ID: 1157505473

View in Genome Browser
Species Human (GRCh38)
Location 18:48223161-48223183
Sequence CTGCAGAGGTAGTGGGAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 531
Summary {0: 1, 1: 0, 2: 2, 3: 106, 4: 422}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157505464_1157505473 14 Left 1157505464 18:48223124-48223146 CCTTAGGGAAGAGCTGGGGATGG 0: 1
1: 0
2: 3
3: 29
4: 327
Right 1157505473 18:48223161-48223183 CTGCAGAGGTAGTGGGAGATGGG 0: 1
1: 0
2: 2
3: 106
4: 422

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157505473 Original CRISPR CTGCAGAGGTAGTGGGAGAT GGG Intronic
900008237 1:79684-79706 CTGTAGAGGCAGTGGCAGAGGGG - Intergenic
900374400 1:2346911-2346933 CTTCAGGGCTAGTGGGAGCTGGG - Intronic
900483820 1:2912109-2912131 CTGCAGAGAAAATGGGAAATAGG - Intergenic
900741729 1:4334254-4334276 TTGGAGAGGTAGGGGGAGAAGGG + Intergenic
902295411 1:15463516-15463538 CTGCAGAGTAAGTGGGAGCCAGG + Exonic
902298303 1:15483394-15483416 CTGCAGAGTAAGTGGGAGCCAGG + Exonic
902404768 1:16176585-16176607 ATGCAGGGGCAGTGGGAGCTTGG - Intergenic
903258200 1:22116729-22116751 CTGCAGCGGGGGTGGGGGATAGG + Intergenic
903947283 1:26971878-26971900 CTGCAGAGCTGGTGTGGGATGGG + Intergenic
904585723 1:31579573-31579595 CTGCAGAGTCAGAGGGAGAAGGG + Intronic
904605073 1:31693661-31693683 CTGCAGAGCTTGTGAGTGATGGG - Intronic
904776089 1:32907615-32907637 CTGAAGAGGAAGTGGGAGTTGGG - Intergenic
905417608 1:37815161-37815183 CTGCAGGGGGAGGAGGAGATGGG - Exonic
906528230 1:46508819-46508841 CTGCAGGGGTGGTGGGGGGTGGG - Intronic
906594458 1:47062662-47062684 CTGCAGCTGTTGTGGGGGATGGG - Intergenic
906775988 1:48530027-48530049 ATTTAGAGGTAGTGGGGGATAGG - Intergenic
908090243 1:60678043-60678065 CTTCATAGGTGGTGGGAGATGGG - Intergenic
908398076 1:63744657-63744679 TGGCAGAGGTAGTGGTATATCGG + Intergenic
908679803 1:66648094-66648116 CTTCAGAGTTAGTGTGAGTTTGG + Intronic
908815173 1:68024343-68024365 GTACAGAGGTAGTGGGTGTTGGG + Intergenic
910812649 1:91253809-91253831 CTGCAGAGGCAATGGCAGAGAGG - Intergenic
911096610 1:94060315-94060337 CTGGGCAGGAAGTGGGAGATGGG + Intronic
912968918 1:114262003-114262025 GTGCAGAGGTAGAGGTAGGTAGG - Intergenic
913246384 1:116873865-116873887 CTGCATATGTAGTGGGTTATGGG - Intergenic
913410193 1:118542597-118542619 CTGCAGAGGCAGTGGCAGAGAGG - Intergenic
913606181 1:120468639-120468661 ATGCAGAATTACTGGGAGATGGG - Intergenic
915464617 1:156089645-156089667 CTACAGAGGTTGGGGGAGAGAGG + Intronic
915534350 1:156526041-156526063 CTGCTGATGCAGTGGGAGGTAGG + Exonic
916268655 1:162917839-162917861 CTGCAGTGGCAGTGGCAGAGGGG + Intergenic
916568909 1:166008217-166008239 CTGCAGGGGCAGTGGCAGAGAGG + Intergenic
916757270 1:167784673-167784695 CTGCAGATGTAGGTTGAGATTGG - Intronic
917149393 1:171928675-171928697 CTGCAGAGGCAGTGGCAGAGAGG + Intronic
919773413 1:201177420-201177442 CAGCAGATGGAGGGGGAGATAGG + Intergenic
919910061 1:202105779-202105801 TTTCAGAGGGAGTGGGAGGTGGG + Intergenic
920161834 1:204004539-204004561 CTGCAGAGGTGGTGTAGGATGGG + Intergenic
920555404 1:206900542-206900564 GTGCAGTGGTACTGGGAGATGGG + Intronic
920823784 1:209405251-209405273 GTGGAGTGGTAGTGGGAGAGGGG + Intergenic
921012959 1:211161267-211161289 CTACAGAGGCAGTGGCAGAGAGG + Intergenic
922443759 1:225678907-225678929 GTTCAGAGGTAATGGGGGATTGG + Intergenic
922663698 1:227451455-227451477 CTGCAGAGGTGGTGGGTACTTGG + Intergenic
922740460 1:228011369-228011391 CTGCAGAGGGAGTGGGCCAGTGG - Intronic
922768078 1:228166247-228166269 CTGCAGAGGGCGTGGGGGGTGGG + Intronic
923240726 1:232082958-232082980 CTGCAGATGTGCTGGGAGAATGG + Intergenic
1063721037 10:8581721-8581743 CTGCAGAGATTTTGGAAGATTGG + Intergenic
1064996326 10:21299812-21299834 CTGCAGGGTGAGTGGGAGACAGG + Intergenic
1065359095 10:24872282-24872304 GTGCAGGGGGAGTGGGAGAGAGG + Intronic
1065619516 10:27566174-27566196 ATGTGGAGGTGGTGGGAGATGGG - Intergenic
1068832148 10:61507589-61507611 CAGAAGAGGTAGTGGGAGGCAGG + Intergenic
1069780966 10:70955065-70955087 GTCCAGAGCTAGTGGGAGAAAGG + Intergenic
1070870589 10:79748281-79748303 CTGCAGAGACAGTGGCAGAGAGG - Intergenic
1071023191 10:81082846-81082868 CTGCAGTGGCAGTGGCAGAGGGG + Intergenic
1071637507 10:87270493-87270515 CTGCAGAGACAGTGGCAGAGAGG - Intergenic
1071657738 10:87467458-87467480 CTGCAGAGACAGTGGCAGAGAGG + Intergenic
1072344481 10:94489761-94489783 CTGAAGAGATAGAGAGAGATGGG + Intronic
1072811173 10:98463264-98463286 CTGGAGAGGTAGCTGGAGCTGGG - Intronic
1073828464 10:107354710-107354732 CTGCTGTGGTAGTGGCAGGTTGG - Intergenic
1074291077 10:112138426-112138448 CAGGAGGGGTAGTGTGAGATTGG - Intergenic
1074460783 10:113635236-113635258 CTGCAGAGGGAATGGGAACTTGG + Intronic
1074985817 10:118658697-118658719 CTGCAGCTGCTGTGGGAGATGGG + Intergenic
1075893827 10:125977912-125977934 CTGCTGAGATAGTGGCAGAGAGG + Intronic
1076138746 10:128063275-128063297 CTGCAGTGATAGTGGGAGGAAGG - Intronic
1077186315 11:1236902-1236924 CTGCAGAGGCAGCGAGAGAGTGG - Intronic
1077442207 11:2574151-2574173 CTGCAGCTGTGGGGGGAGATGGG - Intronic
1078294825 11:10057316-10057338 TTGCAGAGGTAGTGGCAGAGAGG - Intronic
1078644601 11:13128895-13128917 CTCCTGAGGTGGTGGGAGGTGGG - Intergenic
1078850682 11:15160283-15160305 GTGAAGAGGAAGTGGGAGAGAGG + Intronic
1078993278 11:16670460-16670482 CTGCAGAGGCAGTGGCAGAGAGG - Intronic
1079871970 11:25808982-25809004 CACCAGAGGAAGGGGGAGATGGG + Intergenic
1082615760 11:55357246-55357268 CTGCAGTGGCAGTGGGAGAGAGG - Intergenic
1083312086 11:61789088-61789110 CTGCAGGGGTGGTGGGTGCTGGG - Exonic
1083771865 11:64872041-64872063 AAGCAGAGGGAGTGGGAGGTGGG + Intronic
1085510916 11:77087822-77087844 CTGCAGAGTCAATAGGAGATGGG - Intronic
1085518015 11:77122551-77122573 AGGGAGAGGGAGTGGGAGATGGG - Intronic
1086871618 11:92044412-92044434 CTGGAGAGGATGTGGGAAATAGG + Intergenic
1087655839 11:100921982-100922004 GTGCAGAGGTGGTGGGGGACAGG + Intronic
1089206190 11:116765192-116765214 CTTCAGAGGTAGTAAGACATAGG - Intronic
1089459461 11:118644145-118644167 CTGCAGAGCTAGTTGGCGCTTGG - Exonic
1091331371 11:134733660-134733682 ATGCAGATGTAGTGGCAGAAGGG - Intergenic
1091650960 12:2309345-2309367 GGGAAGAGGTAATGGGAGATGGG + Intronic
1091911988 12:4240270-4240292 CTGCAGTGATAGTGGCAGGTTGG + Intergenic
1092047573 12:5442992-5443014 CTACAGAGGTTTTGGGAGTTTGG + Intronic
1092063845 12:5573121-5573143 CTGCAGTGGAACTGGGAGGTGGG + Intronic
1092441420 12:8508490-8508512 CTGCAGTGGTAGTGGCAGAGGGG + Intergenic
1092579339 12:9821319-9821341 CTGCAGAGGCAGTGGCAGATGGG - Intergenic
1092587883 12:9919512-9919534 GTGCAGAGGCAGTGGCAGAGAGG + Intronic
1093690194 12:22101611-22101633 CTGCAGAGGCAGTGGCAGAGAGG + Intronic
1094675604 12:32617111-32617133 ATGCAGAAGTGTTGGGAGATGGG - Intronic
1095835908 12:46638351-46638373 CTGCAGAGGCAGTGGCAGAGAGG - Intergenic
1096277502 12:50222651-50222673 CGGCAGAGGGAGAGGGAGAGGGG + Intronic
1096526210 12:52211837-52211859 CTGCAGAGGGAGGAGGGGATGGG + Intergenic
1096947203 12:55420131-55420153 CTGCAGAGTTTGGGGGAAATGGG + Intergenic
1097379940 12:58882735-58882757 CTGCTGAGGTAGAGGAAAATGGG - Intronic
1098128474 12:67323560-67323582 CTGCAGAAGCAGTGGCAGAGAGG - Intergenic
1098245826 12:68516827-68516849 CTGCAGAGGTAGAGTGGGGTCGG - Intergenic
1099439430 12:82683671-82683693 ATTCAGAGGTATTGGGAGGTGGG + Intergenic
1099719508 12:86342426-86342448 CTGCATAGGCAGTGGCAGAGAGG - Intronic
1100295698 12:93258859-93258881 GTGAAGAGGAAGTGAGAGATAGG + Intergenic
1100690614 12:97035089-97035111 CTGCCGAAGTAGTGAGAGGTAGG + Intergenic
1101529326 12:105559796-105559818 CAGCAGAGGATGTGGGAGAAAGG + Intergenic
1101579550 12:106030674-106030696 TTTCAGAGGAAGTGGGAGATGGG - Intergenic
1101683947 12:106998297-106998319 CTGCAGTGTTACTGGGAGAATGG + Intronic
1101998576 12:109542509-109542531 ATGCTGAGGTAGTGGGGGTTAGG - Intergenic
1102014213 12:109637199-109637221 ATTCATAGGTAGCGGGAGATAGG + Intergenic
1102658335 12:114502639-114502661 GTGCAGTGGCAGAGGGAGATTGG + Intergenic
1103612469 12:122132376-122132398 CTGCACAGGTAGAGGAAGCTGGG + Exonic
1103932827 12:124459615-124459637 TTGCAGAGGTCATGGGAGTTTGG - Intronic
1103975041 12:124696965-124696987 CAGCAGAGGCACTGGGAGATCGG - Intergenic
1106285004 13:28310660-28310682 CTGCAGAGGGAATTGGAGAAGGG - Intronic
1106513224 13:30429543-30429565 CTGGAGAGGCGGTGGGGGATGGG - Intergenic
1106679972 13:31999475-31999497 CTGGAGAGGGAGAGGGAGACGGG - Intergenic
1107175578 13:37394862-37394884 CTGCAGCTGCAGTGGGAGAGAGG - Intergenic
1107935410 13:45341523-45341545 CTGGAGAGGTGCTGGGAGCTGGG + Intergenic
1108200252 13:48036267-48036289 ATGCTGAGGTACTGGGGGATAGG + Intergenic
1110035028 13:70672592-70672614 CTGCAGAGGCAGTGGCAAAGAGG + Intergenic
1110410183 13:75196172-75196194 GTGCAGAGGTAGTGGGAAAGAGG - Intergenic
1112456536 13:99568285-99568307 CTTCAGAAGTACTGGGAGTTAGG + Intergenic
1112738082 13:102443454-102443476 CTGCAGCTGCTGTGGGAGATGGG - Intergenic
1113149931 13:107252118-107252140 CTGGCGAGGTAGTGGGAGGTGGG + Intronic
1113226931 13:108169257-108169279 CAGCAGAGGCAGTGGCAGAGAGG - Intergenic
1114059009 14:19001989-19002011 CTGCAAAGGCAGTGGCAGAAAGG - Intergenic
1114103534 14:19399765-19399787 CTGCAAAGGCAGTGGCAGAAAGG + Intergenic
1114278707 14:21170278-21170300 CTGCAGAGGCACTGGCAGAGGGG - Intergenic
1114453354 14:22840484-22840506 CAACAGAGGAAGTGGGACATAGG - Intronic
1114988888 14:28263358-28263380 CAGCAGAGGCAGTGGCAGAGAGG - Intergenic
1118666417 14:68075344-68075366 CTGCAGTGGTACTGGCAGAGGGG + Intronic
1120264212 14:82228806-82228828 CAGCAGAGGTAATAGGAGAAAGG - Intergenic
1121176313 14:91893068-91893090 CTGGAGTGGTAGGGGGAGACCGG - Intronic
1123496808 15:20834639-20834661 CTGCAGAGGCAGTGGCAGAGAGG + Intergenic
1123554040 15:21408231-21408253 CTGCAGAGGCAGTGGCAGAGAGG + Intergenic
1123590287 15:21845596-21845618 CTGCAGAGGCAGTGGCAGAGAGG + Intergenic
1123984457 15:25632848-25632870 CTGCAGAGGGAGAGGCAGAGTGG + Intergenic
1126225212 15:46262116-46262138 CTGCAGAGGCAGTGGCAGAGAGG + Intergenic
1127628386 15:60802467-60802489 CTGCAGGGGAAGAGAGAGATGGG - Intronic
1128154970 15:65386305-65386327 CTACAGAGGAAGTGGGAGTGAGG + Intronic
1128565447 15:68697952-68697974 CTGCTGAGGTGCTGGGAGAGTGG + Intronic
1128568138 15:68714656-68714678 CTGGAAAGGTAGTAGGAGGTGGG + Exonic
1129060648 15:72857944-72857966 CTGCGGTGGTATTGGGAGGTGGG + Intergenic
1129249171 15:74299137-74299159 CTGCAGAGGTGTTGTGAGCTGGG + Intronic
1129584541 15:76849266-76849288 TGGCAGAGGTAGTGGTAGAGAGG - Intronic
1130786627 15:87104584-87104606 CAGCAGTGGTGGTGGTAGATGGG - Intergenic
1131166536 15:90145736-90145758 CTGGAGAGGCACTGGGAGTTGGG + Intergenic
1131261664 15:90890977-90890999 CTGCAGCGGTGGAGGGAGCTGGG - Exonic
1131691696 15:94834271-94834293 CTGCTGAGGATGTGGGACATTGG - Intergenic
1131770731 15:95734737-95734759 CTGCACAGGAAGAGGGAGACAGG + Intergenic
1132445318 15:101912426-101912448 CTGTAGAGGCAGTGGCAGAGGGG + Intergenic
1202962388 15_KI270727v1_random:135427-135449 CTGCAGAGGCAGTGGCAGAGAGG + Intergenic
1132866278 16:2094151-2094173 CTGCAGAGGCTGGGGGAGCTGGG - Exonic
1133125903 16:3645891-3645913 CTGCTCAGGTTGTGGGACATGGG + Intronic
1134768737 16:16785421-16785443 GTGTAGAGGTATTGGGAGGTGGG + Intergenic
1136062375 16:27735402-27735424 TTAAAGAGGTAGTGGGTGATGGG - Intronic
1136402886 16:30028161-30028183 CAGCAGAGGTGATGGGAGATGGG + Intronic
1137502942 16:49025247-49025269 ATTCACAGGCAGTGGGAGATGGG - Intergenic
1138276309 16:55737375-55737397 CTGAAGAGGTAATGGGAAGTGGG + Intergenic
1138351878 16:56350374-56350396 CTGCACAGGGAGTGGGAGGAAGG - Intronic
1138520292 16:57567242-57567264 GTGCATAGGGAGTGGGAGAAGGG + Intronic
1139061893 16:63263238-63263260 CTGCAGTGGCAGTGGCAGAGGGG + Intergenic
1139237283 16:65353064-65353086 CTGCAGAGGAAGTAGGGGGTGGG + Intergenic
1139466083 16:67154960-67154982 CTGCAGAGGGAGTGGGGAAACGG + Intronic
1140447217 16:75039889-75039911 CTCCAGATGTTGTGGGATATTGG + Intronic
1141114040 16:81293257-81293279 CTGGAGAGCTCCTGGGAGATGGG + Intergenic
1141544548 16:84756099-84756121 CTGAAGGGGTGTTGGGAGATGGG - Intronic
1141551152 16:84807537-84807559 GTGAAGAGGAAGTCGGAGATTGG + Intergenic
1143706161 17:8698956-8698978 CAGCAGAGGTGGTGGGAGTGGGG + Intergenic
1144465540 17:15493810-15493832 CTGCAGAGGGAGAGAGAGAGAGG - Intronic
1145017364 17:19408084-19408106 CTGGGGAGGCAGTGGGACATGGG - Intergenic
1145351861 17:22090691-22090713 CTGCGGGGGAAGTGGGAGACAGG - Intergenic
1146522935 17:33540372-33540394 CAGCATAGGTAGTAGGAGTTAGG + Intronic
1146665428 17:34699500-34699522 CTGGAGAGGCAGAGGGAGAAAGG - Intergenic
1146751897 17:35389475-35389497 CTGCAGAGGCAGTGGCAGAGGGG + Intergenic
1147385529 17:40079146-40079168 CTGGGGGGGTAGTGGGAGCTGGG + Intronic
1147429661 17:40363583-40363605 CAGAAGCGGTAGTGGGAGACCGG + Exonic
1148085929 17:44993849-44993871 CTGCAGTGCTGGTGGGAGCTGGG - Intergenic
1148086144 17:44994990-44995012 CTGCAGAGGAAGGAGGAGAGGGG + Intergenic
1148451822 17:47783543-47783565 CTGGAGAGGCGGTGGGAGAGAGG - Intergenic
1148678928 17:49461926-49461948 CTGCAGAGTGAGTGCAAGATAGG - Intronic
1149063870 17:52457352-52457374 CTGCTGAGGTTGTGGGAAAATGG + Intergenic
1150470915 17:65436920-65436942 CTGCAGCTGTAGTTGGAGAGAGG - Intergenic
1150665102 17:67127114-67127136 GGGTGGAGGTAGTGGGAGATTGG - Intronic
1151626282 17:75277818-75277840 AGGCAGGGGGAGTGGGAGATGGG - Intronic
1152013326 17:77734408-77734430 CTGGGGAGGTGGTGGGAGATGGG - Intergenic
1153231862 18:2945534-2945556 CAGCAGATTGAGTGGGAGATGGG - Intronic
1153980349 18:10303428-10303450 CTGCAGAAGTAGAGAGAAATGGG - Intergenic
1154181363 18:12142487-12142509 CTGCAGAGGCAGTGGCAGAGAGG + Intergenic
1154181651 18:12144151-12144173 CTGTAGAGGCAGTGGCAGAGAGG + Intergenic
1154182253 18:12147433-12147455 CTGTAGAGGCAGTGGCAGAGAGG - Intergenic
1154182541 18:12149097-12149119 CTGCAGAGGCAGTGGCAGAGAGG - Intergenic
1154315268 18:13299105-13299127 CTGCCCAGTTAGTGTGAGATCGG + Intronic
1154454711 18:14510323-14510345 CTGCAGAGGCAGTGGCAGAGAGG + Intronic
1155577016 18:27259270-27259292 CTGCAGAGGCAGTGGCAGAAAGG + Intergenic
1155768977 18:29672866-29672888 CTGCAAAGGTAGTGGCAGAAGGG - Intergenic
1157381849 18:47225777-47225799 GTGCAGAGGTGGAGGGAGAGGGG + Intronic
1157505473 18:48223161-48223183 CTGCAGAGGTAGTGGGAGATGGG + Intronic
1157807533 18:50669178-50669200 CTGCAGAGGAAGCGGTAGAAAGG - Intronic
1158377202 18:56884612-56884634 CTGCAGCCGTGGTGGGGGATGGG - Intronic
1160251245 18:77205046-77205068 GTGCAGAGGGAGAGGAAGATGGG - Intergenic
1160639991 19:121281-121303 CTGTAGAGGCAGTGGCAGAGGGG - Intergenic
1160784844 19:895293-895315 ATTCTGAGGTAGTGGGAGTTAGG - Intergenic
1160969227 19:1760026-1760048 GTGCAGAGGGGGAGGGAGATGGG + Intronic
1163496635 19:17649720-17649742 CTTCTGAGGTAGTGGGGGTTAGG - Intronic
1164330460 19:24249636-24249658 CTGGAGAGGATGTGGGAAATAGG + Intergenic
1165247122 19:34504229-34504251 CTGCAGAGAGAGAGGGAGAGAGG + Exonic
1165293548 19:34907843-34907865 CTGCAGAAGCAGTGGTAGGTGGG - Intergenic
1165740626 19:38203294-38203316 CTGCAGCTGCAGAGGGAGATGGG - Intronic
1165902847 19:39176775-39176797 CTGCAGCGCTGGCGGGAGATGGG + Intronic
1166299261 19:41904926-41904948 CTGCAGGGAGAGGGGGAGATGGG - Intronic
1166761635 19:45227959-45227981 CTGCAGAGGTAGGGGAACCTGGG - Exonic
1166911695 19:46163617-46163639 CTGCAGAGGCAGTGGCAGAGGGG + Intergenic
1167012182 19:46815962-46815984 CTGAAGAGGTAGGTTGAGATGGG + Intergenic
1168291952 19:55361435-55361457 CTGCAGAGATAGAGGGAGGCAGG + Intronic
925646945 2:6045223-6045245 CTGCAGAGGCAGTGGCAGAGGGG - Intergenic
925705548 2:6681531-6681553 CTGCGGCTGTTGTGGGAGATGGG - Intergenic
925788156 2:7453059-7453081 CTCCAGAGGTTGTAGGAGAAGGG - Intergenic
928217456 2:29373826-29373848 CTGTAGAGGTAGTTGGAGGCAGG - Intronic
930116782 2:47724969-47724991 TTGCAGGAATAGTGGGAGATAGG + Intronic
930229447 2:48828048-48828070 CTGCAGAGGCAGTGGTAGAGAGG - Intergenic
930839147 2:55826134-55826156 CTGCAGTGGCAGTGGCAGAGGGG - Intergenic
930939513 2:56997532-56997554 CTGAAGAGGTAGTGGCAAAGAGG + Intergenic
931251052 2:60530817-60530839 CAGGAGGGGTAGTGGGAGGTGGG - Intronic
931424338 2:62157307-62157329 CTGCAGAGGTGGTGAGTGATAGG - Intergenic
931543390 2:63354035-63354057 CTGTAGAGGCAGTGGCAGAGAGG - Intronic
933107504 2:78350549-78350571 CTGAAGAGATAGTTGGAGGTGGG + Intergenic
934623213 2:95829035-95829057 CTGCAGAAGCAGTGGCAGAGAGG + Intergenic
934810553 2:97273058-97273080 CTGCAGAAGCAGTGGCAGAGAGG - Intergenic
934827139 2:97434881-97434903 CTGCAGAAGCAGTGGCAGAGAGG + Intergenic
934940794 2:98500542-98500564 TTGCAGTGGTGGGGGGAGATTGG + Intronic
936274883 2:111086759-111086781 AAGCAGAGGTAGTGAGAGAAGGG - Intronic
936561568 2:113543056-113543078 CTACCGAGGTCGTGGGAGAAGGG - Intergenic
937521007 2:122712255-122712277 CTGCAGAGGCAGTGACAGAGAGG - Intergenic
938282181 2:130072241-130072263 CTGCAGAGGCAGTGGCAGAAAGG + Intergenic
938332808 2:130460813-130460835 CTGCAGAGGCAGTGGCAGAAAGG + Exonic
938357000 2:130659858-130659880 CTGCAGAGGCAGTGGCAGAAAGG - Intergenic
938433436 2:131266664-131266686 CTGCAGAGGCAGTGGCAGAAAGG - Intronic
938477477 2:131629247-131629269 CTGCAGAGGCAGTGGCAGAAAGG - Intergenic
939389849 2:141552986-141553008 ATGGAGAGGTAGTGGGAGAAGGG + Intronic
939655301 2:144817173-144817195 ATGCTGAGGTACTGGGAGTTAGG + Intergenic
939936931 2:148304612-148304634 CTGCAGTGGGAGAGAGAGATTGG + Intronic
940446697 2:153785566-153785588 CTGCAGTGGCAGTGGCAGAGGGG + Intergenic
940446918 2:153786757-153786779 CTGCAGTGGCAGTGGCAGAGGGG - Intergenic
944294671 2:198048828-198048850 GTGCAGTGGTAATGGGAGGTGGG - Intronic
945016295 2:205520420-205520442 CTGCAGAGGCAGTGGCAGAGAGG + Intronic
945196895 2:207245333-207245355 CTGAAGAGGGAGTGGGAGTTAGG - Intergenic
945696564 2:213113941-213113963 TTGCAGTTGCAGTGGGAGATAGG - Intronic
946349936 2:219143619-219143641 CTGGAAAGGAAGTGAGAGATAGG - Intronic
947667879 2:231918609-231918631 CTGCAAGGGTGGTGGGAGATAGG - Intergenic
947962682 2:234252835-234252857 GTGCAGAGGGAATGGGAGGTAGG - Intergenic
948319265 2:237056537-237056559 CTGCAGAGGGAGGGGGCTATTGG + Intergenic
948612970 2:239181240-239181262 CTGCAGAGGTGGCAGGAGGTAGG + Intronic
1169974006 20:11302857-11302879 ATGCAGAGGAAGTTGGTGATGGG + Intergenic
1170005018 20:11658174-11658196 TACCAGAGGTAGGGGGAGATAGG + Intergenic
1170310547 20:14986705-14986727 CTTAATAGGTAGTGGGCGATGGG + Intronic
1170494853 20:16914886-16914908 CCACAGAGGTAGTGGGAGCTGGG + Intergenic
1170863158 20:20127862-20127884 CTGCAGCTGCTGTGGGAGATGGG + Intronic
1172271530 20:33658108-33658130 CTCCAGAGGCAGTGTGAGAAGGG - Intronic
1173527511 20:43744296-43744318 CTGCAGAGGCAGTGGGGACTGGG + Intergenic
1175367834 20:58467659-58467681 CTGCAGGGGTGGAAGGAGATGGG + Intronic
1175813544 20:61872013-61872035 CTGCAGAGGGAGGGCGAGGTGGG + Intronic
1176819453 21:13642985-13643007 CTGCAGAGGCAGTGGCAGAGAGG - Intergenic
1177275418 21:18906660-18906682 CTGCAGGGGGAGAGGGAGAGTGG + Intergenic
1178258806 21:31079863-31079885 TTTCAGATGTAGTGGGAGCTGGG - Intergenic
1178366856 21:31995572-31995594 CTGCCCAGGCAGAGGGAGATGGG + Intronic
1179311366 21:40198742-40198764 CTGGAGAGGCAGTGGGAGGTGGG + Intronic
1179478111 21:41660731-41660753 CTACAGAGGTTGTGGGGGACAGG - Intergenic
1180477493 22:15724605-15724627 CTGCAAAGGCAGTGGCAGAAAGG - Intergenic
1181171751 22:21014008-21014030 CCGCAGGGGTTGTGGGAGGTGGG - Intronic
1181324682 22:22035879-22035901 CTGGAGAGGAGGTGTGAGATGGG - Intergenic
1181662103 22:24359183-24359205 CTGAGAAGGGAGTGGGAGATAGG - Intronic
1181770273 22:25120146-25120168 TGGCACAGGCAGTGGGAGATGGG - Intronic
1181778597 22:25177420-25177442 CGCCGGAGGGAGTGGGAGATGGG - Exonic
1181886109 22:26023584-26023606 CAGCAGTGGCAGTGGGAGCTAGG + Intronic
1181899569 22:26142055-26142077 CTCCAGAGGGACTGAGAGATGGG + Intergenic
1181944909 22:26509038-26509060 CTGCACAGGTAGTGGAGGACTGG - Intronic
1182927102 22:34135308-34135330 ATGCTGAGGTATTGGGAGTTAGG + Intergenic
1183030766 22:35102839-35102861 TTGCAGAGGTGGAGGGAGAAGGG - Intergenic
1183041717 22:35184901-35184923 CTGCAGAGGCAGTGGTGGAGAGG - Intergenic
1183243306 22:36674252-36674274 ATGCTGAGGAAGTGGGAGGTGGG - Intronic
1183284768 22:36954878-36954900 GTGCAGGGGAAGTGGGGGATGGG - Intergenic
1183523361 22:38309380-38309402 CTGGGGAGGTAGTGGTAGACAGG + Intronic
1185021565 22:48379707-48379729 CTTCAGAGGAAGTGGCAGAGTGG + Intergenic
949243797 3:1901694-1901716 ATGCAAAGGCAGTGGGATATAGG - Intergenic
949595803 3:5546174-5546196 CTGTTGTGGTATTGGGAGATGGG - Intergenic
950012974 3:9736389-9736411 TGGGAGAGGAAGTGGGAGATGGG - Intronic
950601005 3:14035470-14035492 CTGCAGAAGCAGTGGCAGAAAGG + Intronic
951197064 3:19836196-19836218 CTGCAGAGGCAGTGGCAGAGAGG - Intergenic
951283412 3:20780011-20780033 CTGCAGAGGCAGTGGCAGAGAGG - Intergenic
953185298 3:40631789-40631811 CTGCAGCTGCTGTGGGAGATGGG - Intergenic
954583483 3:51716150-51716172 CCACAGAGGTCGGGGGAGATGGG + Intronic
954865185 3:53722940-53722962 CTGGAGAGGTAGAGGGAAACGGG - Intronic
955864944 3:63372395-63372417 CTGCAGTGGCAGTGGCAGAGGGG - Intronic
956890081 3:73604732-73604754 CTGGAGAGAAAGAGGGAGATAGG + Intronic
959488356 3:106955677-106955699 TTGCAGAGTTAGTGGAAGCTAGG - Intergenic
959520202 3:107316601-107316623 CTGCAGAGGCAGTGGCAGAGAGG + Intergenic
960699703 3:120428057-120428079 CTTCTGAGGTAGAGGGAGACAGG + Intronic
962000406 3:131289350-131289372 ATTCAGAGGTAATGGGAGTTAGG + Intronic
963053027 3:141158502-141158524 CTGCAGAGGCAGTGGCAGAGAGG - Intergenic
964553269 3:157908954-157908976 TTGCAGAGGGACTAGGAGATTGG - Intergenic
965317809 3:167212400-167212422 CTGCAGAGGCAGTGGCAGAGAGG - Intergenic
965811025 3:172592039-172592061 CTACAGAGGCAGTGGCAGAGAGG + Intergenic
966152355 3:176878133-176878155 CTGCACAGGCAGTGGCAGAGGGG - Intergenic
966510622 3:180758224-180758246 AGGCAGTGCTAGTGGGAGATAGG - Intronic
968651450 4:1761763-1761785 ATGCAGAGGTGGGGGGAGCTTGG + Intergenic
969300924 4:6296433-6296455 CTGCAGAGGTTCTGAGACATGGG + Intronic
969643554 4:8413175-8413197 GTGCAGGGGTGGAGGGAGATGGG - Intronic
969677858 4:8624653-8624675 CTGCAGAGGCAGTGAGAGAGTGG - Intergenic
969678813 4:8630289-8630311 CTGCAGAGGCAGTGAGAGAGTGG - Intergenic
969679769 4:8635939-8635961 CTGCAGAGGCAGTGAGAGAGTGG - Intergenic
969939982 4:10722376-10722398 CAGCTGAGCTAGCGGGAGATGGG - Intergenic
970691005 4:18620682-18620704 ATGCAGTGGTATTTGGAGATGGG + Intergenic
971106013 4:23524807-23524829 CTGCAGAGGCAGTGGCAAAGAGG - Intergenic
971605311 4:28651224-28651246 CTGCAGAGGCAGTGACAGAGGGG + Intergenic
972761821 4:42113782-42113804 CTGTAGAGTTAGTGGGTGATCGG - Exonic
973976058 4:56263666-56263688 ATTCAGAGGTACTGGGAGTTAGG + Intronic
974023306 4:56711035-56711057 CCGCAGAGGTGATGGGAGCTGGG + Intergenic
974109542 4:57510900-57510922 CTGCAGAGATGGTGGCAGAGAGG + Intergenic
974184602 4:58430231-58430253 CTGCAGAGGCAGTGACAGAGAGG + Intergenic
975106174 4:70571531-70571553 TTGCAGAGGCAGTGGCAGAGAGG + Intergenic
975404127 4:73969366-73969388 CTGCAGTGGCAGTGGTAGAGGGG - Intergenic
976627884 4:87206590-87206612 CTGTAGAAATGGTGGGAGATGGG + Intronic
976954662 4:90880556-90880578 CTGCAGAGGCAGTGGCAGAGAGG + Intronic
977006268 4:91571997-91572019 CAGCAGAGGCAGTGGCAGAGAGG + Intronic
977649529 4:99454034-99454056 CTGCAGAGGCAGTGGTAGAAAGG + Intergenic
977819853 4:101458734-101458756 CTGCAGAGGCACTGGCAGAGAGG - Intronic
978043046 4:104093000-104093022 CTGCAGAGGCAATGGCAGAAAGG - Intergenic
978208243 4:106105063-106105085 CTGCAGAGACAGTGGCAGAGAGG - Intronic
978557490 4:109996746-109996768 ATGCAGAGGAAGTGAGAGTTGGG + Intronic
978683730 4:111414802-111414824 ATGCAGAGGCAGTGGCAGAGAGG + Intergenic
979013098 4:115396199-115396221 CTGCAGAGGAAGTGGCAGAGAGG + Intergenic
979371656 4:119895585-119895607 CTGCTGTGTTACTGGGAGATGGG - Intergenic
980390139 4:132134236-132134258 CTGGAGAGGATGTGGGAAATAGG + Intergenic
981337279 4:143581569-143581591 CTGCAGTGGCAGTGGCAGAGGGG - Intronic
981606419 4:146545823-146545845 CTACAGAGGCAGTGTGAGAGGGG + Intergenic
982646211 4:158027422-158027444 CTGCAGAGACAGTGGCAGAGAGG - Intergenic
982957580 4:161791924-161791946 CCGCAGAGCCAGTGGGAGCTGGG + Intronic
983628446 4:169826353-169826375 CTGCAGTGGTAGTGGCAGAGGGG - Intergenic
984356764 4:178669998-178670020 CTTCTGAGGTACTGGGAGTTAGG + Intergenic
984466003 4:180101024-180101046 CTGCAGTGGTGGTGGCAGAGGGG + Intergenic
984883995 4:184433772-184433794 CTGCCCAGGGCGTGGGAGATGGG - Intronic
985425148 4:189822721-189822743 TTGCAGAGGAAGTGGGAGCTTGG - Intergenic
986233444 5:5886646-5886668 CTGCAGAGGGTGTGGGAGAGAGG - Intergenic
986255354 5:6098415-6098437 ATGCAGTAGTATTGGGAGATGGG - Intergenic
986806776 5:11314772-11314794 CTTCAGGGGTAGTGGGAGCCAGG - Intronic
987172274 5:15271121-15271143 CTGCAGAGCTAGAGTGAGAAAGG - Intergenic
987518489 5:18947144-18947166 CTGCAGTGGCAGTAGCAGATTGG - Intergenic
987644329 5:20648929-20648951 CTGCAGAGGCAGTGGCAGAGGGG - Intergenic
988936014 5:36083490-36083512 CTGCAGAGGCAGTGGCAGAGAGG - Intergenic
989009963 5:36858967-36858989 CAGAAGAGGTAGTGTCAGATTGG + Intergenic
989370325 5:40700368-40700390 CTGCAGAGGCAGTGGCAGAGAGG - Intergenic
989667639 5:43874633-43874655 CGGCAGAGGTGGGTGGAGATAGG + Intergenic
990013406 5:51027488-51027510 CTGCAGAGGAAGCTTGAGATGGG + Intergenic
990098459 5:52151383-52151405 CTGCAGTGGTAGTCGGAGTTAGG + Intergenic
991328098 5:65460752-65460774 CTGCAGAGGTATTCAGAGGTTGG - Intronic
991613792 5:68475468-68475490 CTCCAGAGGTAGGGGAAGAAAGG - Intergenic
992350153 5:75920621-75920643 CTGCATAGGGAGTGGGTGGTGGG + Intergenic
992679556 5:79140511-79140533 GTGCAGCGGTCGTGGGAGGTAGG + Intronic
992696308 5:79291742-79291764 GTACAGAGGTGGTGGGAGATGGG - Intronic
993351261 5:86853238-86853260 CTGCAGAGGCAGTGGCAGAGAGG + Intergenic
993450847 5:88070517-88070539 CTGCAGAAGTAGTGGCAGAGAGG - Intergenic
993704849 5:91158210-91158232 CTGCAGATGTAAGGAGAGATTGG - Intronic
994103241 5:95916799-95916821 CCTCAGAGGAAGTGGGAGAGAGG + Intronic
994897306 5:105722151-105722173 CTGCAGAGGCAGTGGTAGAGAGG - Intergenic
995187829 5:109290258-109290280 CTGCAGAGGCAGTGGCAGAGAGG - Intergenic
995253410 5:110019148-110019170 CTGCAGTGGCAGTGGCAGAGGGG - Intergenic
995659326 5:114463497-114463519 TTGCACAGCTAGTAGGAGATGGG - Intronic
996403542 5:123086879-123086901 CTGTAGACGTAGTGGGCGAGGGG + Intergenic
997580754 5:135015338-135015360 CTGCAGAGCTAGAGGGAAAGGGG + Intergenic
997641186 5:135449850-135449872 CTGCAGCCGTGGTGGGACATTGG + Exonic
997863343 5:137439460-137439482 CTCCAGAGGTAGGGGGTGAGGGG + Intronic
998227533 5:140338636-140338658 CTGCAAAGGGAGGGGGAGGTAGG - Intronic
998311739 5:141139163-141139185 ATTCTGAGGTAGTGGGAGTTAGG - Intronic
998692034 5:144597922-144597944 ATTCACAGGTAGTGGGAGTTAGG - Intergenic
999052172 5:148534544-148534566 CTGCAGAAGCAGTGGCAGAGAGG - Intronic
999642178 5:153682730-153682752 TTGCAGAGGTGGAGAGAGATTGG - Intronic
1000031683 5:157407129-157407151 CTGCAGAGGCAGTGACAGAGAGG - Intronic
1000094611 5:157960355-157960377 TAGCAGAGATAGTGGGGGATGGG - Intergenic
1001275766 5:170350242-170350264 CTCCAAAGGAAGTGTGAGATGGG - Intergenic
1002688774 5:181036402-181036424 GTGCACAGGCACTGGGAGATAGG - Intergenic
1002747341 6:69688-69710 CTGTAGAGGCAGTGGCAGAGGGG - Intergenic
1005015403 6:21370728-21370750 CTGAAAAGGCAGTGGGAGACTGG - Intergenic
1005072178 6:21872041-21872063 CTGCAGAAGTTGTGGCAGAAGGG - Intergenic
1006305325 6:33215114-33215136 CTGCAGTGGGTGAGGGAGATGGG + Intergenic
1006376512 6:33674362-33674384 CTGCAGAGGGAATGGCAGAGAGG - Intronic
1007139086 6:39553893-39553915 CTACAGAAGTGGTGGGAGCTTGG - Intronic
1007597871 6:43062736-43062758 CAGTGGAGGTAGTGGGAAATTGG + Intronic
1008173242 6:48234680-48234702 CTGCAGAGGCAGTGGCAGAGAGG - Intergenic
1008219901 6:48842980-48843002 CTACAGTGGCAGTGGGAGAGGGG + Intergenic
1008973897 6:57401943-57401965 CTGCAGAGGCAGTGGCAGGGAGG + Intronic
1009162787 6:60303448-60303470 CTGCAGAGGCAGTGGCAGGGAGG + Intergenic
1009325779 6:62346221-62346243 CTGCAGAGGCAGTGGCAGAGAGG - Intergenic
1009351558 6:62685706-62685728 CTGCAGAGGTGGTGGTGGACAGG + Intergenic
1009588516 6:65637449-65637471 CTGCAGAGCTGGTGGGAGCCAGG + Intronic
1009596695 6:65745559-65745581 CTGAAGAGGCAGTGGCAGAGAGG - Intergenic
1009769553 6:68127247-68127269 CTGCAGAGACAGTGGCAGAGAGG + Intergenic
1010019240 6:71139926-71139948 CTGCAGAGGCAGTGGCAGGGAGG - Intergenic
1010210163 6:73356323-73356345 CTGCAGGTGGAATGGGAGATGGG - Intergenic
1010313235 6:74413068-74413090 CTGGAGAGGTAATTGGAGACAGG + Intergenic
1011063170 6:83294616-83294638 CTGCAGAGGCAGTGGCAGAAGGG - Intronic
1011133147 6:84072747-84072769 CTGCAGCTGCTGTGGGAGATGGG + Intronic
1011375515 6:86682178-86682200 CTGCAGCTGCTGTGGGAGATGGG + Intergenic
1011696425 6:89917658-89917680 CTCTAGTGGTAATGGGAGATTGG + Intergenic
1012252015 6:96990920-96990942 CTGCAGTGGCAGTGGCAGAGGGG + Intronic
1013023979 6:106251170-106251192 GTGCAGAGGGAGTGGCAGCTGGG - Intronic
1014124389 6:117759905-117759927 CTGCAGATGCAGTGGCAGAGAGG - Intergenic
1014183292 6:118408056-118408078 CTGAAGAGGCAGTGGCAGAGAGG - Intergenic
1015197289 6:130537358-130537380 CTGCAGAGGCAGTGGCAGAGAGG - Intergenic
1015452392 6:133385824-133385846 CTGCAGATGTAATGGTATATTGG + Intronic
1015660231 6:135566597-135566619 CTGCAGAGTTATTGGGGGAAGGG - Intergenic
1016288939 6:142506713-142506735 CCGCAGAGGCAGTGCCAGATTGG + Intergenic
1017535986 6:155348772-155348794 CTGCAGTGGCAGTGGCAGAGAGG + Intergenic
1017797013 6:157854086-157854108 CTGGTGAGGGTGTGGGAGATGGG + Intronic
1017906143 6:158758669-158758691 CAGCACAGGCAGTGGGAGAGTGG - Intronic
1017977001 6:159366993-159367015 CTGGAGAGGATGTGGGAAATAGG + Intergenic
1018107911 6:160506732-160506754 CTGCAGTGGCAGTGGCAGATGGG + Intergenic
1018426773 6:163690261-163690283 CTGCAGAGCTGGTGAGTGATGGG - Intergenic
1018846437 6:167560087-167560109 CTGCAGAGATGCTGGGAGAAGGG - Intergenic
1019218317 6:170457613-170457635 TTGCAGAGCTACTGGGAGGTGGG + Intergenic
1019911344 7:4102238-4102260 CTGCAGAGGGAGGGACAGATGGG - Intronic
1020030466 7:4929309-4929331 CTGCTGCGGCCGTGGGAGATGGG - Intronic
1020079043 7:5276704-5276726 CTGCGGAGGCAGAGGGAGAGGGG - Intronic
1020426264 7:8069418-8069440 CTGCAGTGGCAGTGGCAGAGGGG + Intronic
1020702336 7:11499046-11499068 CTACAGAGGCAGTGGCAGAGAGG - Intronic
1021355770 7:19651738-19651760 CTGCAGTGGTACTGGCAGAGGGG - Intergenic
1021562713 7:21985112-21985134 CTTCTGAGGTACTGGGAGTTAGG + Intergenic
1021590368 7:22254718-22254740 TTGGAGAGGAAGGGGGAGATGGG + Intronic
1022703792 7:32784777-32784799 AAGCAGAGGTAGTGGGAGCCAGG - Intergenic
1022833430 7:34091020-34091042 CTGTTGAGGTACTGGGAGGTAGG + Intronic
1023886373 7:44360142-44360164 CTACAGAGGCAGTGGCAGAGAGG + Intergenic
1024165437 7:46724787-46724809 CTGCAGAGGCAGTGGCAGAGAGG - Intronic
1026579543 7:71602591-71602613 CTGCAGAGGGAGAGAGAGAGAGG - Intronic
1027627616 7:80564636-80564658 CTGCAGAGGCAGTGGCAGAGAGG + Intronic
1028017521 7:85734654-85734676 TTGTAGAGGGAGTGGGAGCTGGG + Intergenic
1028077443 7:86533953-86533975 CTGCAGGGGCAGTGGGAGAGGGG + Intergenic
1029052183 7:97700652-97700674 CTGCAGAGGCAGTGGCAGAGAGG - Intergenic
1029923438 7:104290708-104290730 CTGCAATGGTATTTGGAGATGGG + Intergenic
1030361387 7:108598855-108598877 GTGCAGAGGAAGAGGGAGAGAGG + Intergenic
1030809396 7:113956214-113956236 CTGCAGAGACAGTGGCAGAGAGG + Intronic
1032084597 7:128877312-128877334 CTGCAGGGGGAGTGGGAGGCGGG + Intronic
1032836874 7:135682851-135682873 CAGCAGAGGAAGCGGGAGACAGG + Intronic
1033516278 7:142109980-142110002 CTGCAGAAACAGGGGGAGATGGG + Intergenic
1034180149 7:149130791-149130813 CTGCTGAGGAGATGGGAGATGGG + Intronic
1034967582 7:155400729-155400751 CTGCAGAGGGAGTGGGGGACAGG - Intergenic
1035770505 8:2143147-2143169 CTCCAGAGGAAATGTGAGATGGG - Intronic
1038233565 8:25729119-25729141 CTGCAGAGGGAGTGGCACAGAGG + Intergenic
1038344886 8:26723307-26723329 CAGTAGGGGTAGTGGGAGAGAGG + Intergenic
1038827225 8:31017256-31017278 CTGGAGAAGTAGTGGTAAATGGG - Intronic
1040087850 8:43364599-43364621 CTGCAGAGGCAGTGGCATAGAGG - Intergenic
1040404558 8:47087202-47087224 CTTCAGAGGCAGTGGCAGAGAGG + Intergenic
1041012781 8:53560130-53560152 CTGCTGAGGAAGTGGGAGAGGGG - Intergenic
1041405294 8:57492261-57492283 ATGCTGGGGTAGTGGGAAATAGG - Intergenic
1042460400 8:69058753-69058775 CTGAAGAGGTAGTGGGGATTTGG - Intergenic
1042619924 8:70693881-70693903 CTGCAGAGGCAGTGGCAAAGAGG + Intronic
1044162463 8:88936151-88936173 CTGCAGATGCAGTGGCAGAGAGG - Intergenic
1045137049 8:99232801-99232823 CTGCAGAAGTCCTGGGAGGTAGG + Intronic
1046629671 8:116610898-116610920 CTGCAGCGGGAGAGAGAGATTGG + Intergenic
1047133524 8:122050186-122050208 CTACAGAGGGAGTGGTAGAAAGG + Intergenic
1049891117 9:72262-72284 CTACCGAGGTCGTGGGAGAAGGG + Intergenic
1050837778 9:10105605-10105627 TGGCAGAGGGAGTGAGAGATGGG - Intronic
1051822249 9:21181591-21181613 CTGCAGAGGCAGTGGTAGACAGG - Intergenic
1051823482 9:21193650-21193672 CTGCAGAGGCAGTGTTAGACAGG - Intergenic
1051827281 9:21234247-21234269 CTGCAGAGGCAGTGGTAGACAGG - Intronic
1051899717 9:22025397-22025419 TTGCAGAGGTAGTGGCAGAGAGG + Intronic
1052311609 9:27074722-27074744 CTGCAGAGGCAGTGGCAGAGAGG + Intergenic
1052703029 9:31960499-31960521 CTGCAGAGGCAGTGGCAAAGAGG - Intergenic
1054695876 9:68358258-68358280 CTACCGAGGTCGTGGGAGAAGGG - Intronic
1055208683 9:73763149-73763171 CTGCAGAGGCAGTGGCAGACAGG - Intergenic
1055727791 9:79250196-79250218 CTGCAACAGTATTGGGAGATGGG - Intergenic
1056127865 9:83554687-83554709 CTGCAGAAGCAGTGGAAGAGAGG + Intergenic
1057014521 9:91639595-91639617 TTGCAGTGGCAATGGGAGATTGG + Intronic
1058985561 9:110206532-110206554 CAGCCCAGGTAATGGGAGATGGG + Intronic
1058987387 9:110220832-110220854 CTGGAGAAGTAGTGGGAGGGGGG + Intergenic
1059526297 9:114993732-114993754 CTACAGAGGGAATGGGACATAGG - Intergenic
1060586650 9:124790730-124790752 CGGCAGAGGCAGTAGGAGACAGG + Intronic
1060826264 9:126689712-126689734 CTGCAGAGATGATGGGAGATGGG + Intronic
1060834660 9:126745997-126746019 CTGCAGTGGCAGTGGGAGGGTGG + Intergenic
1062039108 9:134396059-134396081 CAGCAGAGGTTGTTGAAGATGGG - Intronic
1062338709 9:136084016-136084038 CTGTAGAGGAACTAGGAGATGGG - Intronic
1203527905 Un_GL000213v1:106585-106607 CTGCAGAGGCAGTGGCAGAGAGG + Intergenic
1185750479 X:2607060-2607082 CTGGAGGGGTAGAGAGAGATGGG - Intergenic
1186747628 X:12585537-12585559 CTGCAGGTGGAATGGGAGATGGG - Intronic
1188715013 X:33449618-33449640 CTGTAGAGGCAGTGGCAGAGAGG - Intergenic
1188756390 X:33968924-33968946 CTGCAGAGCCAGTGGGAGCTGGG + Intergenic
1188791757 X:34414190-34414212 CAGCAGAGGCAGTGGCAGAGGGG - Intergenic
1188842887 X:35037526-35037548 CTGCAGAGGCAGTGGCAGAGAGG - Intergenic
1188869694 X:35359045-35359067 CTGCAGAGGCAGTGGTAGAGAGG + Intergenic
1189071584 X:37869315-37869337 GTGGAGAGGTAGAGGGCGATAGG + Intronic
1189925657 X:45951808-45951830 CTTCAGAGGTGGAGGGATATTGG + Intergenic
1191094611 X:56661270-56661292 CTGCAGAGGTGGTGGCAGAGAGG + Intergenic
1191122991 X:56925609-56925631 CTGCAGAGGCAGTGGCAGAAGGG + Intergenic
1191155248 X:57266509-57266531 CTGCAAAGGCAGTGGCAGAGAGG - Intergenic
1191738906 X:64416824-64416846 CTGCATAGGTGGTGGCAGAAAGG + Intergenic
1191743699 X:64463701-64463723 CTGCAGAGGCAGTAGCAGAGAGG + Intergenic
1191922503 X:66271410-66271432 CTGCAGAGGCAGTGGCAGAAAGG - Intergenic
1191988871 X:67010523-67010545 CTGCCGAGGTAGTGGCAGAGAGG - Intergenic
1192310935 X:70013471-70013493 CTGCAGTGGCAGTGGCAGAGGGG - Intronic
1193028746 X:76875031-76875053 CTGCAGAGGCAGTGGCAGAGAGG - Intergenic
1193317042 X:80076706-80076728 CTGCAGTGGCAGTGGGATAGAGG + Intergenic
1193332110 X:80246314-80246336 GTGGAGAAGGAGTGGGAGATTGG - Intergenic
1193408846 X:81139628-81139650 CTGCTGGGGTAGTGGCAGAGGGG - Intronic
1193422538 X:81299946-81299968 GTGCTGAGGGAGTGGGGGATGGG - Intergenic
1193481661 X:82035349-82035371 CTGCAGGGGTCTTTGGAGATAGG + Intergenic
1193496396 X:82219053-82219075 CTGCAGAGGCAGTGGCAGATGGG + Intergenic
1193714909 X:84926817-84926839 CTGCAGAGGCAGTGGCAGAGAGG + Intergenic
1193773872 X:85620088-85620110 CTGCAGTGGTAGTGTCAGAGGGG - Intergenic
1193779648 X:85686233-85686255 CTGCAGCTGCTGTGGGAGATGGG + Intergenic
1193805208 X:85985982-85986004 CTGCAGAGGCAGTGGCAGAGAGG - Intronic
1193858942 X:86640262-86640284 CAGCAGAGGCAGTGGCAGAGAGG - Intronic
1193902889 X:87204232-87204254 CTGTGGTGGTAGTGGTAGATAGG - Intergenic
1193937620 X:87641860-87641882 CTGCAGCTGCTGTGGGAGATTGG - Intronic
1194040689 X:88938576-88938598 CTGCATTGGTAGTGGCAGAGGGG + Intergenic
1194055596 X:89127824-89127846 CTGCAGAGGCAGTGGCAGAGAGG + Intergenic
1194195055 X:90882614-90882636 CTGCAGTGGCAGTGGCAGAGTGG + Intergenic
1194235012 X:91372417-91372439 CTGCAGTGGCAGTGGGAAAGGGG - Intergenic
1194781462 X:98029334-98029356 CTGCAGAGGCAGTGATAGATAGG + Intergenic
1194838910 X:98714929-98714951 CTGCAGAGGCAGTGGCAAAGAGG + Intergenic
1194917528 X:99723408-99723430 CTGCAGAGACAGTGGCAGAGAGG - Intergenic
1194920358 X:99758164-99758186 GTGCAGAGATAGTGGAATATGGG + Intergenic
1194948065 X:100091928-100091950 CTGCAGAGGAAGTGGCAGAGAGG - Intergenic
1195148855 X:102044762-102044784 CTGCAGAGGCAGTGGCAGAGAGG - Intergenic
1195208132 X:102624748-102624770 CTGCAGAGGCAGTGGCAGAGGGG + Intergenic
1195345841 X:103950380-103950402 AGGCAGAGCTAGTGGGAGATAGG + Intronic
1195473498 X:105259758-105259780 CTACAGAGGTAGTGGCACAGAGG + Intronic
1195856505 X:109338199-109338221 CTGCAGAGACAGTGGCAGAGGGG + Intergenic
1196227933 X:113188618-113188640 CTGCAGAGGCAGTGGCAGAGAGG + Intergenic
1196528860 X:116759652-116759674 CTGCACAGGCAGTGGCAGAGAGG - Intergenic
1197076952 X:122364211-122364233 CTGCAGAGGCAGTGACAGAGAGG + Intergenic
1197572157 X:128163152-128163174 CTGCAGCTGTTGTGGGAAATGGG + Intergenic
1197860704 X:130966897-130966919 ATGCAGAGGTGGTGAGAGAAAGG + Intergenic
1197904742 X:131412817-131412839 CTGCAGAGGCAGTGGCAGAGAGG - Intergenic
1198797280 X:140410610-140410632 CTGCAGCTGCTGTGGGAGATGGG + Intergenic
1199249037 X:145638215-145638237 CTGCAGAGGCAGTGGCAGAGGGG - Intergenic
1199307007 X:146279054-146279076 CTGCAGAGGCAGTGGCAGAGAGG + Intergenic
1199966447 X:152824508-152824530 CTGCAGAGGTAGCCGGAGTGTGG - Intergenic
1201492525 Y:14557706-14557728 TGGGAGAGGTAGTGGGAGAGGGG + Intronic