ID: 1157507527

View in Genome Browser
Species Human (GRCh38)
Location 18:48239154-48239176
Sequence GCTGCAGCAAGCCCCACTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157507522_1157507527 -6 Left 1157507522 18:48239137-48239159 CCTCATCCCCCACAGTAGCTGCA No data
Right 1157507527 18:48239154-48239176 GCTGCAGCAAGCCCCACTCAAGG No data
1157507519_1157507527 7 Left 1157507519 18:48239124-48239146 CCTGAGAACCAACCCTCATCCCC No data
Right 1157507527 18:48239154-48239176 GCTGCAGCAAGCCCCACTCAAGG No data
1157507521_1157507527 -5 Left 1157507521 18:48239136-48239158 CCCTCATCCCCCACAGTAGCTGC No data
Right 1157507527 18:48239154-48239176 GCTGCAGCAAGCCCCACTCAAGG No data
1157507520_1157507527 -1 Left 1157507520 18:48239132-48239154 CCAACCCTCATCCCCCACAGTAG No data
Right 1157507527 18:48239154-48239176 GCTGCAGCAAGCCCCACTCAAGG No data
1157507518_1157507527 14 Left 1157507518 18:48239117-48239139 CCATTGGCCTGAGAACCAACCCT No data
Right 1157507527 18:48239154-48239176 GCTGCAGCAAGCCCCACTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157507527 Original CRISPR GCTGCAGCAAGCCCCACTCA AGG Intronic