ID: 1157502425

View in Genome Browser
Species Human (GRCh38)
Location 18:48200932-48200954
Sequence GCTTCATCCTGACCAGGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 195}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157502425_1157502431 4 Left 1157502425 18:48200932-48200954 CCTGACCCTGGTCAGGATGAAGC 0: 1
1: 0
2: 0
3: 11
4: 195
Right 1157502431 18:48200959-48200981 CACCCCAGGCACCACCCCCTTGG 0: 1
1: 0
2: 4
3: 66
4: 1153
1157502425_1157502437 17 Left 1157502425 18:48200932-48200954 CCTGACCCTGGTCAGGATGAAGC 0: 1
1: 0
2: 0
3: 11
4: 195
Right 1157502437 18:48200972-48200994 ACCCCCTTGGAGCCCCAGGCAGG 0: 1
1: 0
2: 0
3: 28
4: 341
1157502425_1157502429 -10 Left 1157502425 18:48200932-48200954 CCTGACCCTGGTCAGGATGAAGC 0: 1
1: 0
2: 0
3: 11
4: 195
Right 1157502429 18:48200945-48200967 AGGATGAAGCAGGCCACCCCAGG 0: 1
1: 0
2: 2
3: 15
4: 201
1157502425_1157502435 13 Left 1157502425 18:48200932-48200954 CCTGACCCTGGTCAGGATGAAGC 0: 1
1: 0
2: 0
3: 11
4: 195
Right 1157502435 18:48200968-48200990 CACCACCCCCTTGGAGCCCCAGG 0: 1
1: 0
2: 3
3: 38
4: 320
1157502425_1157502442 22 Left 1157502425 18:48200932-48200954 CCTGACCCTGGTCAGGATGAAGC 0: 1
1: 0
2: 0
3: 11
4: 195
Right 1157502442 18:48200977-48200999 CTTGGAGCCCCAGGCAGGTGCGG 0: 1
1: 0
2: 3
3: 44
4: 384

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157502425 Original CRISPR GCTTCATCCTGACCAGGGTC AGG (reversed) Intronic
900327034 1:2113442-2113464 GCTTCCACCTGCCCTGGGTCAGG - Intronic
901438724 1:9264725-9264747 GCTTCATCCTGCCCATGACCAGG - Exonic
902693298 1:18123943-18123965 GCTTCATGCTTCCCAGGGTGGGG - Intronic
903306202 1:22414966-22414988 CCTGCACCCTGACCAGGGTGGGG + Intergenic
903502209 1:23807115-23807137 ACTTCATCCTGATCACGCTCAGG - Intronic
907188360 1:52629366-52629388 GCTTCCCCCTGGCCAGGATCGGG - Intergenic
910499829 1:87877447-87877469 GCTTTATCCTTGCCAGAGTCAGG + Intergenic
912699079 1:111862856-111862878 ACTAAATCCTGACCAGGGGCTGG + Intronic
914357719 1:146901969-146901991 GCTTCAACCTCCCCAGGCTCAGG + Intergenic
914482996 1:148083065-148083087 GCTTCAGTCTGACCAGGGAGAGG - Intergenic
914516213 1:148376932-148376954 GCTTCAACCTCCCCAGGCTCAGG - Intergenic
917135403 1:171784203-171784225 CCTTCATCATGACCAAGTTCAGG + Exonic
920033988 1:203053905-203053927 GCAGCATCATGGCCAGGGTCTGG - Exonic
1063173647 10:3532716-3532738 GCACCATCCTGGCCAGGGTGGGG - Intergenic
1063239378 10:4152718-4152740 GCTTCCTGCTGACCAGAGTGTGG + Intergenic
1067221444 10:44347032-44347054 GCTTCATGCTGACCTGGGAGGGG - Intergenic
1069671507 10:70208873-70208895 GCTTCAACCTCCCCAGGCTCAGG + Intronic
1070005543 10:72420755-72420777 GCTTCAACCTCCCCAGGCTCAGG + Intronic
1073615671 10:104992201-104992223 GAATCTTCCTGACCAGGCTCAGG - Intronic
1075466792 10:122657482-122657504 GCCTCATCCTGAGCAGAGCCTGG - Intergenic
1075468862 10:122672866-122672888 GCCTCATCCTCAGCAGGGCCTGG - Intergenic
1076598677 10:131642993-131643015 GCTTCAGCCTGACCCAGGTTGGG + Intergenic
1076700593 10:132270786-132270808 GCTCCATCCTGGCCACGGTGAGG + Intronic
1077104188 11:834877-834899 CCTTCATCCTGGCCGGGGTGGGG - Intronic
1079451722 11:20604341-20604363 ACTTCATCCTGTCCATGGTGGGG + Exonic
1079628402 11:22644734-22644756 GCTTCATCCTGCCAAGTATCTGG + Intronic
1080474897 11:32581203-32581225 GATTCATCCTGACCTAGGTGAGG + Intergenic
1083537112 11:63479736-63479758 TTTTCTTCCTGACCAGTGTCAGG - Intronic
1084455027 11:69263448-69263470 GCTACATCCTGCTCAGAGTCTGG + Intergenic
1084590586 11:70087871-70087893 GCACCCTCCTGACCAGGGTCCGG - Exonic
1084805707 11:71577281-71577303 GCGTCCTCCTGTCCAGGGCCAGG - Intergenic
1085126577 11:74006296-74006318 GCACCATCCTGACCATGGTGCGG - Exonic
1085596549 11:77816158-77816180 GTTTCAACCTAACCAGGCTCTGG + Intronic
1086953659 11:92915057-92915079 ACTTCATCATGACCATGATCAGG + Intergenic
1088883270 11:113988124-113988146 CCTTCCTCCTGACTAGGGCCAGG + Intronic
1089556923 11:119320169-119320191 CCTTCCTCCTGCCCTGGGTCAGG - Intronic
1089563274 11:119356673-119356695 GATGCAGCCTGATCAGGGTCTGG - Exonic
1090400701 11:126446773-126446795 GCTTCATCCAGACGATGGTCAGG + Exonic
1091229953 11:133981843-133981865 GCTTAATTCTGCCCAGGGGCTGG + Intergenic
1091963589 12:4719900-4719922 GCTTCTCCCTGAGCAGCGTCAGG - Intronic
1097124162 12:56760385-56760407 GCTTCAACCTTCCCAGGCTCAGG + Intronic
1100573245 12:95862633-95862655 GCTTCAACCTCCCCAGGCTCAGG - Intronic
1103658259 12:122492051-122492073 TCTTAATGCTGACCAAGGTCAGG - Intronic
1106287171 13:28328304-28328326 GCTTCCTTCAGACCGGGGTCGGG - Intronic
1108426763 13:50310213-50310235 TCTTCATCCTGTCCTGGATCTGG + Intronic
1108497413 13:51039501-51039523 GCTTCAACCTCCCCAGGCTCAGG + Intergenic
1109376667 13:61503825-61503847 GCTTCAGTCTCCCCAGGGTCAGG - Intergenic
1113415198 13:110123564-110123586 CCTTCTTGCTGAGCAGGGTCTGG - Intergenic
1113609577 13:111634077-111634099 GCTTCTTCCGGCCCAGCGTCCGG + Intronic
1114535102 14:23417679-23417701 GCTTCTTCCTGCCCAGGGGAGGG + Exonic
1114585293 14:23806593-23806615 GCTTCAACCTCCCCAGGCTCAGG + Intergenic
1119225737 14:72943446-72943468 GCTTCTTCCTGAACTGGGGCAGG + Intronic
1119671785 14:76525591-76525613 GCTGCATTCTGATCAGGGGCTGG + Intergenic
1120301117 14:82708261-82708283 GCTTCAACCTCCCCAGGCTCAGG - Intergenic
1122347201 14:101067803-101067825 GCTGCCTCCTGTCCAGGCTCTGG + Intergenic
1128237868 15:66079875-66079897 TCCTCATCCTGACAAAGGTCTGG + Intronic
1128842578 15:70862190-70862212 GCTTCTCCCTGATCAGGGTGAGG + Intronic
1129591102 15:76915978-76916000 GGGTCATCCTGACAAGTGTCCGG - Intergenic
1130449328 15:84034990-84035012 ACTTCCTCCTGGCCAGGGACAGG - Intronic
1131619205 15:94049217-94049239 ACTTCATCCAGCACAGGGTCTGG - Intergenic
1133296702 16:4756898-4756920 GCTTCAACCTCCCCAGGCTCAGG - Intronic
1135222210 16:20623016-20623038 GCCTCATCCAGACCATGGGCAGG + Intronic
1138623212 16:58228358-58228380 GCTTCCTCGTGACCTGAGTCAGG - Intergenic
1139173467 16:64659607-64659629 GCTTCAACCTCCCCAGGCTCAGG + Intergenic
1139584552 16:67893458-67893480 GCTGCAGGCTGACCAGGGGCAGG - Intronic
1139976464 16:70815323-70815345 GCTTCAACCTCCCCAGGCTCAGG - Intronic
1140358001 16:74322136-74322158 ACTTCATCTTGAACAGGGGCTGG + Intergenic
1143106862 17:4534455-4534477 GGGTCAGCCTGGCCAGGGTCAGG + Intronic
1148867008 17:50634045-50634067 GCTTCAGCCTGATCAGGGTTGGG - Intergenic
1149098339 17:52871949-52871971 GCTTCAACCTACCCAGGCTCAGG + Intronic
1149656256 17:58310966-58310988 GCTTCAGCCTCCCCAGGGCCTGG - Exonic
1152228331 17:79102785-79102807 GCTCCATGGTGAGCAGGGTCTGG + Intronic
1152415984 17:80162303-80162325 ACTCCATCTTGAACAGGGTCTGG + Intergenic
1152563154 17:81088760-81088782 GCTCCATCCTGCTCAGGGCCAGG + Intronic
1153904541 18:9649784-9649806 GCTTCCTGCTGCCCAGGCTCAGG + Intergenic
1156511174 18:37638046-37638068 ACTGCTTCCTGTCCAGGGTCAGG + Intergenic
1157447994 18:47761114-47761136 GCTTCAACCTCCCCAGGCTCAGG - Intergenic
1157502425 18:48200932-48200954 GCTTCATCCTGACCAGGGTCAGG - Intronic
1158803038 18:60935579-60935601 GCTTCACCCTGAACATGGTAAGG - Intergenic
1158976640 18:62716190-62716212 GCGTCTTCCTGTCCAGGCTCCGG - Exonic
1159767223 18:72505032-72505054 GCTTCCACCTCCCCAGGGTCTGG - Intergenic
1160123094 18:76147739-76147761 GCTTCCACCTCACCAGCGTCTGG - Intergenic
1162361987 19:10226123-10226145 CCCTCATGCTGACCTGGGTCAGG + Intronic
1162533288 19:11248144-11248166 GCTTCATCCTGCCAAGAGTGGGG + Exonic
1162550007 19:11353447-11353469 GCTTCATCTTGGTCAGGATCTGG - Exonic
1163737465 19:18990264-18990286 GCCTCTGCCTGACCAGGGTGAGG - Intergenic
1164455025 19:28399720-28399742 GCCTCCTCCTGACCAGGATTTGG + Intergenic
1164770427 19:30804159-30804181 GCTCCATCTTGAACAGGGGCTGG + Intergenic
1165390681 19:35537002-35537024 GCTTCAGACTGATCAGGGGCTGG - Intronic
1166401882 19:42487664-42487686 ACTGCATCTTGAACAGGGTCTGG - Intergenic
1167373909 19:49101290-49101312 GCCTCATCCGGCCCAGGGCCTGG + Intronic
1168062053 19:53898619-53898641 CCTCCATCCTTACCGGGGTCTGG - Exonic
925033948 2:672133-672155 GCTCCTTCCTGCTCAGGGTCTGG + Intronic
925057999 2:870216-870238 GCTCCATCCTGACCAGGACCGGG - Intergenic
925802786 2:7618010-7618032 GTATCATCCTGACAAGGGACAGG - Intergenic
925815997 2:7749238-7749260 GCTGCATCCTGCCCAGCCTCAGG - Intergenic
927818033 2:26237543-26237565 GCTTCAGCCTCCCCAGGCTCAGG - Intronic
927891575 2:26753721-26753743 GCTTCAACCTCCCCAGGCTCAGG + Intergenic
928319887 2:30274592-30274614 GCTTCATTTTGACCTGGGACAGG - Intronic
930027299 2:47036934-47036956 CCCGCATCCTGGCCAGGGTCTGG + Intronic
930056493 2:47256487-47256509 GCATCATCCTGCACAGGGCCAGG + Intergenic
933464441 2:82634548-82634570 GCTTCACCCTGGCCAGGGCCTGG + Intergenic
933642488 2:84778580-84778602 GCCTCAACCTCCCCAGGGTCAGG + Intronic
933967673 2:87443175-87443197 ACTTCATCCTCACCAGGGTGGGG + Intergenic
936326126 2:111507321-111507343 ACTTCATCCTCACCAGGGTGGGG - Intergenic
936604498 2:113936208-113936230 GCCTCAACCTCTCCAGGGTCAGG - Intronic
937764482 2:125643616-125643638 GCATTATCCTGACTTGGGTCTGG - Intergenic
938070619 2:128306408-128306430 GCGTCATCGTGGCCAGGGTGGGG - Intronic
945649767 2:212542463-212542485 GCTTCATTCTTACCACGGCCTGG - Intergenic
947020231 2:225666413-225666435 GCTTCACCCTGACCACGCTGGGG - Intergenic
948385378 2:237577607-237577629 CCTTCACCCTGACCAGGCCCAGG + Intronic
1169285139 20:4301525-4301547 GATTCATCCTGATTAGGGACAGG - Intergenic
1171306848 20:24113989-24114011 GCTTCCTCCAGACCCGGGCCTGG + Intergenic
1172720770 20:36999318-36999340 GCTTCAACCTCCCCAGGCTCAGG - Intronic
1173609627 20:44357109-44357131 GATTCTTCCTGACTAGAGTCAGG - Intronic
1174112500 20:48206049-48206071 GCTTCATCCTTCCCTGGGGCTGG - Intergenic
1176093634 20:63329743-63329765 GCCTCATGCTGTCCAGGGTGGGG + Intronic
1176143622 20:63555684-63555706 GCTTCATCTTGTCCAGGCCCAGG - Exonic
1178972806 21:37195837-37195859 GCTTCAGGCTGACCAGGGGGTGG - Exonic
1179409017 21:41147889-41147911 GTTTAACCCTGAGCAGGGTCTGG + Intergenic
1179534009 21:42039794-42039816 GCTCCAACCTGGCCAGGGTTGGG - Intergenic
1179876738 21:44272547-44272569 GGCTCTTCCTGCCCAGGGTCGGG + Intergenic
1180101794 21:45590911-45590933 GCTTCATCCTGAGCACCGCCCGG + Intergenic
1183805170 22:40203262-40203284 GCTTACCCCTGTCCAGGGTCTGG + Intronic
1184614257 22:45627216-45627238 GCTTCACCCAGACCTGGGTCAGG - Intergenic
1184651124 22:45919932-45919954 GCTTCCCTCTGACCAGGGTGGGG - Intergenic
949347071 3:3086337-3086359 GCTTCATGAAGACCAGGGTCAGG + Intronic
950649213 3:14396727-14396749 GCTCCATCCTTACCTGGGGCAGG - Intergenic
953125375 3:40087330-40087352 GCTTACTCCTGGCCAGGGGCAGG - Intronic
953537079 3:43784560-43784582 TCTTCACCCTGGACAGGGTCAGG - Intergenic
954309013 3:49750228-49750250 CCTTCAGCCTGACCGGGGCCAGG - Intronic
954454118 3:50587835-50587857 GCTGCAACTTGTCCAGGGTCTGG + Intergenic
955743105 3:62113115-62113137 GCCTCATCCTGACCTGGGTAAGG - Intronic
955784159 3:62518668-62518690 GCTTCTTCCTTACCTGGGACAGG + Intronic
956805174 3:72802826-72802848 CCTCCACCCTGACCAGGCTCTGG + Intronic
960297071 3:115957413-115957435 ACTTCATCCTGACCAGCCTGAGG + Intronic
961376772 3:126472381-126472403 GCTTCAGTGTGAACAGGGTCTGG - Intronic
961797836 3:129422517-129422539 GCCTCATCCTGACTAGGGGTTGG + Intronic
962448636 3:135492695-135492717 GTTTCATCCTCTGCAGGGTCTGG + Intergenic
964571047 3:158107138-158107160 GCATCATCCTGCCCAGAGACAGG + Intronic
965376442 3:167930137-167930159 GCTTCAGGCTGCCCAGGCTCAGG - Intergenic
968764114 4:2459249-2459271 ACTGCATCCTCACCTGGGTCAGG - Exonic
970250875 4:14114641-14114663 ACAGCATCCTGGCCAGGGTCGGG + Intergenic
971267249 4:25106447-25106469 GCTCCATCCTGCCCCGAGTCTGG + Intergenic
974641217 4:64633337-64633359 GCATCATCCTGACCAAAGCCTGG - Intergenic
976041028 4:80885463-80885485 CCTTCCTCCTGCCCAAGGTCAGG + Intronic
976149280 4:82077230-82077252 GCTTCAGCCTGCCCAGTGCCTGG + Intergenic
977563852 4:98561799-98561821 GCTTCCTCTTCACCAGGGCCTGG - Intronic
981159915 4:141485468-141485490 TCTTCATGCTGCCCAGGGCCTGG + Intergenic
985819646 5:2150995-2151017 GCTGCCTCCTGGGCAGGGTCAGG + Intergenic
991493509 5:67206188-67206210 GCTTCTTCCAGTTCAGGGTCTGG + Intergenic
994497837 5:100535726-100535748 GCTTCAGCCAGACCACGGCCCGG - Exonic
997549087 5:134736981-134737003 GCTTCAACCTCCCCAGGATCAGG + Intergenic
1001543686 5:172557011-172557033 GATGTCTCCTGACCAGGGTCTGG + Intergenic
1002344203 5:178536518-178536540 GCATCATCCAGACCATGGACAGG + Intronic
1003385357 6:5662496-5662518 GCTTCATCCAGAGAAGGATCAGG - Intronic
1003976683 6:11351379-11351401 GCTTCATCCTGATGGGGTTCAGG + Intronic
1006487961 6:34360145-34360167 GCTTCAACCTCCCCAGGCTCAGG - Intronic
1008044469 6:46837604-46837626 GCTTCATCCTTCCCAGGCTAAGG + Intronic
1012898158 6:104975734-104975756 GCCTCATCCTCCCCAGGCTCAGG + Intronic
1015786824 6:136927319-136927341 GGTCCACCCTGACCAGAGTCAGG + Intergenic
1017180941 6:151551417-151551439 GCTTCCTCTTGAGCACGGTCTGG + Intronic
1017334114 6:153234969-153234991 GCTTCATTCTGACCCTGCTCTGG - Intergenic
1017929194 6:158937888-158937910 GCTTCAACCTCCCCAGGCTCTGG - Intergenic
1018886767 6:167945227-167945249 GCTTCGGCCTGCACAGGGTCAGG + Intronic
1021487491 7:21183413-21183435 GCTTCAACCTCCCCAGGCTCAGG + Intergenic
1027883602 7:83874300-83874322 ACTAAATCCTGACCAAGGTCTGG + Intergenic
1031048732 7:116923310-116923332 GCCTCAACCTGTCCAGGCTCAGG - Intergenic
1032254612 7:130287138-130287160 GCTGCATACTGACCTGGGGCAGG - Intronic
1032482230 7:132256389-132256411 GCTTAACCTGGACCAGGGTCTGG + Intronic
1032805569 7:135350550-135350572 GCTTCAACCTCCCCAGGCTCAGG - Intergenic
1033165448 7:139035545-139035567 GCTTCGTCCTGCCCCGGGCCGGG - Intronic
1033597150 7:142866268-142866290 GCTGCAGCCTGAGGAGGGTCAGG - Exonic
1033661908 7:143408441-143408463 GCTACTTCCTGGCAAGGGTCCGG + Intronic
1037200798 8:16249908-16249930 GCTTTAGCCTGACCAGGATGAGG + Intronic
1037770636 8:21797371-21797393 GCTTCAGCCTCCCCAGGCTCAGG + Intronic
1038143869 8:24875711-24875733 GCTTCCTCCTCTCCAGGCTCAGG - Intergenic
1039512080 8:38100181-38100203 GCCTCATCCTCCCCAGGCTCAGG - Intergenic
1042987637 8:74602016-74602038 ACTCCATCCTGAATAGGGTCTGG + Intronic
1045889766 8:107141670-107141692 GCTTATTCCTGAGCAGGGACAGG + Intergenic
1048952538 8:139508309-139508331 GCTTCACCCTAAACAGGGGCTGG - Intergenic
1048993671 8:139775787-139775809 ACTTCATCTTGACCATGGCCAGG - Intronic
1052444294 9:28540340-28540362 GCTTCAACCTCTCCAGGCTCAGG + Intronic
1053420496 9:37974590-37974612 GCTGCCTCCTGAGCAGGGTCAGG + Intronic
1053653126 9:40189331-40189353 GCTTCATCCTTCCCAGGCTAAGG - Intergenic
1053903529 9:42818634-42818656 GCTTCATCCTTCCCAGGCTAAGG - Intergenic
1054531458 9:66186892-66186914 GCTTCATCCTTCCCAGGCTAAGG + Intergenic
1057077568 9:92146715-92146737 GCAGCATCCAGACCAGGGTGGGG + Intergenic
1058679842 9:107431233-107431255 GCTGCATCCTAACCTTGGTCTGG - Intergenic
1058983116 9:110188367-110188389 GTTTCATCCTCTCCAGGGTTGGG - Intergenic
1060787275 9:126460607-126460629 GCCTCTCCCTGACCGGGGTCTGG + Intronic
1061001659 9:127906059-127906081 GCTTCCTCCTGCCCAGTGCCAGG - Intergenic
1061207159 9:129171364-129171386 TCTTCATCCTGGCCAGGAGCAGG + Intergenic
1062227922 9:135464270-135464292 GCATCATCTTGACCTTGGTCTGG - Intergenic
1062278654 9:135742339-135742361 GCTTCGTGCTGAGCAGGGCCAGG + Intronic
1185868130 X:3640661-3640683 ACTCCATCCTGAACAGGGGCCGG + Intronic
1189115988 X:38343171-38343193 GCTTTCTACTGACCAGGGTTTGG - Intronic
1193318307 X:80090820-80090842 GCTTAAGCCTGCACAGGGTCAGG - Intergenic
1198420867 X:136469975-136469997 GTTTCATACTGAGCTGGGTCTGG - Intergenic
1198786732 X:140296947-140296969 ACTTCATTCAGGCCAGGGTCTGG - Intergenic
1198855438 X:141010693-141010715 GCATCTTCCTGGCCAGGGTGGGG - Intergenic
1198907257 X:141576675-141576697 GCATCTTCCTGGCCAGGGTGGGG + Intergenic
1198909534 X:141597726-141597748 GCATCTTCCTGGCCAGGGTGGGG - Intronic
1198917552 X:141690419-141690441 GCATCTTCCTGGCCAGGGTGGGG + Intronic
1199948477 X:152686439-152686461 ACTCCATCTTGAACAGGGTCTGG + Intergenic
1199961202 X:152782017-152782039 ACTCCATCTTGAACAGGGTCTGG - Intergenic
1200796109 Y:7342686-7342708 ACTCCATCCTGAACAGGGGCTGG - Intergenic