ID: 1157507520

View in Genome Browser
Species Human (GRCh38)
Location 18:48239132-48239154
Sequence CTACTGTGGGGGATGAGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157507520_1157507527 -1 Left 1157507520 18:48239132-48239154 CCAACCCTCATCCCCCACAGTAG No data
Right 1157507527 18:48239154-48239176 GCTGCAGCAAGCCCCACTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157507520 Original CRISPR CTACTGTGGGGGATGAGGGT TGG (reversed) Intronic