8:41629993-41630015 GGGGCAGGGGACCCCTATGCTGG + Intergenic
1047627308 8:126669290-126669312 GGCTGAGGTGACCACATTGCAGG - Intergenic
1049552393 8:143266663-143266685 AGGCGAGGGGACCCCTGAGCTGG - Intronic
1057854856 9:98594304-98594326 GGGCTTGGGGACCCCTTAGCAGG - Intronic
1057872704 9:98730386-98730408 GTGCGTGGGGACCACTTACCTGG + Intergenic
1062097611 9:134711036-134711058 GGGGGAGGGGACCACTTGGGGGG + Intronic
1195678648 X:107526745-107526767 GGGCTAGGGGAACACTCTGAGGG - Intronic
1196734802 X:118974290-118974312 GGCAGAGGGGACCTGTTTGCTGG + Intergenic
1199851257 X:151726261-151726283 GGACCAGGGGCCCACTTGGCAGG - Intergenic
1200097375 X:153670513-153670535 GGGCGAGGGGGCCTCTGAGCAGG - Exonic