ID: 1157504790

View in Genome Browser
Species Human (GRCh38)
Location 18:48218674-48218696
Sequence GGCCAAGGAGAGCAGAGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 517
Summary {0: 1, 1: 1, 2: 4, 3: 48, 4: 463}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157504790_1157504798 30 Left 1157504790 18:48218674-48218696 CCTGGACTCTGCTCTCCTTGGCC 0: 1
1: 1
2: 4
3: 48
4: 463
Right 1157504798 18:48218727-48218749 TTCTGCACCACTGCCGACTATGG 0: 1
1: 0
2: 0
3: 9
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157504790 Original CRISPR GGCCAAGGAGAGCAGAGTCC AGG (reversed) Intronic
900205625 1:1430936-1430958 AGCCCCGGAGAGCAGAGGCCTGG + Intergenic
900294184 1:1940348-1940370 TGACAAGGAGACCCGAGTCCTGG - Exonic
900958944 1:5907166-5907188 GGCCAAGCAGTGCTGAGTCGGGG + Exonic
901049948 1:6420940-6420962 GGCCAAGGAGGGCTCTGTCCAGG + Intronic
901936325 1:12629676-12629698 GGCTTAGGAGAGCAGAGGGCTGG - Intergenic
902069603 1:13723109-13723131 TGCCAAGGAGAGAAGGGGCCTGG - Intronic
902809418 1:18879831-18879853 GGCCAAACCGAGGAGAGTCCTGG + Intronic
902873652 1:19328530-19328552 GGCCAAGCTGAGCAGAGACTGGG - Intronic
903056787 1:20641665-20641687 GCCCCAGGAGAGCAGAGGCTAGG - Intronic
903136188 1:21310735-21310757 AGCCAAGGTGACCAGAGTCTTGG - Intronic
903261502 1:22134080-22134102 GGCCAAGCAGATCAGTGTCGTGG + Intronic
903269365 1:22178037-22178059 CCCCAAGGAAAGCAGGGTCCTGG - Intergenic
904036953 1:27564116-27564138 GGACAAGGAGGCCAAAGTCCAGG + Intronic
904312273 1:29636526-29636548 GACCAAGCAGAGCTGAGTGCTGG + Intergenic
904919354 1:33994719-33994741 GGCCAATGAGATTAGATTCCTGG - Intronic
904938928 1:34151402-34151424 GGCCACGGAGGGGAGGGTCCTGG + Intronic
904954393 1:34270965-34270987 AGCCAACCAGAGCTGAGTCCAGG + Intergenic
906750056 1:48250815-48250837 ACCCAAGGAGAGGAGAGGCCAGG - Intergenic
907410726 1:54281593-54281615 GGACAGGGAGAGCCAAGTCCAGG - Intronic
907701367 1:56791481-56791503 GGCCAAGGTGGGCAGAGTTCAGG - Intronic
908443951 1:64183662-64183684 GGCAGAGGAGAGCAAAGTCCGGG - Intergenic
908716590 1:67077287-67077309 GGCCCAGGAGAGTGGAGTACTGG + Intergenic
908827289 1:68146051-68146073 GGCCAAGTTGAGCCGGGTCCAGG + Intronic
910865361 1:91783376-91783398 GGCCAAGGAGCTCAGAGACAAGG + Intronic
912540598 1:110412082-110412104 GGCCAAGGAGAGCAAATTGCAGG - Intergenic
913090289 1:115472146-115472168 GGCCAATGGGAGCAGAGGCAGGG - Intergenic
914428291 1:147599212-147599234 GGCGGAGGAGAGCGCAGTCCTGG + Intronic
915023554 1:152805088-152805110 AGCCTAGAAGAGCAGAATCCAGG - Exonic
915579755 1:156806382-156806404 GGCCAAGGAAATTAGACTCCAGG + Exonic
915888540 1:159749273-159749295 GGCCTAGAAGTGCAGAGTCCAGG + Intergenic
916388184 1:164300740-164300762 GGCCAAGGGAAGCTGAGACCTGG - Intergenic
917798608 1:178550713-178550735 GAACAAGGAGAGCAGGTTCCTGG + Intergenic
917967164 1:180186176-180186198 GGCCAAGGTGAGCAGGGCCATGG + Exonic
918038457 1:180897489-180897511 TGCCGAGCAGAGCAGAGCCCTGG - Intergenic
918077464 1:181181477-181181499 GGCCAAGGCGGGCAGAGTTCAGG - Intergenic
919575537 1:199304173-199304195 GTCCTTGGAGAGCAGAGTTCGGG + Intergenic
919796894 1:201326343-201326365 GGACAAGGACAGCAGCCTCCAGG - Intronic
919855622 1:201704219-201704241 GCCCTAGGAGTGCAGAGTCCTGG + Intronic
919942775 1:202299771-202299793 GACAGAGGTGAGCAGAGTCCAGG + Intronic
920176299 1:204104068-204104090 GGCCAGGGTCAGCTGAGTCCCGG + Intronic
920314169 1:205065881-205065903 GTCCAAGGAGGCCACAGTCCTGG + Exonic
922619548 1:226981481-226981503 GGCCAAGGGCAGCACAGCCCAGG - Intronic
923434484 1:233955406-233955428 GGCCAAGATGAGCAGAGAGCTGG - Intronic
923616577 1:235543380-235543402 GGCCGAGGAGGGCAGATTGCTGG - Intergenic
924033582 1:239912274-239912296 GGCAAAGGAGAGCAGAGCCGAGG - Exonic
1063229347 10:4048687-4048709 GGCCAAGGTCAGATGAGTCCAGG - Intergenic
1063422557 10:5924926-5924948 GGGAAAGGGGAGCAGAGTCCTGG + Intronic
1063474269 10:6314945-6314967 GGCCTTGAATAGCAGAGTCCAGG + Intergenic
1063705469 10:8426096-8426118 GGCCAAGGAGGGCAGATCACTGG - Intergenic
1063953638 10:11246681-11246703 GTCCAAGGAGAGCAGAGTGAGGG - Intronic
1064536421 10:16362038-16362060 GGCCAAGGCGAGCAGATCACTGG + Intergenic
1065486079 10:26237544-26237566 GAGCAGGGAGAGCAGAGTCGGGG + Intronic
1066076988 10:31888620-31888642 GGCCCATGAGACCAAAGTCCAGG - Intronic
1066338905 10:34509688-34509710 GGCCAAAGCGCCCAGAGTCCAGG + Intronic
1066490483 10:35889362-35889384 GGTCAAGGTCAGCAGAGCCCGGG + Intergenic
1067083710 10:43227430-43227452 GGGGAAGGAGAGCAGAGCCATGG - Intronic
1067157913 10:43797988-43798010 GGCCAAGGTGGGCAGATTGCTGG - Intergenic
1067296536 10:44978001-44978023 GGCCACGGAGAGCAGAAGCCGGG + Exonic
1067345319 10:45433983-45434005 AGCCAAGGAAGCCAGAGTCCTGG - Intronic
1067375844 10:45727254-45727276 GGCCGAGGACCGCAGAGCCCCGG - Exonic
1067721552 10:48731492-48731514 GGCCCAGGAGCCCTGAGTCCCGG - Exonic
1069440508 10:68424266-68424288 GGCCAAGGTGGGCAGATTGCTGG + Intronic
1069960414 10:72075841-72075863 GGACGAGGAGAGCAGGGCCCTGG + Intronic
1070332157 10:75425808-75425830 GGCCTAGGAGAGCTGGGTTCAGG - Intergenic
1070355196 10:75632973-75632995 GTCCCAGGGGAGCAGACTCCTGG + Intronic
1071309380 10:84328576-84328598 GGCCCTGGAGGGCGGAGTCCGGG + Exonic
1072436822 10:95421769-95421791 GGTCAAGGGGAGCAGAGGCATGG - Intronic
1073099735 10:101000220-101000242 GGCTGAGGAGAGCAGAGGGCTGG - Exonic
1073347357 10:102794004-102794026 GGCCAAGGTGGGCAGATTACTGG - Intronic
1073646356 10:105308373-105308395 GGCCAAGGAGAGCAGATCACCGG - Intergenic
1073654612 10:105399656-105399678 GGCCAAGGGAAGCAGTGTCAGGG + Intergenic
1074085079 10:110203774-110203796 GAGAAAGGAGGGCAGAGTCCAGG + Intergenic
1074539658 10:114353888-114353910 GGCCAAGTAGAGCAGAGGCATGG + Intronic
1074758362 10:116644927-116644949 GGTCAAGGGGAGCCGAATCCAGG + Intronic
1075761291 10:124859175-124859197 GGCCAAGGTGGGCAGATCCCTGG - Intergenic
1075845566 10:125542523-125542545 GGCCAAGGAGAGATGGGGCCTGG + Intergenic
1076157660 10:128216030-128216052 GACCAGGGACAGCAGGGTCCTGG + Intergenic
1076701170 10:132273987-132274009 GGAAAAAGAGAGCAGAGCCCAGG - Intronic
1076991883 11:279849-279871 GGACACGGAGAGCAGCGTCCCGG - Exonic
1077466828 11:2737343-2737365 GCCCCAGGAGAGCAGCTTCCTGG - Intronic
1078561706 11:12378013-12378035 GGCCCAGGAGGGCAGCGCCCGGG - Intronic
1078886231 11:15502905-15502927 GGCCAAGGAGAGCCAGATCCAGG - Intergenic
1079006011 11:16791456-16791478 GACCCAGGAGACCTGAGTCCTGG - Intronic
1079101879 11:17547131-17547153 GGCCAAGAAAAGCAGAGGCTAGG + Intergenic
1079579407 11:22044286-22044308 GGCCAAGGTGGGCAGATTCCTGG + Intergenic
1081677385 11:44978890-44978912 TGCCAAGGATACCAAAGTCCAGG - Intergenic
1081936359 11:46906647-46906669 GAGCAAGTAGAGCAGTGTCCTGG + Intronic
1082995932 11:59255529-59255551 GACCAAGGTGAGCAGTGCCCAGG + Intergenic
1083231786 11:61326180-61326202 GGACAAGGAGTGAAGAGGCCTGG + Intronic
1083544511 11:63538512-63538534 GGCAAAGGAGAGCAGACCCCAGG + Intronic
1083610639 11:64002667-64002689 GGCTAAGGAGAGCAGGGTGGGGG - Intronic
1083897468 11:65627287-65627309 AGCCCAGCAGAGCAGAGGCCAGG + Intronic
1084215787 11:67646179-67646201 GGCCAAGCACAGCACAGGCCTGG - Intronic
1085415766 11:76318288-76318310 GGCCAGGGTGAGCAGGGGCCTGG + Intergenic
1085436533 11:76509255-76509277 GGCCAAGGAGTGCAGATCACCGG + Intronic
1086591180 11:88515899-88515921 GGCAAAGAAGAGGAGAATCCTGG + Intronic
1087833447 11:102845276-102845298 GGACAAGGAGAACAGAGTGGTGG + Intergenic
1087996753 11:104818539-104818561 GTTCAAGGAGAGCAGAGCTCTGG - Intergenic
1088796294 11:113269209-113269231 GGCCCCAGAGAGCTGAGTCCAGG + Intronic
1089110627 11:116053139-116053161 GGAAAAGGAGAGCAGGGACCGGG - Intergenic
1089295605 11:117465405-117465427 GGCCAAAGAGGCCAGAGTGCTGG - Intronic
1089578176 11:119461526-119461548 AGCCAAGGGGAGCAGAATCCCGG - Intergenic
1090472248 11:126990499-126990521 GCCCAGAGAGAGCAGAGCCCGGG - Intronic
1090654764 11:128834592-128834614 GGGCAAAGAAAGCAGAGCCCAGG - Intergenic
1091384271 12:82814-82836 GGCCATGGAGAGTAGAGGCTAGG - Intronic
1092229789 12:6770040-6770062 CTCAAAGGAGAGCAGAGTCAGGG + Intronic
1092242014 12:6841049-6841071 AGCCCAGGAGAGCAGAGCCCAGG - Intronic
1093012086 12:14118019-14118041 GGCCAAGCAGGGCAGATTGCTGG + Intergenic
1093121479 12:15276557-15276579 AGCAAAGGAAAACAGAGTCCAGG - Intronic
1093479347 12:19588870-19588892 GGCCAAGGGGGGCTGAGCCCTGG + Intronic
1093594639 12:20945997-20946019 GGCCAAGGAGAGCAAGGACATGG + Intergenic
1094128938 12:27053994-27054016 GGCCAAGGTGGGCAGATGCCAGG + Intronic
1095318544 12:40796871-40796893 AGCCAAGGAGACAAAAGTCCTGG + Intronic
1095471000 12:42536683-42536705 TGCCCAGGTGAGCAGAGTTCAGG - Intronic
1095872370 12:47043732-47043754 GGGCACCTAGAGCAGAGTCCAGG + Intergenic
1096105481 12:48994980-48995002 GGGCAAGGAAGGGAGAGTCCCGG + Intergenic
1096275859 12:50207651-50207673 GGCCAAGGCGGGCAGATTGCTGG + Intronic
1096304654 12:50463708-50463730 GGCCCATGAGAGCAGCCTCCAGG - Intronic
1096497271 12:52045819-52045841 GGGCCAGGAGAGCAGAGCCTGGG + Intronic
1096549432 12:52362546-52362568 GGGCAGGGAGAGGAGGGTCCTGG + Intronic
1096787815 12:54027730-54027752 GGCAAAGGAGAGCAGATGCGTGG + Intronic
1098083028 12:66809889-66809911 GGCCAAGGTGGGCAGATTGCTGG - Intergenic
1098124269 12:67273710-67273732 GGCCAAGGTGGGCAGATTGCCGG - Intronic
1100512050 12:95285206-95285228 GGCCAACTAGAGCAGATTGCTGG + Intronic
1100681593 12:96929658-96929680 GGAAAAGTAGAGCAGAGTCAGGG - Intronic
1102058653 12:109915595-109915617 GGCCCAGGGGAGCAGGGGCCGGG - Intronic
1102795992 12:115689164-115689186 AGCCCAGGAGCGCAGAGACCAGG - Intergenic
1103935657 12:124475135-124475157 GGGCAAGGACAGCAGGGGCCTGG + Intronic
1104735221 12:131132267-131132289 TGCAAGGGAGAGCAGTGTCCTGG + Intronic
1104933420 12:132352288-132352310 GGCAAAGCAGTGCAGCGTCCAGG - Intergenic
1104996296 12:132659568-132659590 GGCCTAGAGGAGCACAGTCCAGG - Intronic
1105476207 13:20730017-20730039 GGCCCGGGAGGGCAGAGTCGGGG - Intronic
1108076689 13:46687192-46687214 GGCCAAGGCGGGCAGATCCCTGG - Intronic
1108678367 13:52757848-52757870 GGCCAAGGCGGGCAGACTACTGG + Intergenic
1110354559 13:74552307-74552329 CCTCCAGGAGAGCAGAGTCCGGG + Intergenic
1110561159 13:76911941-76911963 GGTAGAGGAGAGCATAGTCCAGG - Intergenic
1112489559 13:99849410-99849432 GGCCAAGGCGAGCGGATTGCTGG + Intronic
1114329955 14:21626904-21626926 GGCCCAGGAGAACAGAGCCAAGG - Intergenic
1114517315 14:23308354-23308376 AGCCCTGGAGTGCAGAGTCCAGG - Intronic
1115140838 14:30169078-30169100 GGCATAGGACAGCAGAGCCCTGG + Intronic
1115770147 14:36658894-36658916 GCCCAAGGGGAGCAGGGGCCGGG - Intronic
1116333958 14:43633044-43633066 GGCCAAGGCGGGCAGATTGCCGG - Intergenic
1116996316 14:51328840-51328862 GGCCAGGAAGAACACAGTCCAGG - Intergenic
1118753364 14:68821980-68822002 GGGCAAGGAGACCAGAGGCAGGG + Intergenic
1119120348 14:72069773-72069795 GGCCAAGGCGGGCAGATTGCTGG - Intronic
1119240345 14:73054382-73054404 GGCCAATGAGAATAGGGTCCAGG + Intergenic
1119386545 14:74260947-74260969 GCCCGAGGAGAGCAGAGTCTTGG - Exonic
1119736628 14:76986759-76986781 GAGCAGGGAGGGCAGAGTCCTGG - Intergenic
1120690242 14:87584708-87584730 GGCCAAGGAGGGCAGATCACCGG + Intergenic
1120842360 14:89097137-89097159 CGCCAACGTGGGCAGAGTCCCGG + Intergenic
1121069751 14:91007119-91007141 GGCCTGGGAGAGCAGAGTTTGGG + Intronic
1121514309 14:94539216-94539238 GGCAAAGCAGGGCAGATTCCCGG - Intergenic
1121588858 14:95083805-95083827 GGCCAAGGTGGGCAGATTGCTGG - Intergenic
1121700942 14:95953592-95953614 CTCCAAGGAGCCCAGAGTCCAGG - Intergenic
1122171121 14:99876543-99876565 GACCAAGGACAGAAGAGCCCTGG - Intronic
1122978433 14:105180712-105180734 GAGCAAGGAGCGCAGAGGCCGGG - Intronic
1123029289 14:105443709-105443731 GGCCAAGGCGGGCAGATTGCTGG + Intronic
1123066559 14:105622155-105622177 GGACATGGAGAGCAGAGCCATGG + Intergenic
1123075311 14:105664917-105664939 GGACATGGAGAGCAGAGCCAGGG + Intergenic
1123095726 14:105766159-105766181 GGACATGGAGAGCAGAGCCAGGG + Intergenic
1124318655 15:28694278-28694300 GGCCACGGGGAGCTGAGACCGGG - Intergenic
1125510602 15:40290566-40290588 GGCCCAGGAGAGGTGAGCCCTGG - Exonic
1125883309 15:43211105-43211127 GGGAAAGGAAAGCAGGGTCCTGG + Intronic
1126360583 15:47841780-47841802 GGCCAGAGAAAGCAGAGTACAGG + Intergenic
1127332853 15:57955664-57955686 GGCCAAGGCGTTCAGAGACCTGG - Intronic
1128229566 15:66025226-66025248 GGGCAAGGAGAGGAGAATGCGGG - Intronic
1128269884 15:66299572-66299594 GGCCAGGTAGAGAAGAGGCCTGG + Intronic
1128919978 15:71601496-71601518 GGCCAACAGGAGCAGAGTCTTGG - Intronic
1128998679 15:72315880-72315902 GGGCCTTGAGAGCAGAGTCCCGG + Exonic
1130925609 15:88383552-88383574 GGCCAGGGTGAGCTGAGGCCAGG + Intergenic
1132008811 15:98255964-98255986 GGCCAAGTGAAGCAGAGTCTCGG + Intergenic
1132111622 15:99105844-99105866 CGGCCAGGAGAGCAGACTCCAGG + Exonic
1132506458 16:311968-311990 GGCAATGGTGAGCCGAGTCCAGG + Intronic
1132735969 16:1386171-1386193 GGCCAAGGTGGGCAGATTACTGG + Intronic
1132743246 16:1426355-1426377 GCCCCAGGACAGCAGAGTCAGGG + Intergenic
1132743370 16:1426923-1426945 CACCAAGGAGAGCAGGGCCCCGG - Intergenic
1133113439 16:3563160-3563182 GGCCATGGAGAGCGGGGCCCTGG - Exonic
1133519848 16:6546395-6546417 GGCCAAGGAGCCCAAAGTCAGGG + Intronic
1133977839 16:10612773-10612795 TGCCAAAAAGAGCAGAGTTCAGG + Intergenic
1135419741 16:22297711-22297733 GGTCAAGGAAGTCAGAGTCCGGG - Intronic
1136358868 16:29764723-29764745 AGCCAAGGACAGAAGAGACCTGG - Intergenic
1137245878 16:46704312-46704334 GGCCAAGGTGGGCAGATTGCTGG - Intergenic
1137286822 16:47023076-47023098 GGTCAAGGAAAGCAGTGTCCTGG + Intergenic
1137463202 16:48684828-48684850 AACCAAGGAGAGCAAAGTACAGG - Intergenic
1138000677 16:53275860-53275882 GGCCAAGGAAATGAGAGACCAGG - Intronic
1138228975 16:55324179-55324201 GGTGGAGGAGAGCAGAGGCCCGG - Exonic
1138610898 16:58123220-58123242 GGCCAAGGCGAGCTGAGGTCAGG - Intronic
1138613671 16:58147318-58147340 GGCCAAGGTGAGCAGATTGCTGG + Intergenic
1140034493 16:71361904-71361926 GGACTAGGAGACCAGATTCCTGG - Intronic
1140212126 16:72978608-72978630 GGCCTAGGAGAGCATCGGCCGGG + Intronic
1140407112 16:74718329-74718351 GGCCAAGGACAGCACAATGCAGG + Intronic
1141168729 16:81677795-81677817 GGGGCAGGAGAGCAGAGTCCTGG + Intronic
1141975568 16:87513741-87513763 GGCCAAGGTGGGCAGATTGCTGG - Intergenic
1142117689 16:88368553-88368575 GGCCTGGGAGAGCATAGCCCTGG + Intergenic
1142534375 17:604227-604249 TGCCAGCGAGAGCAGAGCCCGGG - Intronic
1143044346 17:4064610-4064632 GCCACAGGAGACCAGAGTCCTGG - Exonic
1143372947 17:6451712-6451734 CAACAAGGAGAGCAGAGCCCAGG + Exonic
1143539023 17:7558624-7558646 GGCCAAGCTGGGCAGTGTCCAGG - Exonic
1145010084 17:19362945-19362967 GGCGAATGAGAGCTGAGTCCTGG + Intronic
1145058998 17:19720665-19720687 GGCAAGGGAGTGGAGAGTCCTGG + Intergenic
1146278466 17:31530133-31530155 GGGCAAGGAGGGCTGGGTCCTGG - Intronic
1146885828 17:36470129-36470151 GGTCAAGGCAAGCAGAGCCCTGG - Intergenic
1147002519 17:37374121-37374143 GGCCAAGGTGGGCAGATTACTGG + Intronic
1147160086 17:38564483-38564505 GGCCAAGGCCAGCAGAGACTGGG - Intronic
1147913600 17:43873211-43873233 TGCAAAGGAGGGCAAAGTCCTGG - Intergenic
1148075639 17:44933922-44933944 GGCCAAGGAGATCAGGCTCTCGG - Exonic
1148150623 17:45394827-45394849 GGTCAAGGACAGCAGAGGCCCGG + Exonic
1149579694 17:57741033-57741055 GGCCAAGGCGAGAAGATTGCTGG - Intergenic
1149598244 17:57876464-57876486 TGCCAAGGAGATCAGGGTCTAGG - Intronic
1150132822 17:62678527-62678549 GGACAAGAAGAGCTGGGTCCAGG + Exonic
1150265727 17:63831356-63831378 GGCGAAGCAGTGCCGAGTCCAGG - Exonic
1151396500 17:73826628-73826650 GGTCCAGGAGAGGACAGTCCTGG - Intergenic
1151629512 17:75301019-75301041 GGGCAAGGAGAGCAGAGGGGAGG - Intergenic
1151630716 17:75309191-75309213 GTCCAAAGAGGGCAAAGTCCAGG - Intergenic
1151649390 17:75456832-75456854 GGCCAAGGAAAGGGGAGTCTGGG + Intronic
1151681665 17:75625777-75625799 GACCAAGCAGAGCAGGTTCCAGG + Intergenic
1151685080 17:75641482-75641504 GCACAGGGAGAGCAGAGGCCTGG - Intronic
1152222540 17:79076720-79076742 GTCCTAAGAGAGCAGAGACCAGG - Intronic
1152298314 17:79481185-79481207 GGACAAAGAGACCAGAGGCCCGG - Intronic
1152570407 17:81119104-81119126 GGCAGAGGAGAGCCGAGTGCAGG + Intronic
1152592785 17:81222105-81222127 TGGCTGGGAGAGCAGAGTCCTGG - Intronic
1152638283 17:81439110-81439132 GGCCCAGCAGAGCCGAGTCCTGG + Intronic
1152689708 17:81712404-81712426 GGCCCAGGAGAGCCCAATCCCGG - Exonic
1153019657 18:615584-615606 GGAAGAGCAGAGCAGAGTCCTGG - Intronic
1153365856 18:4255048-4255070 GGCAAAGCAGAGCCGAGTGCTGG + Intronic
1153499075 18:5730151-5730173 CGCCCAGCAGAGCAGAGTCTTGG + Intergenic
1153572317 18:6485827-6485849 GGCCAAGGAGGGCAGATCACTGG - Intergenic
1155023966 18:21924035-21924057 GGCCAAGGCGGGCAGATTGCTGG - Intergenic
1155718337 18:28975485-28975507 GGCCAAGGAGGGCAATATCCTGG + Intergenic
1157504790 18:48218674-48218696 GGCCAAGGAGAGCAGAGTCCAGG - Intronic
1157505363 18:48222396-48222418 GGCCAAGGAGAGGAGAGTGTGGG + Intronic
1157562647 18:48659677-48659699 GGCAAAGGAGAGGTGAGACCCGG + Intronic
1159020064 18:63136023-63136045 GCCCAAAGGGAGCAGAGTCACGG - Intronic
1160201760 18:76801944-76801966 GGCCAGGGCGAGCAGGGTGCGGG + Intronic
1160320855 18:77893526-77893548 GGAGAAGGAGAGCAGAAGCCAGG - Intergenic
1160763294 19:796462-796484 GGCCAAGGACTGCAAGGTCCAGG + Intergenic
1161180698 19:2879575-2879597 GGCCAAGGCGGGCAGATTTCAGG - Exonic
1161211241 19:3067130-3067152 GGCCCAGGAGGGCAGACTGCTGG - Intergenic
1161275085 19:3411561-3411583 GGCCAAGGAGGGCAGATCACTGG - Intronic
1161314667 19:3612351-3612373 GGCCAAGGAGGGCATGGGCCAGG - Exonic
1161317991 19:3627177-3627199 GGCCGAGGAGAGGCGTGTCCGGG + Intergenic
1161683741 19:5693187-5693209 GGCCAAGGAGAGGGAAGCCCTGG - Intronic
1161907108 19:7164894-7164916 GGCCAAGGTGGGCAGATTGCAGG + Intronic
1162944899 19:14037066-14037088 GGCCAAGGCAGGCAGAGTTCGGG - Intronic
1163289283 19:16368895-16368917 TGCCTAGGAGAGCAGTGGCCCGG + Intronic
1163475297 19:17522445-17522467 TGCCAAGGACAGGAGAGGCCTGG - Intergenic
1163632730 19:18425457-18425479 GGCCAGGGTGAGCAGGTTCCAGG - Intronic
1163799389 19:19355591-19355613 GGGCATGGAGAACAGAGTCCCGG + Intronic
1164478701 19:28594833-28594855 CCCCCAGGAGAGCAAAGTCCTGG - Intergenic
1164746014 19:30614096-30614118 GGCCAAGGCGGGCAGATTACTGG - Intronic
1165073372 19:33268172-33268194 GGCCCCGGGGAACAGAGTCCAGG + Intergenic
1165100313 19:33435142-33435164 GGCAGAGGAGAGCAAAGGCCTGG + Intronic
1165361770 19:35341265-35341287 GGCCAAGGGGAGGGGAGGCCTGG + Intronic
1165507557 19:36243935-36243957 GGCCAAGGAGGGTGGATTCCTGG - Intronic
1166677766 19:44749678-44749700 GACCCAGGAGAACAGAGACCCGG + Intronic
1166985936 19:46660158-46660180 GGTCAAGGAGAGCTGGGGCCAGG + Intronic
1167706953 19:51086771-51086793 GGCCAAGATGAGCAGGGCCCTGG + Intergenic
1168362451 19:55753537-55753559 GGGCAGAGAGAGCAAAGTCCAGG + Intergenic
925358531 2:3261155-3261177 GACCAACGAGACCAGAGTGCCGG + Intronic
925398726 2:3556572-3556594 GGAACAGGAGAGCTGAGTCCTGG + Intronic
925759624 2:7171835-7171857 TGCCAATGAGACCAGAGCCCAGG - Intergenic
926631266 2:15138333-15138355 GGCCAAGTGGTGCAGAGTCCAGG + Intergenic
927061923 2:19431443-19431465 TGCCAGGGAGAGCAGATCCCGGG - Intergenic
927110732 2:19862188-19862210 GGCTCAGGAGGGCAGAGTCCAGG + Intergenic
927471895 2:23383913-23383935 AGCCAAGGAGAGCAGAGGCCTGG + Intergenic
928407272 2:31024223-31024245 AGCCAGGGAGATCAGAGTTCAGG - Intronic
928747890 2:34436136-34436158 GGCTTAGGACAGCAGTGTCCAGG - Intergenic
929446927 2:42009212-42009234 GGCCAAGGAGTGGAGAGACAAGG + Intergenic
929510496 2:42562621-42562643 GGTTCAGGAGATCAGAGTCCAGG - Intronic
929523831 2:42680976-42680998 GGCCAAGGTGGGCAGAATGCTGG - Intronic
929771233 2:44893847-44893869 GGTCAAGGAAAACAGAGTACTGG + Intergenic
929967358 2:46545140-46545162 GGCCCAGGAGAGCTGAGAACTGG - Intronic
931180192 2:59891747-59891769 TGCAAAGGAAGGCAGAGTCCTGG + Intergenic
932411035 2:71547983-71548005 GCCCGAGGAGAGCAGTGGCCAGG - Intronic
933807696 2:86012100-86012122 AGCCAAAGAGAGCAGGCTCCTGG + Intergenic
933810737 2:86031398-86031420 GGCCATGGAGCGCCGGGTCCAGG - Exonic
935633378 2:105230952-105230974 GGCCTCTGAGACCAGAGTCCTGG + Intergenic
936558852 2:113519166-113519188 GGCCAAGAAGAGCAGGGACTTGG - Intergenic
936984210 2:118292631-118292653 AGCCAAAGAGAGCAAAGTTCTGG - Intergenic
937986173 2:127639097-127639119 GGCCAAGGAGAGGAGAGACATGG + Exonic
938686985 2:133748100-133748122 GGCCAAAGAGAGGTGAGTCTTGG - Intergenic
938775028 2:134534075-134534097 GGTCCAGGAGAGCAGAGAGCTGG + Intronic
939651507 2:144768110-144768132 GGCAAAGGAGAGCAGAGAGCTGG - Intergenic
939690531 2:145254671-145254693 GGCCAAGGAATGAAGAGGCCAGG - Intergenic
940647620 2:156408188-156408210 GGCCAAGGTGGGCAGATTACTGG - Intergenic
940982411 2:160018405-160018427 GGCCAAGGATGGTAAAGTCCAGG + Intronic
941929351 2:170924734-170924756 GGCCAACGAGTGCACAGCCCTGG + Intergenic
942215332 2:173713698-173713720 GGCCTAGGAGAGCAGGGCACTGG - Intergenic
944120550 2:196235890-196235912 GGCCAAGGCGAGCAGATCACAGG - Intronic
946253780 2:218429296-218429318 GGCCAAGGAGATCCGAGACCAGG + Exonic
946369047 2:219269495-219269517 AGGCAAGCAGAGTAGAGTCCAGG + Intronic
947618556 2:231574189-231574211 AGACAGGGAGAGCAGAGCCCTGG + Intergenic
948646201 2:239406672-239406694 GGCCAAGGGGAGGAGACACCAGG + Intergenic
948656639 2:239480367-239480389 GTCTAAGGAGAGCATGGTCCTGG - Intergenic
948901073 2:240957173-240957195 GGCCAGGGAGGGCAGAGAGCTGG - Intronic
948928869 2:241117451-241117473 GGCCAAGGAGACAAGAGGGCAGG + Intronic
1168957916 20:1847808-1847830 GGCCAAGAAGAGTAGATTCAGGG + Intergenic
1169948044 20:11010606-11010628 GGGCAAGCTGAGCAGAGACCAGG - Intergenic
1170470712 20:16665189-16665211 GGCCAAGGTGAGCAGATTGCTGG - Intergenic
1170812334 20:19684293-19684315 GGCCATGGAGAGCCGGGTCTTGG - Exonic
1171372422 20:24670290-24670312 GCCCAAGGACAGCAGCGTGCAGG + Intergenic
1171950727 20:31419119-31419141 GCCCAAGGAGAGAAGTCTCCAGG + Intergenic
1172767468 20:37358518-37358540 GGGCAAGGAGAGGTGAGCCCTGG - Intronic
1173474582 20:43349989-43350011 GGCCAGGGAGACCAGAGGACTGG + Intergenic
1173585581 20:44180570-44180592 GGCCAAGGTGGGCAGATTGCTGG - Intronic
1174378949 20:50144209-50144231 GGCCCAGGAGACCAGAGTTCTGG - Intronic
1175901573 20:62361885-62361907 GGCCAAGGAGAGCCCAGAGCTGG + Intronic
1175918152 20:62437169-62437191 GACCCAGGAGGGCAGAGACCAGG + Intergenic
1175988518 20:62776287-62776309 GAGCAAGGAGAGCCGAGCCCCGG - Intergenic
1176003746 20:62847982-62848004 AGCCAAGGAGAGCAGAGAAATGG + Intronic
1176261380 20:64182660-64182682 GGCCAGGGAGGGCTGGGTCCAGG - Intronic
1176410122 21:6445222-6445244 GGCAAAAGAGAGAAGAGTCCAGG - Intergenic
1177163872 21:17578599-17578621 GGCCAAGGCAGGCAGAGCCCAGG + Intronic
1178492064 21:33058710-33058732 TGCCAAGGACAGGAGATTCCTGG - Intergenic
1178758528 21:35377569-35377591 GGCTTAGGAGAGCAGACCCCCGG + Intronic
1178989998 21:37345139-37345161 GGCCAGGGTGAGCAGATTGCTGG - Intergenic
1179088137 21:38238433-38238455 GGCCAAGGACACCAAAGTTCTGG - Intronic
1179106392 21:38404452-38404474 GGACAGGGAGAGCAGGGCCCGGG + Intronic
1179685615 21:43053544-43053566 GGCAAAAGAGAGAAGAGTCCAGG - Exonic
1179799647 21:43804917-43804939 GGCCAAGGAGAGGGAAGGCCAGG + Exonic
1179910361 21:44444197-44444219 AGCCGAGGAGAGCTGGGTCCAGG - Intergenic
1180081298 21:45488955-45488977 GGCCTAGGAGAGGAGGCTCCAGG - Intronic
1180336335 22:11579699-11579721 GGACAGAGAGAGCAGATTCCTGG + Intergenic
1180414347 22:12694592-12694614 AGCCAATGGAAGCAGAGTCCAGG + Intergenic
1180751018 22:18124259-18124281 GGGCAAGGAGAGCATTGACCTGG + Exonic
1180884140 22:19227823-19227845 GGCCAAGGTGAGCAGAGCCCAGG - Intronic
1182765023 22:32752594-32752616 GGACAGGGACAGCAGAGCCCCGG - Intronic
1183506218 22:38210373-38210395 GGCCAAGGTGGGGACAGTCCAGG - Intronic
1183580057 22:38719240-38719262 GGCCAAGGTGGGCAGATTGCTGG - Intronic
1184102695 22:42349092-42349114 GGACTGGGAGAGCAGAGCCCAGG + Intergenic
1184290909 22:43497751-43497773 GTCAAAAGAGAGCAGATTCCAGG - Intronic
1184562135 22:45269337-45269359 GGGCCGGGAGAGCAGGGTCCTGG - Intergenic
1184692336 22:46122990-46123012 GGCAGAGGATAGCAGAGCCCAGG - Intergenic
1185032705 22:48453076-48453098 GCCCAAGAAGCACAGAGTCCAGG + Intergenic
1185250514 22:49799342-49799364 GGCCAAGGTGAGCAGGGGGCTGG + Intronic
950198285 3:11025294-11025316 GGCCAAGGAGAGCAAGGATCTGG + Intronic
954225480 3:49178165-49178187 GGCCAAGGAGGCCAGGGTACAGG - Intronic
954793886 3:53151704-53151726 GGCCAAGGTCAGGAGTGTCCTGG - Intergenic
955082776 3:55673287-55673309 GACAAAGGGGAGCAGAGGCCGGG + Intronic
957277881 3:78112524-78112546 GGCCAAGGAGAGAACATTGCTGG - Intergenic
957408702 3:79807961-79807983 TGCCAAGGAAGGCAGAGTCCTGG + Intergenic
957690702 3:83562862-83562884 GGCCAAGGTGAGAAGATTACTGG - Intergenic
960941962 3:122940778-122940800 GGAGAAGGACAGCAGAGGCCTGG - Intronic
961542633 3:127610385-127610407 GGGTAAGGAGAGCTGTGTCCAGG + Intronic
961723111 3:128908985-128909007 GGCCAAAGTGAGCACAGTCATGG + Exonic
961787978 3:129358963-129358985 GGCCATGGAGAGAAGGGTTCTGG + Intergenic
961836759 3:129667949-129667971 GGCCAAGGAGGGCAGATCACTGG + Intronic
962825115 3:139094324-139094346 GGTCAATGAGAGCAGAGCCTGGG - Intronic
963393437 3:144699797-144699819 GGAGAAGGAGAGCACAGTCAAGG - Intergenic
964118678 3:153161360-153161382 GACCAATGAGTGCAGAGTCTGGG + Intergenic
967419834 3:189260716-189260738 GGCCAAAGAAAGCAGTTTCCTGG - Intronic
968262972 3:197339959-197339981 ATCCCAGGCGAGCAGAGTCCAGG - Intergenic
968737204 4:2303689-2303711 GGGCAAGGAGGAGAGAGTCCTGG + Intronic
968956393 4:3721888-3721910 GCCCAAGGAGTACAGATTCCAGG + Intergenic
969721658 4:8895603-8895625 GGCCAGAGAGAGCAGATTCTGGG + Intergenic
972392184 4:38624002-38624024 GGCCAAGGAGGGCAGATCACGGG + Intergenic
973786216 4:54335066-54335088 GGAGAAAGAGAGGAGAGTCCAGG - Intergenic
975492530 4:75004485-75004507 AGACATGGAGAGCAGAGTCAGGG + Intronic
978530516 4:109707616-109707638 GGCCAAGGTGGGCAGATACCAGG - Intergenic
978658102 4:111090885-111090907 GGCCGAGGAGAGCTGATTGCTGG + Intergenic
979307674 4:119166341-119166363 AGCCAAGGTGAGCTGAGCCCAGG + Intronic
979727027 4:123974504-123974526 GGCCAAAGAGAGTCGAGTCCTGG - Intergenic
981773091 4:148333028-148333050 GGCCAAGGTGGGCAGATTGCTGG + Intronic
982177552 4:152720220-152720242 GGCCGAGGTGGGCAGAGGCCAGG + Intronic
982216467 4:153086717-153086739 GGCAAAGAAGAGCAGAGACCGGG - Intergenic
984014194 4:174406570-174406592 GTCCAAGTAGAGCATATTCCTGG - Intergenic
985877235 5:2609498-2609520 GTCAAAGAAGAGCAGAGGCCAGG + Intergenic
987201319 5:15580806-15580828 TGCCCAGGTGAGCAGAGTCATGG + Intronic
987389794 5:17365169-17365191 CTCCAAGGAGTCCAGAGTCCTGG - Intergenic
987429915 5:17820258-17820280 GGATAAGGAGAGCAGACCCCAGG - Intergenic
988562625 5:32294534-32294556 GGCCAAGGTGGGCAGATTACTGG - Intronic
990543362 5:56797105-56797127 GGCCAAGAAGAGCACATTCAAGG + Intergenic
990603717 5:57386310-57386332 GGCCAGGGAGCAGAGAGTCCTGG + Intergenic
991673912 5:69074405-69074427 GGCCAAGGACAGCAGAGGGATGG + Intergenic
992509228 5:77416813-77416835 GGCCTAGGAGAGCAAATTCTGGG + Intronic
995021065 5:107367896-107367918 GGCTAATGAGACCAGAGCCCAGG + Intergenic
995109441 5:108412523-108412545 GGCCAAGGTGGGCAGAGCCCAGG - Intergenic
995884627 5:116880105-116880127 AGCCAAGTACAGCAGATTCCCGG - Intergenic
996007920 5:118445755-118445777 TACCAAGGAGTCCAGAGTCCTGG + Intergenic
997613560 5:135231457-135231479 GGCCACAGAGGGCAGAGTCAGGG + Intronic
997647910 5:135493183-135493205 TGCCAAGAAGTGCAGACTCCTGG + Intergenic
998190473 5:140019562-140019584 GGCCAAGGAAAGCAGTGGCATGG - Intronic
998571138 5:143259102-143259124 GGCCAATGAGAGGTGAGTACAGG + Intergenic
999319091 5:150602165-150602187 GGCCTAGGTGACCTGAGTCCTGG + Intronic
999690038 5:154138782-154138804 GGCCAAGGATTCCAGAGGCCTGG - Intronic
1001116850 5:168947425-168947447 GGCCAAAGAGAGCAGTGAGCAGG - Intronic
1001748066 5:174107412-174107434 GGCCAAGCAGAGCACTGCCCGGG + Exonic
1002307784 5:178293908-178293930 GGCCACGGAGTCCAGAGGCCAGG + Intronic
1002606496 5:180386099-180386121 GGCCAAGGTGGGCAGAGGTCAGG + Intergenic
1002716856 5:181233548-181233570 GGGGAAGGAGAGGAGGGTCCAGG - Intronic
1002898815 6:1393930-1393952 GCCCCGGGAGAGCAGGGTCCAGG + Intronic
1003347606 6:5285243-5285265 GGCCAAAGGGAGCAGTGTCCAGG + Intronic
1003369200 6:5508514-5508536 GGGAAAGGGGAGCAGAGTGCTGG + Intronic
1004177639 6:13354010-13354032 AGTCCAGGAGAGCAGAGGCCAGG + Intergenic
1004190162 6:13456735-13456757 GGCCAAGACGAGCAGCGTGCAGG - Intronic
1004950486 6:20665102-20665124 GGTGATGGAGAGAAGAGTCCAGG + Intronic
1006012377 6:31053879-31053901 GACCAAGGAGGGCATAGGCCAGG - Intergenic
1007779050 6:44241470-44241492 GGCCAAGGTGGGCGGAGGCCAGG - Intergenic
1008693033 6:54002258-54002280 GGCCCAGGAGGGCAGAATCCAGG - Intronic
1010949840 6:82022681-82022703 GGAAAAGGAGAGCAGGGTGCAGG + Intergenic
1011089257 6:83577153-83577175 GGCAAAGCTGAGCAGAGTCTGGG + Intronic
1013723666 6:113064640-113064662 GCCTAACCAGAGCAGAGTCCTGG + Intergenic
1015833754 6:137397327-137397349 GGCCGAGGAGCACAGAGTTCAGG + Intergenic
1016939756 6:149474324-149474346 GGCCACGCTGGGCAGAGTCCGGG + Exonic
1017608468 6:156158418-156158440 GGAAAGGGAGAGCAGAGTCCAGG + Intergenic
1019168771 6:170117001-170117023 GGCCCAGGAGAGGCCAGTCCTGG + Intergenic
1019200469 6:170310253-170310275 GGCCAAGGGCACCAGAGTTCTGG + Intronic
1019295266 7:270540-270562 GGCCAAGGGGCCCAGAGTCATGG + Intergenic
1019446681 7:1074883-1074905 GGGCAAGGTGGGCAGAGCCCAGG + Intronic
1019532504 7:1510834-1510856 GGGCAGGGGGAGCAGAGGCCCGG + Intergenic
1019565915 7:1678984-1679006 GGCAGAGGAGAGGAGAGGCCTGG + Intergenic
1019639173 7:2094042-2094064 GGCCAAGGAAAGCAGAGGCCAGG + Intronic
1020482642 7:8681083-8681105 GGCCAGGGACAGCAAAGTCTAGG - Intronic
1021402015 7:20220110-20220132 GGCCGTGGGGTGCAGAGTCCAGG + Intergenic
1021874580 7:25036640-25036662 GGGCAAGGAGAGCAGAGGGACGG + Intergenic
1022385120 7:29892267-29892289 TGGCAAGGAGAGCAGAGCCAAGG + Intronic
1022434774 7:30372426-30372448 GGCAAAGCAGTGCCGAGTCCAGG - Intronic
1022442865 7:30448154-30448176 GGCCCAGGAGTTGAGAGTCCTGG - Intronic
1022848847 7:34239290-34239312 GGTCAAGGATATCAGAGTCATGG + Intergenic
1023963651 7:44949247-44949269 GGCCAAGGAGGGCAGATCACGGG - Intergenic
1024133597 7:46383659-46383681 GGCCAAAGAGAGGTGAGGCCAGG + Intergenic
1024840913 7:53586412-53586434 GCTAAAGAAGAGCAGAGTCCCGG - Intergenic
1026479203 7:70764026-70764048 CGCCAAGTAGAGCCGAGCCCTGG + Intronic
1026716532 7:72794178-72794200 GGTCAAGTAGAGCAGAGAGCAGG + Intronic
1028160099 7:87475693-87475715 GGCCGCGGCGAGCAAAGTCCAGG - Exonic
1029119417 7:98256942-98256964 GGCTCAGCAGAGCAGAGACCAGG - Intronic
1030203607 7:106930517-106930539 GGCTAAGAAGAGCAAAGGCCAGG - Intergenic
1032789543 7:135232304-135232326 GGCCCAGGAGAGAAAAGTCAGGG + Intronic
1033278660 7:139990687-139990709 GGGCAGGGAGAGCACAGTGCCGG - Intronic
1034189978 7:149206578-149206600 AGCCACGGAGAGCAAAGGCCGGG + Intronic
1034204323 7:149302457-149302479 GACCAGCGAGAGCAGAGGCCTGG - Intergenic
1034256691 7:149728631-149728653 GACCGAGGAGAGCAGAGCCCAGG + Exonic
1034345904 7:150384959-150384981 GACCGAGGAGGGCAGAGCCCAGG - Intronic
1034445161 7:151110401-151110423 GGACAAGCAGGGCAGAGGCCCGG + Intronic
1035043175 7:155945746-155945768 GGCCAAGGAAGCCAGAGTCAAGG - Intergenic
1035049142 7:155988490-155988512 GGCCAAGGAGAGCTCAGTGGTGG - Intergenic
1035253760 7:157613506-157613528 GGCCCAGGAGAGCAGGGTCCGGG + Intronic
1035362548 7:158322931-158322953 GGTCATGGAGACCAGAGACCTGG + Intronic
1035719364 8:1780095-1780117 TCCCAATGAGAGCAGAGCCCTGG + Intronic
1035883497 8:3267786-3267808 GACCAAGGGGTGCAGAGGCCGGG + Intronic
1036623950 8:10449852-10449874 GGCCAAGGTGGGCAGAGTTCAGG + Intergenic
1037121306 8:15290485-15290507 GCCCAAGGAGGGCACTGTCCTGG + Intergenic
1037401652 8:18500189-18500211 GGCCAAAGAAAGCAGACTCAAGG + Intergenic
1038433471 8:27518550-27518572 GGCCAAGGGGAGGAGAGACTGGG + Intronic
1039517549 8:38146273-38146295 GATCAAGGTGAGCAAAGTCCAGG - Exonic
1039776982 8:40746588-40746610 GGCCAAGGTGGGCAGAGGTCAGG - Intronic
1040908389 8:52492126-52492148 AGGCAAGGAGAACTGAGTCCTGG + Intergenic
1041594573 8:59633350-59633372 GACCAAGGGGAGCAGCATCCCGG - Intergenic
1043110363 8:76172012-76172034 GTCTTAGGAGAGCAGAGTCCAGG + Intergenic
1043970223 8:86520307-86520329 GGCCAAGGTGGGCAGATTACAGG + Intronic
1044265208 8:90173955-90173977 GGCCAAGGTGAGAAGATTGCTGG + Intergenic
1044665111 8:94626626-94626648 GGCCAAGGCGGGCAGAGCCCAGG + Intergenic
1045393880 8:101741131-101741153 GGCCAAGGAGAGGAGGCACCCGG + Intronic
1047717325 8:127607523-127607545 GGCCAAGGCGGGCAGAGGTCAGG - Intergenic
1048209934 8:132446414-132446436 AGCCAAGGAGAGCAGAGTCCGGG - Intronic
1048348842 8:133599569-133599591 GGACAGGGAGAGCTGACTCCAGG - Intergenic
1048375339 8:133818152-133818174 GGCCAGGGCGAGCTGAGACCAGG - Intergenic
1048986871 8:139739450-139739472 GGCCGAGGAGACCAGAGTTGGGG - Intronic
1049024846 8:139981234-139981256 GGCCAGGGAGTCCAGAGCCCAGG + Intronic
1049383837 8:142331056-142331078 GGGCAGGGTGAGCAGAGCCCAGG + Intronic
1049565415 8:143335464-143335486 TCCCAAGGAGACCAGAGACCAGG + Intronic
1049581899 8:143416223-143416245 GGCCAAGGCAAGCAGATTGCTGG - Intergenic
1049861679 8:144902766-144902788 GGCCAAGGAGACCGGAGGCATGG + Intergenic
1049893998 9:97015-97037 GGCCAAGAAGAGCAGGGACTTGG + Intergenic
1050009640 9:1172540-1172562 GGGCAGGGACAGCAAAGTCCAGG + Intergenic
1050143832 9:2544650-2544672 GGCCAAGGAAAGCTGAGTAAAGG + Intergenic
1052473179 9:28925580-28925602 ATACAAAGAGAGCAGAGTCCAGG - Intergenic
1053282949 9:36832895-36832917 TGCCACTGATAGCAGAGTCCTGG + Intergenic
1054693154 9:68334298-68334320 GGCCAAGAAGAGCAGGGACTTGG - Intronic
1054949752 9:70836533-70836555 GGCTAAGGAAGGCAGAGACCTGG - Intronic
1056543718 9:87595723-87595745 GGCCAAGGAGAGCAGAGGAGAGG - Intronic
1056790955 9:89625001-89625023 GCCCAAGGAGAGCAGAGGCAGGG + Intergenic
1056842402 9:90009124-90009146 GGCCCAGGAGAGGAGAATGCAGG - Intergenic
1057009631 9:91589890-91589912 GGCAAAGGACAGCTGAGTCAGGG + Intronic
1057307485 9:93920654-93920676 GGCTCAGGAGAGCGGAGGCCCGG + Intergenic
1057443561 9:95098591-95098613 GGCCAAGGCGAGCAGCGCCGTGG - Intergenic
1057761700 9:97879775-97879797 GGCCAAGAAGGGCAGATTGCTGG + Intergenic
1059277611 9:113109167-113109189 GGCCAAGGAGAGAAGGGCCAGGG + Intergenic
1059278640 9:113115384-113115406 GGCCAAGGAGAGAAGGGCCAGGG - Intergenic
1059723435 9:116983882-116983904 AGCCAAGGGCAGCTGAGTCCTGG + Intronic
1060149949 9:121282132-121282154 GGGGGAGGAGTGCAGAGTCCTGG + Intronic
1060809928 9:126605890-126605912 GGCCAAGGAGAACAGGGCCAGGG + Intergenic
1060929764 9:127481544-127481566 GGCCAAGGAGAGCAGCTTTGAGG + Intronic
1061147407 9:128808070-128808092 GGGCAAAGAGGGCAGAGTGCAGG - Exonic
1061177650 9:129007321-129007343 GGCCAATGAAAGCAGGGTCAAGG - Intronic
1061875398 9:133541024-133541046 GTCCAAGCACAGCAGAGTCTGGG + Intronic
1062037514 9:134389364-134389386 GGACAGGGACAGCAGAGGCCTGG + Intronic
1062072735 9:134566562-134566584 GGCCAAGGGGCCCAGAGGCCTGG - Intergenic
1062106511 9:134757878-134757900 GCTCCAGGAGAGCAGGGTCCCGG - Intronic
1062343779 9:136105429-136105451 GTCCAGGGAGAGCAGAGAGCAGG + Intergenic
1062353124 9:136148767-136148789 GGCCCAGATGAGCAGAGACCAGG + Intergenic
1062469577 9:136696686-136696708 GGCCTAGGAGACCCCAGTCCTGG - Intergenic
1203758549 Un_GL000218v1:159175-159197 AGCCAATGGAAGCAGAGTCCAGG - Intergenic
1185795955 X:2964550-2964572 GGCCAAGGAGGGCAGATCACTGG - Intronic
1185988663 X:4867079-4867101 GGCCAAGGTGGGCAGATTACTGG + Intergenic
1186744220 X:12549258-12549280 GGCCCAGGAAAGAAGAGTTCTGG - Intronic
1187018691 X:15357334-15357356 GCCCATGGAGGGCAGCGTCCTGG - Intronic
1187187168 X:16998007-16998029 GGCCAAGGTAAGCAGATTGCTGG + Intronic
1187893787 X:23962166-23962188 GGCCAAGGCAGGAAGAGTCCAGG - Intergenic
1189083544 X:37997643-37997665 GGCCAAGGACAGCTCAGTGCTGG + Intronic
1189179199 X:38987413-38987435 GGCCAGGGCGAGCACAGGCCTGG + Intergenic
1189261047 X:39679024-39679046 GGCCAACCAGGGCTGAGTCCTGG - Intergenic
1190059468 X:47201588-47201610 GCCCATGGAGATCAAAGTCCTGG + Exonic
1192333503 X:70199325-70199347 GGCTAAGGAGAGCACAGCCAAGG - Exonic
1192368296 X:70493450-70493472 GGCCCAGGAGAGCAGCATACAGG + Intronic
1192567142 X:72174363-72174385 GGCAGAGGAGAGCACATTCCAGG + Intergenic
1193149628 X:78111313-78111335 GGCCAAGGTGGGCGGGGTCCAGG - Intronic
1194632039 X:96296727-96296749 GACCATGGAGACCAGAGACCAGG + Intergenic
1195043200 X:101032850-101032872 GGCCTAGGATGGCAGACTCCAGG + Intronic
1195935168 X:110118525-110118547 GGCAAAGCAGAAAAGAGTCCTGG - Intronic
1197202883 X:123764065-123764087 GGCCAAGGTGGACAGAGGCCAGG + Intergenic
1197885160 X:131210671-131210693 GGAAGAGGAGAGCAGAGTCAAGG - Intergenic
1198118369 X:133566682-133566704 GGGGAAGGTGAGCAGAATCCAGG + Intronic
1198686690 X:139235181-139235203 GGCCAGGGACAGCAGTGCCCAGG + Intergenic
1199685925 X:150265608-150265630 GGCCAAAGGGTGCAGATTCCTGG - Intergenic
1201279804 Y:12331952-12331974 GGCCAAGGAGGGCAGATCACTGG + Intergenic
1201753046 Y:17455137-17455159 GGCCAAGGTGAGCAGATCACAGG + Intergenic