ID: 1157509616

View in Genome Browser
Species Human (GRCh38)
Location 18:48261454-48261476
Sequence TGTGGTGCAAAATAATGGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 131}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157509616 Original CRISPR TGTGGTGCAAAATAATGGCT TGG Intronic
903333503 1:22609562-22609584 TGTGGTGCAGGATAAAAGCTCGG - Intergenic
905872110 1:41410631-41410653 TGTGGTGGATCAGAATGGCTGGG + Intergenic
907248707 1:53123722-53123744 TGTGGTGCAGGATAAAGCCTGGG + Intronic
908128517 1:61052529-61052551 GGTGGTGCTACATAATGGCATGG + Intronic
909586363 1:77293215-77293237 TGTGGTCCAATGGAATGGCTTGG - Intronic
910714943 1:90220569-90220591 TGTGTTTCAAAATATTGGCTGGG + Intergenic
911227521 1:95323269-95323291 AATGCTGGAAAATAATGGCTGGG + Intergenic
918957550 1:191229841-191229863 TATTCTGAAAAATAATGGCTTGG - Intergenic
919832887 1:201554432-201554454 TGTGGGACCAACTAATGGCTTGG + Intergenic
921744733 1:218726924-218726946 GGTGGTGCAAAATCAAGGGTAGG - Intergenic
924003770 1:239584026-239584048 TGTGGTGCAGAACAAAGTCTGGG - Intronic
924057180 1:240135288-240135310 TGTGGGGTAAAATCATGGATGGG + Intronic
1067162868 10:43842240-43842262 CTTGCTGCCAAATAATGGCTTGG + Intergenic
1067452425 10:46390533-46390555 TGTTGTGTAAATGAATGGCTGGG + Intronic
1067584806 10:47469222-47469244 TGTTGTGTAAATGAATGGCTGGG - Intronic
1067976288 10:51029151-51029173 TTTGCTTCAAAATAATAGCTAGG + Intronic
1068040276 10:51815532-51815554 TGAGGTGCAAAATAAATACTAGG + Intronic
1068726558 10:60309449-60309471 TGTCATGCATAATAAGGGCTTGG + Intronic
1069179961 10:65346476-65346498 TGAGGAGTAAAATAAGGGCTTGG - Intergenic
1072670168 10:97423597-97423619 TGTTGTGCAAAGTCACGGCTAGG - Intronic
1072827026 10:98617732-98617754 TGGAGTGGAAAATAATGGCAGGG - Intronic
1073876671 10:107931295-107931317 TATGGTGCAAATAAATGACTTGG + Intergenic
1076668840 10:132108068-132108090 TGGGGTTCAAGATCATGGCTCGG + Intronic
1078015060 11:7606140-7606162 CGGGGGGCAAAATACTGGCTTGG + Intronic
1078693220 11:13602832-13602854 TGGGGTGGGAAATATTGGCTTGG - Intergenic
1079459354 11:20666875-20666897 TGGGGTTCAAAATAGAGGCTGGG + Intergenic
1079468015 11:20750905-20750927 TGTGATATAAAATAATGGTTGGG + Intronic
1080580059 11:33634987-33635009 TGGGGTTCAAAATAATGGCTTGG - Intronic
1081803833 11:45878550-45878572 TTTGTAGCAAAAAAATGGCTAGG + Intronic
1082257597 11:50049723-50049745 TGTGGTGGAAACTAATTTCTTGG + Intergenic
1083680971 11:64351760-64351782 GATGGTGCAAAATGGTGGCTGGG - Intronic
1091655430 12:2342700-2342722 TGATGTTCAAAATGATGGCTTGG - Intronic
1091804511 12:3346430-3346452 TGTGGTGAAAACTAAGAGCTGGG + Intergenic
1092965385 12:13636368-13636390 TGTGGTGGAAAGTCATGGCAGGG + Intronic
1098432134 12:70431314-70431336 TCTGGTGAAAAATAATGGTTAGG - Exonic
1102050342 12:109857388-109857410 TGTGATGCTAGTTAATGGCTGGG - Intronic
1106967778 13:35092691-35092713 TGTTGTGCTAAATACTGGCAAGG + Intronic
1108546257 13:51497982-51498004 TCTGGGGAAAAATAATGACTTGG + Intergenic
1114482496 14:23044440-23044462 TGGGGTGCAAGATTAAGGCTCGG - Intergenic
1114719965 14:24871084-24871106 TGGGATGCAAAATATTGGCGTGG - Intronic
1114982701 14:28186015-28186037 GGTGGTTCAAACTCATGGCTGGG + Intergenic
1117864083 14:60127185-60127207 TGTGGTGCAAACTAATGTTTAGG + Intronic
1118552576 14:66971770-66971792 TGTGTTCCAAAATCATGCCTGGG - Intronic
1118565900 14:67140637-67140659 TGTGGTTCAAAATACTGACTGGG - Intronic
1119666163 14:76486591-76486613 TGTGGTGCCAAATCACGGATGGG + Intronic
1123181784 14:106478157-106478179 TGGGTTACAAAATAATGGGTTGG - Intergenic
1202945120 14_KI270726v1_random:18571-18593 TGGGTTACAAAATAATGGGTTGG + Intergenic
1126394967 15:48205134-48205156 TGTGGTGTAATATAGTGGCTAGG - Intronic
1127815067 15:62600782-62600804 GGTGCTTCAAAATAATGGGTGGG - Intronic
1127822814 15:62675117-62675139 TGTGGTGGAGATAAATGGCTAGG - Intronic
1130017600 15:80199831-80199853 TGTGGTGGGGACTAATGGCTGGG + Intergenic
1137834565 16:51578807-51578829 TGTGGTGTAAAATGATGAATTGG - Intergenic
1139078227 16:63481622-63481644 TGTGATGTAAAACAATGGATTGG - Intergenic
1140430104 16:74895613-74895635 TGTATTGCAGAATAATGACTTGG - Intronic
1140572860 16:76129063-76129085 TATGCTGTGAAATAATGGCTGGG + Intergenic
1140578427 16:76200033-76200055 TGTGGTCCAAAATATTTTCTGGG + Intergenic
1141238922 16:82246612-82246634 TGTGGAGGAAAATAATGGAGAGG - Intergenic
1144280417 17:13720639-13720661 TGTGGTGGATAAAAAAGGCTGGG - Intergenic
1152968247 18:136858-136880 TTTGGTGGAAAATAAAGTCTAGG + Intergenic
1153575144 18:6512401-6512423 TCTGGAGCAAAATAAAGACTGGG - Intronic
1155103734 18:22640281-22640303 TGTGGTGAAAAGTAAGGGGTAGG - Intergenic
1155484500 18:26327515-26327537 TGTGGAACAAAATACAGGCTGGG + Intronic
1157509616 18:48261454-48261476 TGTGGTGCAAAATAATGGCTTGG + Intronic
1158947619 18:62460929-62460951 TGTGTTGCAAAACCAAGGCTGGG + Intergenic
1159061000 18:63513863-63513885 TGGGGTCCAAAACCATGGCTGGG + Intergenic
1164835418 19:31352287-31352309 CCTGGTGGAAAATAATGACTCGG - Intergenic
1165046103 19:33106297-33106319 CATGGAGGAAAATAATGGCTGGG - Intronic
927689142 2:25195286-25195308 AGTGGTGCAAGGTAGTGGCTGGG - Intergenic
933264655 2:80169063-80169085 TGTGGTGCAGGATAAAGGCATGG - Intronic
939053546 2:137334408-137334430 TGTGGAGAAAAATAAAGGCAGGG - Intronic
940518214 2:154708589-154708611 TATGGGGTAAAATAAGGGCTAGG - Intronic
940805531 2:158182421-158182443 TCTAGTGCAAAATAATGATTGGG + Intronic
943143552 2:184013836-184013858 TGTGGTCAAAAATAATATCTGGG - Intergenic
944596113 2:201262223-201262245 TGTTGTGAAAAATCACGGCTTGG - Intronic
945183627 2:207117330-207117352 GGTGGTGAAAAACAATCGCTGGG - Intronic
945661834 2:212695829-212695851 TGTGCTGCATAATAATGTTTCGG - Intergenic
947060904 2:226164032-226164054 TGTGGTGTAAAAGAATTGATTGG + Intergenic
1170094409 20:12629869-12629891 TGTGGGGCAAGGTAAAGGCTGGG + Intergenic
1170589602 20:17761869-17761891 TGTGGTATAACATCATGGCTGGG - Intergenic
1175635967 20:60583949-60583971 TTTGGTGCATAATTATGACTCGG + Intergenic
1178269870 21:31179595-31179617 TGTGTTTTAAAATAATGGCAGGG + Intronic
949164580 3:923310-923332 TGTGGTTGAAAACATTGGCTGGG + Intergenic
949197940 3:1335912-1335934 TGTGGTGCCAGCTAATGGATGGG + Intronic
950516039 3:13466103-13466125 TGTGGTGCTAAGTCATGGGTGGG + Intergenic
951085337 3:18506532-18506554 TGTGGTGAAAAATATTGAATTGG + Intergenic
951383800 3:22020202-22020224 TGGGGTACAGAATAATGACTGGG + Intronic
953217957 3:40938912-40938934 TGGGGTACAGAATAATGTCTGGG - Intergenic
956054672 3:65286142-65286164 TGTGGTTAACAATGATGGCTGGG - Intergenic
956331507 3:68115387-68115409 TGTGAAGCAAAAAAATGGGTTGG + Intronic
959463442 3:106654885-106654907 TGAGATGTAGAATAATGGCTAGG - Intergenic
971346984 4:25820539-25820561 TGTGCTTCAAAATAGAGGCTGGG + Intronic
973666080 4:53160673-53160695 TGAGGAGCAAAATAATGGCAAGG + Intronic
975083101 4:70304063-70304085 TTTGGTGCAAAATAATAGTAAGG + Intergenic
976057435 4:81084661-81084683 TAGGCTGCAAAATATTGGCTGGG + Intergenic
976329322 4:83811327-83811349 TGTGGTGCAAGATATTTACTCGG + Intergenic
976507317 4:85863317-85863339 TGTGATAGAAAATAATGGCATGG - Intronic
976507507 4:85865408-85865430 TGTGATAGAAAATAATGGCATGG - Intronic
976549938 4:86382152-86382174 TGGGGTGCAAAATAACCCCTAGG + Intronic
977498288 4:97804257-97804279 TGAGCTGCAAAACAATGTCTTGG + Intronic
983953487 4:173670369-173670391 TGTGGTGCCCAAAAATGGCATGG + Intergenic
984021874 4:174495194-174495216 TCTGGTGACAAATAATGGCTGGG + Intronic
984240629 4:177215196-177215218 TGTGGTGCAAAATAGTTTCATGG - Intergenic
987925640 5:24337226-24337248 TGTGGACCATAATGATGGCTAGG - Intergenic
996282559 5:121748562-121748584 TATAATGCAAAATAATTGCTTGG + Intergenic
1000721222 5:164709653-164709675 TCTGGAGCAAAATAATGTATAGG - Intergenic
1000832364 5:166119023-166119045 TGTTGTTCAACATCATGGCTGGG + Intergenic
1004051924 6:12090922-12090944 TGAGGTTCAGAATAATGGATTGG + Intronic
1006640727 6:35488334-35488356 TGTGGTCCAAATTAATAGCCTGG - Intronic
1008384585 6:50874181-50874203 TGTGATGTAAATTAATAGCTTGG + Intergenic
1009286503 6:61825678-61825700 TGTGGCACATTATAATGGCTAGG + Intronic
1009835239 6:68991950-68991972 TGTGGTGCAATATAATGGAATGG - Intronic
1013973897 6:116054248-116054270 TATGGTGAAAAATAAAGGATGGG + Intronic
1015984858 6:138874796-138874818 TGGAGTGCAAGATACTGGCTGGG + Intronic
1016246620 6:141989319-141989341 TCTGGTGCAAAAACATTGCTTGG - Intergenic
1018928098 6:168221256-168221278 TGTGGTGCAAAACTGTAGCTGGG - Intergenic
1021227176 7:18041994-18042016 TGTAATACAAAATATTGGCTGGG + Intergenic
1024828890 7:53425046-53425068 TCTTGTGCAAAATAAAGGCCAGG + Intergenic
1027568963 7:79838053-79838075 TGTGGTGTTAAAAAAAGGCTTGG + Intergenic
1030741870 7:113119051-113119073 TGTAGTGCAAAATAAAGTTTAGG + Intergenic
1031240941 7:119238448-119238470 GGTGGTGGAAAATAATAGGTTGG + Intergenic
1031738010 7:125391344-125391366 TGTGGTACAAAAGAATGACTTGG - Intergenic
1033352130 7:140570193-140570215 TGTGGTAGAAAAAAATGACTGGG - Intronic
1037314510 8:17588379-17588401 TGTGGTTCAAAATCTTGGCTGGG + Intronic
1038223277 8:25631022-25631044 TGACGTGCAAAATAAAGGCTAGG + Intergenic
1039723959 8:40195182-40195204 TGTGGTTGAAAATACTGTCTTGG + Intergenic
1040462648 8:47663490-47663512 TGTGCTCCAAAATAGTGCCTTGG - Intronic
1041483697 8:58350536-58350558 TGTGGTGAAAAATCATGTCTGGG - Intergenic
1042616856 8:70659093-70659115 TCTACTGCAAAATACTGGCTAGG + Intronic
1044916041 8:97113328-97113350 TGTGGGGTAAAAGAATGGGTTGG + Intronic
1046086674 8:109445311-109445333 TGTGGTGGGAAGTAAAGGCTTGG + Exonic
1046345194 8:112914854-112914876 TTTGTTTCAAAATAATAGCTGGG - Intronic
1046863944 8:119125197-119125219 TGTGGTGCCAAAGAATGTCAGGG - Intergenic
1047325049 8:123828022-123828044 AGTGGAGCAAAATTGTGGCTGGG + Intergenic
1052560428 9:30077677-30077699 GGTGGAGGAAAATAATGTCTTGG - Intergenic
1055744856 9:79432081-79432103 TGTGCAGCAAAACAATGCCTAGG + Intergenic
1055858117 9:80716671-80716693 TGTGGTGGAATAGAATGGGTTGG + Intergenic
1059409401 9:114122692-114122714 TGTGGTGTAAGAGAAAGGCTGGG + Intergenic
1187144846 X:16628014-16628036 TTTTGTGCAAAATGGTGGCTGGG + Intronic
1187651191 X:21408921-21408943 TGTGGTGTTAAATCATGTCTTGG + Intronic
1188971561 X:36623370-36623392 TTTTGTGTATAATAATGGCTAGG - Intergenic
1188980932 X:36726478-36726500 TTTGGTCCAAAATAGTGGATAGG + Intergenic
1192250676 X:69410952-69410974 TGTGGTGGCAAAGAATGGCAAGG - Intergenic
1198804362 X:140479083-140479105 TTTGGAGCAAAAGAATTGCTAGG + Intergenic
1199271617 X:145889860-145889882 TGTGCTGGAAAAAATTGGCTAGG - Intergenic
1200793616 Y:7320724-7320746 TGTGTTGCAAACTAATGGGGGGG + Intergenic