ID: 1157511156

View in Genome Browser
Species Human (GRCh38)
Location 18:48275867-48275889
Sequence CAGTGAGGGCATTAAGCAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 138}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157511153_1157511156 1 Left 1157511153 18:48275843-48275865 CCAATCATCTGCTAAGCAGCATT 0: 1
1: 0
2: 1
3: 13
4: 324
Right 1157511156 18:48275867-48275889 CAGTGAGGGCATTAAGCAACAGG 0: 1
1: 0
2: 0
3: 12
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157511156 Original CRISPR CAGTGAGGGCATTAAGCAAC AGG Intronic
904672351 1:32175359-32175381 CAGGGCTGGCATTCAGCAACAGG - Exonic
905572600 1:39017530-39017552 GAGTGGGGGCAGTAAGCAATGGG + Intergenic
915945895 1:160151704-160151726 CAGTGAGGGCAGGAAACAAGAGG - Exonic
918046587 1:180945260-180945282 CAGTGAGGGCAAAAAGCATCAGG - Intronic
1062924866 10:1308633-1308655 CAGTGAGGGTGTGGAGCAACAGG - Intronic
1063172467 10:3521582-3521604 CACCGAGGGCATTAAGGAAGAGG + Intergenic
1064268220 10:13842076-13842098 CAGAGAGGCTATTAAGCAGCTGG + Intronic
1065661090 10:28004765-28004787 CATTGAGGACATTAAGCATCGGG + Intergenic
1070046973 10:72847784-72847806 CAGTCAGGGCCTTAATCATCTGG + Intronic
1072822345 10:98570308-98570330 CCATGAAGGCATAAAGCAACAGG - Intronic
1073339168 10:102732009-102732031 AAGTGAGGTCACTCAGCAACTGG + Intronic
1074922901 10:118035567-118035589 CACTGTGTGCATTAAGAAACTGG + Intronic
1075029667 10:119013762-119013784 AAGTGAGGACATGAAGAAACTGG - Intergenic
1079811093 11:25000505-25000527 AATTGAGGGCATCAAGCTACAGG - Intronic
1079968660 11:27008853-27008875 AAGTGAAAGCATTAATCAACAGG + Intergenic
1080079898 11:28204480-28204502 CCGTGAGGGAATTAGACAACTGG - Intronic
1080128228 11:28762920-28762942 GAGAGATGGCATTAATCAACCGG - Intergenic
1083452792 11:62757335-62757357 CAGTGTTGGCATTAAACAAGAGG - Intergenic
1084311917 11:68321992-68322014 CAGTGAGGACGTTAAGCTTCAGG - Intronic
1086621784 11:88894717-88894739 AAGTGAGAGTATTAAGAAACGGG + Intronic
1089290206 11:117433138-117433160 CAAAGAAGGCATCAAGCAACTGG - Exonic
1092064518 12:5578699-5578721 AAGTGATGGCATTGACCAACAGG - Intronic
1096652442 12:53068510-53068532 CAGCGTGGGCATTCAGCAAGGGG - Intronic
1099922927 12:88981520-88981542 CAGTGAGGGCTTTAAGCTGGGGG - Intergenic
1100029908 12:90173928-90173950 CAGAGAGGGCAATAAGTAACAGG + Intergenic
1101253312 12:102955819-102955841 CTGTGAGGCCATCAAGCCACAGG + Intronic
1102147202 12:110663091-110663113 CGGTGAGGGCGTGAAGCAATGGG + Intronic
1102540478 12:113615598-113615620 CAATGAGTGCATAAAGAAACTGG + Intergenic
1103869449 12:124080898-124080920 AACTGAGTGCATTAAGCAGCTGG + Intronic
1104393154 12:128408377-128408399 CAGTGGGAGCATTCACCAACAGG - Intronic
1108317698 13:49253877-49253899 CAGTGAGGGCCTTTAGCATAAGG - Intronic
1108753704 13:53474981-53475003 CAGTGAGGGTGCAAAGCAACAGG + Intergenic
1108932232 13:55839563-55839585 AAGTGACGGTATTAAGTAACTGG - Intergenic
1109855330 13:68119629-68119651 CAATGAAGGAATTAAGGAACAGG + Intergenic
1112104650 13:96227856-96227878 CTGTGAGATCATAAAGCAACTGG - Intronic
1113576640 13:111399729-111399751 CAGTGAGAACCTTAAGGAACTGG + Intergenic
1114385478 14:22249986-22250008 CAGTGAGGGTGTGGAGCAACAGG - Intergenic
1118738911 14:68724054-68724076 CAGAGAGTGCATTAATCAAAGGG - Intronic
1121101017 14:91250361-91250383 CAGTGGGGGCAGTAGGCCACAGG - Intronic
1121242435 14:92440306-92440328 CAGTGAGGGAATGAAGCCAGGGG + Intronic
1125262487 15:37843248-37843270 TAGTGAGAACATTGAGCAACAGG - Intergenic
1126562312 15:50057451-50057473 CAGTGAGTCCATTAACCAAAAGG - Intronic
1128822078 15:70666165-70666187 CAGTGAGGGCTTTAAGAAGGAGG + Intronic
1131848544 15:96513770-96513792 CAGAGAGGTCAATAAGCAACAGG + Intergenic
1132406814 15:101546727-101546749 CTGTGAGGGCATTAAGAGGCGGG + Intergenic
1136845479 16:33572978-33573000 CAATGAAGGCCTTAAGCAATGGG - Intergenic
1136938796 16:34500664-34500686 CAGTGGGGGCAAAAAGCAGCGGG + Intergenic
1136961024 16:34847892-34847914 CAGTGGGGGCAAAAAGCAGCGGG - Intergenic
1139580487 16:67870754-67870776 CAGTAAGGGGATCAAGAAACAGG - Intronic
1141837312 16:86550341-86550363 AAATGATGGCATGAAGCAACAGG + Intronic
1203107187 16_KI270728v1_random:1421631-1421653 CAATGAAGGCCTTAAGCAATGGG - Intergenic
1150284498 17:63947361-63947383 CAGTGATGTCATCAACCAACTGG + Intronic
1150486944 17:65550510-65550532 CAGTGAGGGGCTTAAGTAGCGGG + Intronic
1153407659 18:4758800-4758822 CAGTGTGGGTATTAAAAAACAGG + Intergenic
1157511156 18:48275867-48275889 CAGTGAGGGCATTAAGCAACAGG + Intronic
1158188616 18:54799999-54800021 CAGTAAGGACATCAACCAACAGG + Intronic
1158867511 18:61652139-61652161 CAGTCAGGGCATAAATCAAAGGG + Intergenic
1159576892 18:70190170-70190192 CAGTGACAACATTCAGCAACTGG - Intronic
1159949010 18:74466022-74466044 CAGTGAGGATATGGAGCAACAGG - Intergenic
1160561258 18:79757495-79757517 CAGTGAGGACATAGAGCAACAGG - Intergenic
1161682070 19:5685080-5685102 CAGTGTGGGCAGTGAGCACCAGG - Exonic
1167526486 19:49987442-49987464 CACTAAGGGCATTGAGCAGCTGG - Intronic
929023171 2:37574475-37574497 GAGTGAGGGGATAAAGCAAGTGG + Intergenic
929950096 2:46403036-46403058 CAGAGAGGCCATGAAGCAACTGG + Intergenic
932129924 2:69178378-69178400 CGGTCAGGGGATTAAGCGACGGG + Intronic
932904219 2:75732485-75732507 CAGTGAGAACATGGAGCAACAGG - Intergenic
933875228 2:86613902-86613924 AATTTAGGGCATTAAGCAAATGG + Intronic
936085259 2:109463265-109463287 CAGTCAAGGCAGTAATCAACTGG - Intronic
939553631 2:143646618-143646640 CAGTCAAGGCATTACACAACTGG - Intronic
943663663 2:190585980-190586002 CTGTGTGGGCAATAAGCAAACGG - Intergenic
948149057 2:235730319-235730341 CAGAGAGGGCAGGAAGCAAGTGG - Intronic
1168813928 20:723849-723871 CAGTGAGAGGATGAAGCAGCAGG - Intergenic
1168970891 20:1930017-1930039 CAGTGAGGGCAGTGTGCAAGGGG - Intronic
1169304645 20:4478087-4478109 CAGTGAGGGTATGAAGAAAAGGG + Intergenic
1169832586 20:9840018-9840040 CTGGGAGGGCAGTAGGCAACTGG - Intergenic
1170444971 20:16417013-16417035 CAGGGAAGGAATAAAGCAACAGG - Intronic
1171102959 20:22403378-22403400 CACAGAGGGGATTAAGCAATGGG + Intergenic
1171150938 20:22826020-22826042 CAGTGAGGGCAGACAGCAAGAGG - Intergenic
1171278421 20:23877710-23877732 CAGTGTGGGCATGAAGCCCCAGG - Intronic
1173963568 20:47093641-47093663 CAGAGAGGGAATGAAGCTACAGG - Intronic
1177669657 21:24208909-24208931 CAGTGAGGGGACTTAGCACCCGG - Intergenic
1178752483 21:35317922-35317944 AAGTGAGAGCATAAGGCAACTGG + Intronic
1178876973 21:36421121-36421143 GAGTGATGGCGTGAAGCAACAGG + Intergenic
1179219608 21:39394764-39394786 CAGTGATGGCATTAAGAATTGGG - Intronic
1181041649 22:20195235-20195257 CACTGAGGGCATTGAAAAACCGG + Intergenic
1181809635 22:25395565-25395587 CAGTGAGGACATTAAGCTTCAGG + Intronic
1181988374 22:26817819-26817841 CAGAGAGGGTCTTAAGCAATTGG - Intergenic
1183664706 22:39240583-39240605 CAGTGGGGCCATGGAGCAACAGG + Intronic
1184696194 22:46140336-46140358 CAACGACGGCCTTAAGCAACGGG + Intergenic
949133515 3:535269-535291 CAGTGAGGCCATGAACCTACCGG - Intergenic
952609191 3:35186703-35186725 CAGTAAAGGCACTAAGCAAATGG - Intergenic
953141141 3:40230537-40230559 CAGTGAGCACAGTAAGGAACAGG + Intronic
953160981 3:40419014-40419036 CAGTGATGGCATTCAGTAAATGG - Intronic
956458579 3:69448499-69448521 CAGTGAGGATATGGAGCAACTGG - Intronic
959942049 3:112090578-112090600 CAGTGAGGGCACTAGGCTACAGG + Intronic
960314762 3:116162972-116162994 TAGTGAGGACAGTAAGCAACAGG - Intronic
960587910 3:119337352-119337374 CAGCGAGAGCATGAAGCCACCGG - Intronic
961917445 3:130392086-130392108 CATTGAGAGCATTAACCAAATGG - Intronic
962587562 3:136858093-136858115 CAAGGAGGACATTAAGCCACAGG - Intergenic
963006850 3:140734491-140734513 ATGTGAGGGCATTGAGCACCTGG - Intergenic
968752030 4:2395214-2395236 CAGTGAGGGCACTGAGCCTCAGG + Intronic
969196701 4:5568965-5568987 CTGTGAGGCCATTAGGCACCAGG + Intronic
970563603 4:17308819-17308841 CATTGATGGTTTTAAGCAACAGG - Intergenic
973362618 4:49178916-49178938 CAGTGAGGTCCAGAAGCAACTGG + Intergenic
974778162 4:66515351-66515373 GAGTGGGTGCATTAAGCAAATGG + Intergenic
976956510 4:90907696-90907718 AAGTGAGGATATTAAACAACGGG - Intronic
977640536 4:99353607-99353629 CAGTGAGACCATGAAGCCACTGG - Intergenic
977835234 4:101637984-101638006 CAGTGAGACCATGAACCAACTGG - Intronic
977945232 4:102905475-102905497 AAATGAAAGCATTAAGCAACAGG + Intronic
979659651 4:123238577-123238599 CAGTCAGGTCCCTAAGCAACAGG - Intronic
983793028 4:171822319-171822341 CAGGGTTGGCATTAAGCAAAGGG + Intronic
984275577 4:177606342-177606364 CAGTGAGACCATGAAGCCACTGG - Intergenic
984970243 4:185182268-185182290 CAGAGAGGGCATTAAAAAAATGG - Intronic
1202759959 4_GL000008v2_random:100388-100410 CAGTGAGGTCCAGAAGCAACTGG + Intergenic
985804748 5:2034562-2034584 CAGTGAGGACATTCAGTGACTGG + Intergenic
986342647 5:6804180-6804202 CAGAGAGGGCATGGAGCAGCAGG - Intergenic
990250278 5:53907010-53907032 CAGAGAGGGGATTAACCAACTGG + Intronic
992760471 5:79947059-79947081 CACTGAGGGAATGAAGGAACAGG + Intergenic
993511005 5:88771395-88771417 AAGTGAGGGCATTAGGTAATAGG - Intronic
1004001523 6:11601125-11601147 CAGTGAGGACTTCAAGCGACAGG - Intergenic
1006412889 6:33885562-33885584 AAGTGAGGGCATGCAGCAACTGG - Intergenic
1006564614 6:34944333-34944355 CAGTGAGGATATGGAGCAACAGG - Intronic
1010813821 6:80331162-80331184 CAGTCATGGCCTTAAGCATCCGG + Intronic
1011776146 6:90732966-90732988 CAGTGAGGGTATGGAGAAACTGG - Intergenic
1012549122 6:100451740-100451762 CAGTGAAGGCACTAAGCAGAAGG + Intronic
1014876094 6:126661948-126661970 GAGTGATGGCATGAAGCAAGAGG + Intergenic
1016659957 6:146566878-146566900 CAGTGATGTCATGAAACAACAGG + Intergenic
1017449590 6:154542007-154542029 CAGTGAGGTCATTAAGAGAATGG - Intergenic
1020508645 7:9024127-9024149 CAGTGACTGCATTAAGGAATCGG + Intergenic
1021263066 7:18482798-18482820 CAGAGAGGGCAGCAAGCCACTGG - Intronic
1026445096 7:70477359-70477381 CAGTGAGGGAAAGAAACAACAGG + Intronic
1029714550 7:102318826-102318848 CAGGGATGGCCTTAAGCACCTGG - Intronic
1030995203 7:116351692-116351714 CAGTGAGAGAAGTAAGCAAAGGG + Intronic
1031530034 7:122865050-122865072 CAGGGAGGGCATTAATCATGAGG - Intronic
1043916494 8:85928706-85928728 CACTGAAGACATTAAGCAAAAGG + Intergenic
1048379069 8:133847930-133847952 CAATGAGGTCATTAAGGAACCGG + Intergenic
1049956543 9:698349-698371 GAGTGAGGGCAGGAAGAAACAGG - Intronic
1051998459 9:23247975-23247997 CAGTGAGAGCTTTAAGCCAGTGG - Intergenic
1055729577 9:79266680-79266702 GAATGAGGGCTTTAAGAAACTGG + Intergenic
1057343284 9:94222950-94222972 TAGTGAGGGTGTGAAGCAACTGG - Intergenic
1057881280 9:98794842-98794864 CAGTGAGGGGAGTAAGAGACAGG - Intronic
1059439398 9:114297300-114297322 CAGTTAGGACATCACGCAACTGG + Intronic
1060014622 9:120076329-120076351 CAGTGAGGGTATGAAGAAAAAGG + Intergenic
1060554963 9:124503497-124503519 CAGAGAGGGGATTACGCGACGGG - Intronic
1188205346 X:27349543-27349565 CAGTGAGCTCATTAAACAATTGG - Intergenic
1189084723 X:38010113-38010135 CAGTGAGGAAACTCAGCAACAGG - Intronic
1193191152 X:78572719-78572741 CAATGAGGGCTTTAATCAGCAGG + Intergenic
1195880297 X:109586356-109586378 CAGGGAGGGCATGAAGCATGGGG - Intergenic
1196671940 X:118377544-118377566 TGGTGAGGGTATTAAGAAACAGG + Intronic
1201640178 Y:16169701-16169723 CAGTCAGGTGATTCAGCAACAGG - Intergenic
1201662636 Y:16415624-16415646 CAGTCAGGTGATTCAGCAACAGG + Intergenic