ID: 1157501607

View in Genome Browser
Species Human (GRCh38)
Location 18:48194553-48194575
Sequence CAGAGTAAACAGAGGCTTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 251}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157501597_1157501607 21 Left 1157501597 18:48194509-48194531 CCCAGTAAGCTCAGGAGATAATG 0: 1
1: 0
2: 0
3: 13
4: 129
Right 1157501607 18:48194553-48194575 CAGAGTAAACAGAGGCTTGCAGG 0: 1
1: 0
2: 3
3: 30
4: 251
1157501598_1157501607 20 Left 1157501598 18:48194510-48194532 CCAGTAAGCTCAGGAGATAATGT 0: 1
1: 0
2: 0
3: 10
4: 131
Right 1157501607 18:48194553-48194575 CAGAGTAAACAGAGGCTTGCAGG 0: 1
1: 0
2: 3
3: 30
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157501607 Original CRISPR CAGAGTAAACAGAGGCTTGC AGG Intronic
901638939 1:10683538-10683560 CTGTGTAAGCAGAGACTTGCTGG - Intronic
902068884 1:13714672-13714694 CAATGTAAGCAGAGGCTTGTGGG + Intronic
902464067 1:16603884-16603906 CAGAGTACACAGAGACTGCCAGG + Intronic
903087124 1:20871665-20871687 CATAGTAAACAGGGGCTTGAAGG + Intronic
903302287 1:22387903-22387925 CAGCCTAAACAGAGGCTTGGAGG + Intergenic
904301123 1:29555598-29555620 CTGGGTAATCCGAGGCTTGCTGG + Intergenic
904924852 1:34039392-34039414 CAGATTCAAAAGAGGTTTGCAGG - Intronic
905011924 1:34753423-34753445 CATTGTAAACAGAAGCTTGCAGG + Intronic
905482234 1:38269476-38269498 GAGTGGAAACAGAGGCTTACTGG - Intergenic
905940238 1:41857240-41857262 CAGAGTAAACAGAGAGAAGCCGG - Intronic
906150726 1:43585966-43585988 CAGAATTAGCAGAGGCTGGCAGG - Intronic
906195418 1:43927607-43927629 CAGGGAAAACAGAGACTTGGAGG - Intronic
906703471 1:47876771-47876793 AAGAGTAAACAGAGACATGAAGG - Intronic
907624887 1:56020588-56020610 CAGAGTTACCAGAGCTTTGCTGG + Intergenic
907624964 1:56021230-56021252 CAGAGTTACCAGAGCTTTGCTGG + Intergenic
909958349 1:81803440-81803462 CAGAGTGAACAGAGGATTGGAGG - Intronic
910226144 1:84938630-84938652 CAGAGCAAAGACAGGCCTGCAGG + Intronic
912659695 1:111516467-111516489 GAGAGGAAACAGATGCTGGCTGG - Intronic
915018959 1:152761623-152761645 AAGAGTGAGCAGAGGCTTGGAGG - Exonic
915044696 1:153002337-153002359 CAGTGTGAACAGAGGCTCCCAGG + Intronic
915171141 1:153977896-153977918 CAGAGAAACCAGAAGCTTGACGG - Intergenic
915869087 1:159538741-159538763 CAGAGTCTACAGAGGCAGGCAGG - Intergenic
916157004 1:161862074-161862096 TATTGTAACCAGAGGCTTGCAGG + Intronic
916921674 1:169475631-169475653 GAGAGTCAACAGAGGGTTGATGG - Intronic
917683402 1:177391490-177391512 CAGAGCGGACAGAGGATTGCAGG + Intergenic
919695418 1:200569791-200569813 CAGAGGAATCAGAAGCTTCCAGG + Intronic
921119754 1:212126399-212126421 CAGAGGTAACAGAGGCATGCAGG + Intergenic
922309320 1:224373435-224373457 CAGAGTAAATTTAGGCTTGGAGG + Intronic
1062785091 10:257973-257995 CAGGGTGAGCAGAGGCTGGCTGG + Intergenic
1064244642 10:13659043-13659065 CAGAGGCCACAGAGGCTGGCTGG - Intronic
1065037595 10:21655793-21655815 CAGAGTAAACAGTGGGTTTCAGG + Intronic
1065170184 10:23019212-23019234 CAGAGTAAAAAGTGGGGTGCAGG + Intronic
1067549455 10:47223599-47223621 CAGAGAGGACAGAAGCTTGCTGG - Intergenic
1069676440 10:70251963-70251985 CTGACAAAACAGAGGCTTCCAGG - Exonic
1070377807 10:75850882-75850904 CAGAGTATGCAGAGGTTTGAAGG + Intronic
1070680005 10:78442345-78442367 CAAAGTAAACAGAGGATTGTGGG - Intergenic
1070913820 10:80139992-80140014 CAGAGTAAATAGAGGCCATCAGG + Intronic
1072016198 10:91349260-91349282 CTGAGGAAACTGAGGCTTACAGG + Intergenic
1075520464 10:123140531-123140553 GAGAGGAAAGAGAGGCGTGCAGG - Intergenic
1075587317 10:123667161-123667183 CAGAAGAAACAGAGGCTCGGTGG - Intronic
1076055836 10:127372173-127372195 CAGATGAAACAAAGGCTTTCAGG - Intronic
1076312718 10:129520154-129520176 CAGACAAAACAGATGCTTTCAGG + Intronic
1076361604 10:129893626-129893648 CATGGTAAACAAAGACTTGCTGG + Intronic
1078574248 11:12485208-12485230 CAAAATTAACAGAGGCTTCCTGG - Intronic
1082649831 11:55776128-55776150 CAGGGTAAACAGAGGGAAGCAGG + Intergenic
1084343698 11:68528055-68528077 CAGAGAAAACAGAGACAGGCAGG - Intronic
1084675788 11:70633646-70633668 AGGAGTACACTGAGGCTTGCAGG - Intronic
1085004489 11:73072947-73072969 CAGAGTAAACACAGACATGTTGG - Intronic
1086439313 11:86812489-86812511 AAGAGTAAACAGGGGTTGGCCGG + Intronic
1088072932 11:105812184-105812206 CAGAGAAAACAAAGGAATGCTGG - Intronic
1089651153 11:119914091-119914113 CAGATTATAAAGGGGCTTGCAGG + Intergenic
1089773987 11:120823478-120823500 CTGAGAAAACAGAGTCTTGGAGG + Intronic
1091352992 11:134912671-134912693 CAGGGTAAAAAGATGCTGGCTGG - Intergenic
1092305702 12:7298554-7298576 CAGAATAAATACAAGCTTGCTGG - Intergenic
1092920191 12:13224220-13224242 CAGATTATACAGGGGGTTGCAGG + Intergenic
1093439951 12:19183310-19183332 CAGAGGAAACTAAGGTTTGCTGG - Intronic
1094346937 12:29480727-29480749 CAGAATACAGAGAGGCTTGGAGG + Intronic
1095857433 12:46875390-46875412 CAGTGAAAACAGAAGCTTTCAGG - Intergenic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1097149418 12:56965437-56965459 CAGAGTAATTAGAGGTTGGCAGG - Intergenic
1098221607 12:68275646-68275668 CATCGTGACCAGAGGCTTGCAGG - Intronic
1100242204 12:92721022-92721044 CAGAGGAAACTGAGGCTTAGAGG - Intergenic
1101727943 12:107403473-107403495 AAGAGTAAACTGAGGCTCACAGG - Intronic
1104416964 12:128603512-128603534 CAGACTAAACACAGGCATGGAGG - Intronic
1104956911 12:132471279-132471301 CAGAGTGAACAGTGGCTGTCAGG + Intergenic
1106003475 13:25747001-25747023 CAGAGGAAGCAGAGGCTCGCAGG - Intronic
1107596693 13:41970733-41970755 CAGAATATACAGAGGCCTCCAGG + Intergenic
1107937521 13:45357559-45357581 GTGAGGAAACAGAGGCTTGCAGG - Intergenic
1107962141 13:45568002-45568024 CAGGGTAAGAAAAGGCTTGCAGG - Intronic
1108209529 13:48124353-48124375 CAGAGGAAACAGCTGCCTGCAGG - Intergenic
1108535266 13:51370418-51370440 CAGAGACAACAGTGGCTTACAGG - Intronic
1112552764 13:100437004-100437026 CAGAGCAAACAGAGGCCAACAGG - Intronic
1114416261 14:22546518-22546540 AGGAGGAAACAGAGGTTTGCCGG - Intergenic
1114946876 14:27693355-27693377 CAGAGTTAAAAGAAGCTTTCAGG - Intergenic
1116291701 14:43051409-43051431 CAGGTTACACAGAGCCTTGCTGG + Intergenic
1116525568 14:45900091-45900113 AAGAGTAAAGAGAGGCTTGCAGG + Intergenic
1117836796 14:59816313-59816335 GAGAGTGGACAGAGGCTTCCAGG - Intronic
1118735134 14:68695697-68695719 CAGGGTGACCAGAGGCTTGTGGG - Intronic
1119783588 14:77296024-77296046 CAGAGAAAACAGAAGGGTGCAGG + Intronic
1121017757 14:90558708-90558730 CAGTGTGAACAGAGGCCGGCAGG - Intronic
1122298695 14:100719771-100719793 CAGAGGAACCAGGTGCTTGCGGG + Intergenic
1123006405 14:105325886-105325908 GAGAGTAAACAAAGGCATGGAGG - Intronic
1124621583 15:31277031-31277053 CAGAGTCCACAGAGGCAAGCTGG - Intergenic
1125279545 15:38029161-38029183 CAGAGTAAAAAGAGGCATATGGG + Intergenic
1126758431 15:51947037-51947059 AAGAGTGATCAGAAGCTTGCTGG - Intronic
1129168822 15:73795613-73795635 CACAGGAAACAGTGGCCTGCAGG + Intergenic
1129703070 15:77779044-77779066 CAGAGGAAACAGGGGCATCCAGG - Intronic
1130637643 15:85640304-85640326 GAAGGCAAACAGAGGCTTGCTGG - Intronic
1130919967 15:88335606-88335628 CAGCATGAACAGAGGCTTGGAGG + Intergenic
1131715561 15:95106944-95106966 ATGAGTAAACAGAGGCATGGAGG - Intergenic
1132471354 16:105343-105365 CAGAGGATGCAGAGGTTTGCAGG - Intronic
1133514903 16:6499125-6499147 CACAGTAAACAAAGGCTGCCTGG - Intronic
1134666037 16:16019479-16019501 CAGGGTAAACAGAGTCTGGTTGG + Intronic
1136052187 16:27659677-27659699 CAGAGAAAATAGAGGCATGTAGG + Intronic
1137559416 16:49493205-49493227 CTGAGTCAGCAGAGGCTTGAAGG - Intronic
1139338126 16:66247689-66247711 AAGAGGAAACAGAGGCGTGGAGG + Intergenic
1139651055 16:68362249-68362271 AGGAGGAAACAGAGGCTTGGAGG - Intronic
1140244983 16:73239929-73239951 CATTGTGACCAGAGGCTTGCAGG - Intergenic
1142614006 17:1124702-1124724 CAGAGTGAACAGAGGAGGGCTGG + Intronic
1143311007 17:5989186-5989208 AAGATTAAACAAAGGCTTGGAGG + Intronic
1145294643 17:21578568-21578590 CAGAGCAGACAGAGGCTTGGTGG + Intergenic
1147338924 17:39742495-39742517 GATAATACACAGAGGCTTGCAGG + Intronic
1148976423 17:51533811-51533833 GAGAGAAAAAAAAGGCTTGCAGG + Intergenic
1148999203 17:51739737-51739759 CAGAGTCATCATATGCTTGCTGG + Intronic
1149451139 17:56750977-56750999 ATGAGAAAACAGAGGCTTGGAGG - Intergenic
1149553752 17:57558669-57558691 AAGAGCAAAGAGAGGCTTGCTGG + Intronic
1151104232 17:71593993-71594015 CAGTGTATACAGAGGTTAGCGGG - Intergenic
1151226250 17:72650474-72650496 CACAGGAAACAGAGGCATGAGGG + Intronic
1151361911 17:73593988-73594010 AAGGGAAAACAGAGGCTTGGAGG + Intronic
1157434443 18:47656570-47656592 CAGCATGAACAGAGGCTTGTGGG + Intergenic
1157452475 18:47799168-47799190 GAGACTGAACAGAGGCTTGCTGG + Intergenic
1157501607 18:48194553-48194575 CAGAGTAAACAGAGGCTTGCAGG + Intronic
1157943420 18:51953817-51953839 CAGAGGAGACAGAGGGTTTCTGG - Intergenic
1159275152 18:66209691-66209713 CAGAATGAACACAGCCTTGCTGG - Intergenic
1159855533 18:73583178-73583200 CAGAGAAAACACTGGCTGGCTGG + Intergenic
1163428892 19:17254942-17254964 CAGAATATACAAAGGCTTGGAGG + Intronic
1164161461 19:22627987-22628009 GAGAAGAAACTGAGGCTTGCAGG + Intergenic
1166567886 19:43776251-43776273 CAGAGTGGACAGAGGCCTGGGGG + Intronic
1167000927 19:46745686-46745708 GGGAGTAAGCAGAAGCTTGCCGG - Intronic
1168179246 19:54649423-54649445 CACGGTTAACAGAGGCTTGGGGG + Intronic
1202679726 1_KI270711v1_random:41324-41346 CAGAGTACACAGAGACTGCCAGG + Intergenic
929247803 2:39721591-39721613 CAAGGTAGGCAGAGGCTTGCTGG + Intergenic
929811247 2:45190814-45190836 CAGATGAAACGGAGGCTTCCAGG + Intergenic
929971376 2:46580187-46580209 GAGAGGGAACAGAGGCTTGTAGG - Intronic
930716950 2:54602317-54602339 CAGAGTAGAATGAGGCTTGAGGG + Intronic
931400236 2:61924939-61924961 CAGAGGAACCAGAGGCCTGGAGG + Intronic
931530693 2:63210997-63211019 CAGAGTCTACAGAGGCAGGCAGG - Intronic
933253105 2:80050587-80050609 AAGAGTAAACAGACCCCTGCGGG + Intronic
933442500 2:82331170-82331192 CTGAGAAAACCGAGGCTTTCTGG - Intergenic
936175996 2:110220408-110220430 ACAAGTAGACAGAGGCTTGCAGG + Intergenic
938229579 2:129646970-129646992 CAGAATAAGCAGAGACTTGAAGG + Intergenic
938265800 2:129927343-129927365 CCGAGTAAATAGAGGCTATCAGG - Intergenic
938375902 2:130806464-130806486 CAGAGGAAGCAGAGGGGTGCCGG + Intergenic
940995069 2:160140399-160140421 CAGAGCAAGCAGAGGCATGGCGG + Intronic
941186764 2:162327883-162327905 AAAAGACAACAGAGGCTTGCTGG + Intronic
941293190 2:163701593-163701615 CAGAGTATACAGTGGCATGAGGG + Intronic
943626824 2:190210620-190210642 CAGAGCATACAGAGCCTTGAAGG - Intronic
943777893 2:191787101-191787123 CAAAATAAACAGCGGCTTCCTGG - Intergenic
944159205 2:196640949-196640971 CAGAATACACAGAGCCTTGAAGG - Intronic
944311575 2:198239623-198239645 CAGCATAAACAGAGGTGTGCTGG - Intronic
946180320 2:217945199-217945221 CAGAGGAAACTGAGGCTCGGAGG - Intronic
946825142 2:223670291-223670313 CAGATTAAACAGGGGCTTTGGGG - Intergenic
947930933 2:233964659-233964681 CAGAGTCTTCAGAAGCTTGCTGG - Exonic
948027213 2:234787620-234787642 CAGAGCTTACAGAGGGTTGCAGG - Intergenic
948272242 2:236683517-236683539 CAGAGGAATCACAGGCTTGGGGG + Intergenic
948595438 2:239076603-239076625 CGGAGTCCCCAGAGGCTTGCCGG - Intronic
948856079 2:240731287-240731309 CAGACTAAACAGAGGCAGGGAGG + Intronic
1168908220 20:1423677-1423699 CACAGTAAAGAGGGGCCTGCTGG - Intergenic
1168949016 20:1783811-1783833 CATAGTGAACAGAGCATTGCTGG + Intergenic
1169046992 20:2541024-2541046 CAGAGGAAACAGGGGATTGAGGG - Intronic
1169930980 20:10832743-10832765 CAGAGTAGACAGAGGCTTTCTGG + Intergenic
1170098676 20:12674919-12674941 AAGAGTGGACAGAGGCTTGGTGG - Intergenic
1170205430 20:13792795-13792817 CAGAGTAAAGAAAGACTTACAGG - Intronic
1171878971 20:30602730-30602752 CAGAGGGAACAGAAGCTAGCTGG + Intergenic
1172257182 20:33529386-33529408 CAGAGTTGAAAGAGGCTTGATGG - Intronic
1174287109 20:49481591-49481613 GAGAGACAACAGTGGCTTGCTGG - Intronic
1174615470 20:51832281-51832303 CAGAGTGAACACTGGCTTGCCGG - Intergenic
1176263589 20:64196770-64196792 CAGAGAATAGAGAGGGTTGCAGG - Intronic
1178357019 21:31918037-31918059 GACAGTAATCAGAGGTTTGCAGG - Intronic
1178468574 21:32871306-32871328 CAGAGGAGAGAGAGGCTTGCTGG - Intergenic
1179580176 21:42338520-42338542 CAGAGGAGACAGAGGCTGTCAGG + Intergenic
1179876475 21:44271522-44271544 CAGATTAAACAGTGGCACGCTGG + Intergenic
1181046123 22:20215135-20215157 GAGAGTAAACTGAGGCATGTGGG + Intergenic
1181862622 22:25830647-25830669 GAGAGCAAACAGAAGCGTGCAGG + Intronic
1181901819 22:26162260-26162282 ATGAGTAAACAGAGGCTTGGAGG - Intergenic
1182267558 22:29129959-29129981 CAGAGTCAACAGTGGGTTACAGG + Intronic
1182667411 22:31970072-31970094 CAGAGTAAAGAGAGGCTCACAGG - Intergenic
1184046038 22:41972722-41972744 CAGAGTGAACAGAGCCAAGCTGG + Intergenic
1184218083 22:43080607-43080629 CAGGGTGCACACAGGCTTGCAGG - Intronic
950184178 3:10934928-10934950 CAGACTAGCCAGAGGCTGGCAGG - Intronic
950263249 3:11557022-11557044 CAGAGTCCACAAAGCCTTGCAGG + Exonic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
953787284 3:45920713-45920735 CAGAGTAAACAGAGGCATGATGG - Exonic
954223932 3:49171079-49171101 CAGTGTACACTGAGGCTAGCGGG - Intergenic
954294857 3:49668605-49668627 CACAGTAAACAGAGGCGGGCTGG - Exonic
954622277 3:52003000-52003022 CAGACTAAAGAGAGACTTGGCGG + Intergenic
954710016 3:52501025-52501047 CAGAGTAAGCAGAGGGTTCTGGG - Intronic
955135497 3:56213557-56213579 CAGAGTCTACAGAGGCAGGCAGG - Intronic
955963018 3:64360361-64360383 CAGAGTCCACAGAGGCCAGCAGG + Intronic
956811960 3:72872162-72872184 CAGAGGAAGCATAGCCTTGCTGG - Intergenic
958966194 3:100561618-100561640 CATAGTATAAAGGGGCTTGCAGG - Intronic
959563239 3:107806612-107806634 AAAAGGAAACAGAGACTTGCAGG - Intronic
960048738 3:113221249-113221271 CAGAGTGAAAGGAGGGTTGCTGG + Intronic
960548342 3:118944311-118944333 CAGATTAAGCAGAGCCTTGAAGG - Intronic
961507922 3:127383755-127383777 CACAGTAAACAGAGGCAACCGGG - Intergenic
961838091 3:129681530-129681552 TAGAGTATACAGAGGCTGGTGGG + Intronic
962176476 3:133160693-133160715 CAAAGTCAACAGAGGTTTGAAGG - Intronic
963897747 3:150704282-150704304 TTGAGTAGACAGATGCTTGCTGG + Intergenic
964122172 3:153196329-153196351 CAGAGCACACAGAGGCTGGCAGG + Intergenic
964504953 3:157389067-157389089 AAATGTAACCAGAGGCTTGCAGG - Intronic
964564088 3:158030626-158030648 CTGAGGAAACAGAGGCTTCAAGG - Intergenic
964678059 3:159305366-159305388 CAGAGAAAACAGAGGCTGACAGG + Intronic
965402831 3:168233713-168233735 CAAAGTAAAGAGAGGCTTGGTGG - Intergenic
965907381 3:173725755-173725777 CAGACTCATCAGAGGCTTGACGG + Intronic
966939141 3:184734422-184734444 GAGAGGAAACTGAGGCTTGAAGG + Intergenic
968330093 3:197860915-197860937 CAGACTAAACTGAGGGTTACCGG - Intronic
969188477 4:5497805-5497827 CAGCATACACAGAGGCTTGCTGG + Intronic
969680326 4:8639747-8639769 CAGAGAAAACAGAGGCCAGGAGG - Intergenic
972092084 4:35299931-35299953 CAGAGGAAAGTGAGGCTTACAGG - Intergenic
974937032 4:68420720-68420742 TAGAGTATACAGAGGCAGGCAGG - Intergenic
975385162 4:73749545-73749567 CAGAGTAGACAGAGGGTGGAGGG + Intergenic
975819389 4:78254374-78254396 CAGTGTAAATAAAGGATTGCTGG - Intronic
983863949 4:172740964-172740986 AAGTGTGACCAGAGGCTTGCAGG + Intronic
985995166 5:3593663-3593685 CAGAGAGACCTGAGGCTTGCGGG + Intergenic
988193493 5:27969208-27969230 CTGAGGGAACAGAGGCTTGAAGG - Intergenic
988838753 5:35062300-35062322 CAGAGGAAACTGAGGCTTAGAGG + Exonic
995411501 5:111862417-111862439 CAGAGTACGGCGAGGCTTGCAGG + Intronic
995696418 5:114883278-114883300 CAGAGTAAAAAGAGGTTTTCTGG - Intergenic
996168447 5:120257684-120257706 CACAGGAAACAGAGTCTTTCTGG - Intergenic
996192910 5:120567434-120567456 CAGAGTACACAGAGGGTGGTAGG + Intronic
996382898 5:122880075-122880097 CAAAGTAAACAGAAGGTTGGAGG - Intronic
998608709 5:143664359-143664381 GCAAGGAAACAGAGGCTTGCTGG - Intergenic
999907296 5:156155913-156155935 AAGAGGAAACAGAAGGTTGCAGG + Intronic
1000956986 5:167554905-167554927 CAGAGTAGACAGATGCTTGGGGG + Intronic
1001226123 5:169946079-169946101 CAGAGTGAACTGGGGCTTCCTGG - Intronic
1001654147 5:173336518-173336540 CAGAGTTAACTGAGGCTTGGAGG - Intergenic
1002064268 5:176644256-176644278 CAGTGTAAGCAAAGGCTTGGAGG + Intronic
1003010952 6:2427193-2427215 CAGAGAAAACAGATGCTATCTGG - Intergenic
1004374528 6:15080028-15080050 CTGAGTAAAGACAGGCTTGTGGG + Intergenic
1005356351 6:24987296-24987318 CTGAGGAAACTGAGACTTGCTGG - Intronic
1006892373 6:37440019-37440041 CAGAGGAAACAGAGGTCTCCTGG - Intronic
1007931019 6:45690588-45690610 CTGAGTGGACAGAGGCTTGTGGG + Intergenic
1008008722 6:46440780-46440802 CAGAGTAAACAAAGTCTTCCTGG + Intronic
1011412671 6:87082209-87082231 CAGAGTAAGCACAGGTTTGAGGG - Intergenic
1012159629 6:95867490-95867512 ATGAGGAAACAAAGGCTTGCTGG - Intergenic
1015184199 6:130394784-130394806 CAGGGTAAACAGAGGATAGTGGG + Intronic
1018787933 6:167122640-167122662 AAGAGGAAACCGAGGCTTGCTGG + Intergenic
1019162793 6:170080419-170080441 CAGAGTAAGCACAGACCTGCCGG + Intergenic
1020058641 7:5135974-5135996 CAGAGCAAACATGGGTTTGCTGG - Intergenic
1020788281 7:12594807-12594829 CAGAGGAACCAGAGGCCTGGAGG + Intronic
1021241315 7:18205441-18205463 CATAGTAATCAAAGTCTTGCTGG + Intronic
1021536007 7:21705434-21705456 CAGAGCAAACAGCTGGTTGCTGG - Intronic
1022807233 7:33834558-33834580 ATGAGGAAACTGAGGCTTGCAGG + Intergenic
1027005693 7:74690730-74690752 GAGAGTTTACACAGGCTTGCTGG - Intronic
1028159087 7:87465442-87465464 CAGAGTCTACAGAGGCAGGCAGG - Intronic
1028531299 7:91841596-91841618 CAGCATATACAGAGGCTTGGAGG - Intronic
1028876302 7:95827110-95827132 CAGAGTAAACAAAGGGATGCAGG + Intronic
1029665423 7:101992143-101992165 CAGGGTAGAAAGAGGCTTGGAGG + Intronic
1033286551 7:140046353-140046375 CAGAGTAAATAGGGGATTCCCGG - Intronic
1033630080 7:143148958-143148980 CAGAGTGAACAGAGGGGTGCAGG - Intergenic
1037454157 8:19047076-19047098 CAGAGGAATAAGAGGCCTGCTGG - Intronic
1037560667 8:20071903-20071925 TACTGTAACCAGAGGCTTGCAGG + Intergenic
1041648229 8:60275365-60275387 CAGAGTAAACAGAGACAGGTAGG + Intronic
1041945881 8:63442390-63442412 AAAAGTAAACAGAGGCATGGAGG - Intergenic
1042038831 8:64569928-64569950 TATAGTACACAGAGGCTAGCTGG + Intergenic
1045769298 8:105716034-105716056 CAGAGAAAAGAGATGCTGGCAGG + Intronic
1046582727 8:116113044-116113066 CATACTAATCAGAGACTTGCTGG - Intergenic
1049215211 8:141404661-141404683 CTGAGTCAGCAGAGGCTTGGGGG + Intronic
1049266778 8:141671803-141671825 CAGGGTAAACTGAGGCTTATGGG + Intergenic
1049804473 8:144532691-144532713 CTGGGGAAACTGAGGCTTGCAGG - Intronic
1050343275 9:4662321-4662343 CGGACCAAACAGAGGCTTCCCGG - Exonic
1052559948 9:30072280-30072302 GAAAGTAAACTGTGGCTTGCTGG + Intergenic
1054915671 9:70493338-70493360 TAGAGTCAACAGGCGCTTGCGGG + Intergenic
1057265457 9:93614409-93614431 CAGAGGGAACAGAAGCTAGCTGG - Intronic
1057552540 9:96062644-96062666 GAAAGAAAAAAGAGGCTTGCAGG - Intergenic
1058423468 9:104855683-104855705 AAGAGAAAACTGAGGCTTACAGG + Intronic
1059422389 9:114200295-114200317 CATTGTAAACTGAGGCTTGGGGG - Intronic
1059739469 9:117135689-117135711 CAGAGAAAAGAGTGGCTTGCTGG + Intronic
1060137329 9:121170085-121170107 AGGTGTAAACTGAGGCTTGCTGG - Intronic
1060278168 9:122197917-122197939 CAGAGGAAACTGAGGCTCACTGG + Intronic
1060902122 9:127268377-127268399 AAGAGAAAATAGTGGCTTGCTGG - Intronic
1061168068 9:128936087-128936109 AAGAGGAAACTGAGGCTTACAGG + Intronic
1062142283 9:134966206-134966228 CACAGTAAAGAGAAGCCTGCAGG - Intergenic
1062178832 9:135179769-135179791 ATGAGAAAACAGAGGCTTGGAGG - Intergenic
1062403161 9:136381331-136381353 CAGGGTAAACACAGGGGTGCTGG + Exonic
1062447275 9:136600225-136600247 CAGAGCAGACAGAGGCTGGGAGG - Intergenic
1203744931 Un_GL000218v1:36361-36383 CAGGGAAAACTGAGGCTTGACGG - Intergenic
1203565175 Un_KI270744v1:83123-83145 CAGGGAAAACTGAGGCTTGACGG + Intergenic
1186272630 X:7905734-7905756 AAGAGGAAACTGAGGCTTGCAGG + Intronic
1187288810 X:17932292-17932314 CAGGGTGAGCAAAGGCTTGCTGG - Intergenic
1193722769 X:85005836-85005858 GAGAGTAAAAAGAGGCTTCATGG + Intronic
1195765653 X:108294152-108294174 CTGAGGAAACTGAGGCTTACAGG + Intronic
1198275934 X:135096810-135096832 CAGAGGAAACCGAGGCTTCGGGG - Intergenic
1198310579 X:135423923-135423945 CAGAGGAAACTGAGGCTTCAGGG + Intergenic
1198581844 X:138073937-138073959 CAGAGTCTACAGAGGCAGGCAGG - Intergenic
1199654191 X:149978593-149978615 CAGTATAACCAAAGGCTTGCTGG + Intergenic
1200092410 X:153642220-153642242 CCTAGAGAACAGAGGCTTGCAGG + Intergenic
1202356704 Y:24059153-24059175 CAGAGTCTACAGAAGCTGGCAGG - Intergenic
1202361489 Y:24115187-24115209 CAGAGTCTACAGAGGCAGGCAGG + Intergenic
1202363584 Y:24137913-24137935 CAGAGTCTACAGAGGCAGGCAGG - Intergenic
1202507196 Y:25532204-25532226 CAGAGTCTACAGAGGCAGGCAGG + Intergenic
1202509289 Y:25554932-25554954 CAGAGTCTACAGAGGCAGGCAGG - Intergenic
1202514074 Y:25610957-25610979 CAGAGTCTACAGAAGCTGGCAGG + Intergenic