ID: 1157507519

View in Genome Browser
Species Human (GRCh38)
Location 18:48239124-48239146
Sequence GGGGATGAGGGTTGGTTCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157507519_1157507527 7 Left 1157507519 18:48239124-48239146 CCTGAGAACCAACCCTCATCCCC No data
Right 1157507527 18:48239154-48239176 GCTGCAGCAAGCCCCACTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157507519 Original CRISPR GGGGATGAGGGTTGGTTCTC AGG (reversed) Intronic