ID: 1157511174

View in Genome Browser
Species Human (GRCh38)
Location 18:48275987-48276009
Sequence CTCAAGATACAGAGGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 542
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 509}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157511174 Original CRISPR CTCAAGATACAGAGGGAGGA GGG Intronic
900534975 1:3172277-3172299 CCCAAGGTACAGAGGCTGGAAGG + Intronic
900731384 1:4263673-4263695 ATCAGGGTACAGAGGGAGGCAGG + Intergenic
901186834 1:7379028-7379050 CTCAAGAAAGCCAGGGAGGAGGG - Intronic
901539968 1:9909679-9909701 ATCAAACTACAGAGGGAGGAAGG + Intronic
901886654 1:12228308-12228330 CTCCACAGACAGAAGGAGGAAGG - Intergenic
902513759 1:16979452-16979474 CTCAGGATTGAGAGGAAGGAGGG - Intronic
902515859 1:16989317-16989339 CTCAAGAGGCTGAGGCAGGAGGG - Intronic
902974480 1:20079000-20079022 CTCGAGAGGCAGAGGCAGGAGGG + Intronic
902991327 1:20189304-20189326 GTCAGGATTCAGAGGGAGGCAGG + Intronic
904080652 1:27870661-27870683 CTCAGGAGACTGAGGCAGGAGGG - Intergenic
904887004 1:33746368-33746390 CTAAAGTTTCAGAGGGAAGATGG + Intronic
905580373 1:39079732-39079754 ATCAAGAAAGAGAGGAAGGAAGG - Intergenic
906007450 1:42488419-42488441 CTCATGAGACTGAGGCAGGAGGG - Intronic
906662137 1:47590573-47590595 CTGAGGATAGAGAGGGAGGCTGG + Intergenic
907399708 1:54217375-54217397 CTGAAGACACAGAGTCAGGAGGG - Intronic
907998664 1:59658545-59658567 CATAGGATACAGAGTGAGGAGGG + Intronic
908294305 1:62698016-62698038 CTCTTGAAACAGAGGGAGCAGGG + Intergenic
908561770 1:65313158-65313180 CTCAAGAGGCTGAGGCAGGAGGG - Intronic
908946132 1:69499671-69499693 CTCAAGAGAAAGAGGAAGCAAGG + Intergenic
908947427 1:69516524-69516546 CACAAGAACCAGAGGCAGGAGGG - Intergenic
909053964 1:70800837-70800859 CTGAAGATTCAGAAGGAGCAGGG - Intergenic
909921128 1:81381466-81381488 CTCAAGGGACAGAGGCGGGAAGG + Intronic
910330299 1:86065684-86065706 CTCAAGATGCTGAGGTGGGAGGG + Intronic
910672132 1:89784060-89784082 CTCAGGAGGCAGAGGAAGGATGG + Intronic
910750270 1:90621484-90621506 CTCAAGAAGAAGAGGGAGAAAGG - Intergenic
910979621 1:92946645-92946667 ATCAAGAAACAGAGGTAGGCTGG + Intronic
911439282 1:97905243-97905265 CTAAAGATGCAAAGGGAGCAAGG + Intronic
911458857 1:98162977-98162999 CTCCAGGTGCAGAGGGAGTAAGG + Intergenic
912001316 1:104838117-104838139 GTATAGATACAGTGGGAGGAGGG - Intergenic
912537967 1:110389892-110389914 TACAAGATAGGGAGGGAGGAGGG + Intronic
912736402 1:112153013-112153035 CTCCAGATACAGAGGGGACAGGG + Intergenic
913226842 1:116708067-116708089 CTCAAAAGACAGAGCTAGGAGGG + Intergenic
913996599 1:143655909-143655931 CTGAAGACACAGTGGGAAGACGG - Intergenic
914693943 1:150058399-150058421 CTCAGGAGGCTGAGGGAGGAGGG + Intergenic
915043977 1:152995645-152995667 TTCGAGATACAGGGGGAGAAGGG + Intergenic
915407583 1:155673121-155673143 CTCAGGAGGCAGTGGGAGGATGG - Intronic
915815749 1:158963009-158963031 CTGAGGATTCATAGGGAGGAGGG - Intronic
916075357 1:161197355-161197377 TTAAAGCTAGAGAGGGAGGAGGG + Intronic
916264261 1:162874622-162874644 AGCAAGACACAGAGGGAAGATGG - Intergenic
916841950 1:168609862-168609884 CTGAGGAGACAGAGGGGGGAGGG + Intergenic
917311913 1:173687696-173687718 CTCAAAATACAGAACCAGGAAGG - Intergenic
917844525 1:179009396-179009418 CTGAAGCTAGAAAGGGAGGAGGG + Intergenic
918065670 1:181099788-181099810 CTCCGGATACCGAGAGAGGAGGG + Intergenic
919066767 1:192701619-192701641 CTCAAGAAAAAGGGGGAAGAAGG + Intergenic
920496317 1:206457402-206457424 CTGAAGGTACAGAGGAGGGAGGG + Intronic
921185970 1:212669835-212669857 CTCATCCTGCAGAGGGAGGATGG - Intergenic
921744823 1:218728151-218728173 ATTAAGTTACAGAGGGAGGTAGG + Intergenic
922215936 1:223520027-223520049 CTAAAGGTACACATGGAGGAAGG - Intergenic
922429994 1:225541986-225542008 CTCAAGAGACTGAGGTGGGAGGG - Intronic
922637164 1:227185644-227185666 CTACAGAGACAGAGGGAGGGGGG - Intronic
923249498 1:232166929-232166951 GTCAGGAGACAGAGGGAGGTGGG + Intergenic
923433944 1:233950621-233950643 CTCAACATATGGAGGGAGAAAGG - Intronic
923540661 1:234885978-234886000 GCCAAGAAACAGAGGGAGGCTGG + Intergenic
923904010 1:238362343-238362365 CTCAAGAGGCTGAGGCAGGAGGG + Intergenic
924389723 1:243540564-243540586 TACAAGATACAGAGGAAGGTGGG - Intronic
924489153 1:244518101-244518123 CTCATGATACATAAGGAGAAGGG - Intronic
1063255577 10:4323689-4323711 TTGAAGATACTGAGGGAGAAGGG + Intergenic
1063422993 10:5928502-5928524 CTAAAGAGTGAGAGGGAGGAAGG - Intronic
1063917277 10:10896226-10896248 CTCAAGATCCACAGGGCGGTGGG + Intergenic
1063953437 10:11244892-11244914 CACCAGACACAGATGGAGGAAGG - Intronic
1065307077 10:24379485-24379507 CTTAAGAAACACAGGGCGGAAGG + Intronic
1065708291 10:28491370-28491392 CTCAATAGAGAGAGGGAGGGAGG + Intergenic
1066262834 10:33745765-33745787 CTCAGGAAACAGATGGAAGAGGG + Intergenic
1066702483 10:38144868-38144890 CTCAAGAATCAGAGGTAAGAAGG + Intergenic
1066989984 10:42503845-42503867 CTCAAGAATCAGAGGTAAGAAGG - Intergenic
1067739352 10:48882678-48882700 AGCAAGAGAGAGAGGGAGGAGGG + Intronic
1067748786 10:48956513-48956535 AGCAAGAAGCAGAGGGAGGAGGG - Intronic
1068714490 10:60173446-60173468 TTCAAGATACAAAGGAAAGATGG + Intronic
1069312066 10:67050559-67050581 CTCGAGCTACAGAGGGAAGGTGG - Intronic
1070797998 10:79228382-79228404 ATCAAGAGACTGGGGGAGGAGGG + Intronic
1070974331 10:80593915-80593937 CTCAGGAGACTGAGGTAGGAGGG - Intronic
1071371094 10:84952488-84952510 CTCAGGATAGAGAGGGGGAATGG + Intergenic
1071585966 10:86821804-86821826 CTCAAGAAACAAAAGGAGGGAGG - Intronic
1071849994 10:89558877-89558899 CTCCCCGTACAGAGGGAGGAGGG + Intergenic
1071904825 10:90161299-90161321 CTCAAGATCAAGAGGAAGGCTGG - Intergenic
1073909189 10:108321108-108321130 GTTAAGACACACAGGGAGGATGG - Intergenic
1075470871 10:122688045-122688067 CTCAGGTTTCAGAGGGAGGTTGG + Intergenic
1077303237 11:1856652-1856674 CTCCAGATTCTGAAGGAGGAAGG + Intronic
1077465153 11:2730502-2730524 CATAAGAGAAAGAGGGAGGAAGG - Intronic
1078467139 11:11558754-11558776 CCCAAGATGAAGAGGCAGGAAGG - Intronic
1078520842 11:12061696-12061718 CTCAGGGTTCAGAGGGAGCATGG + Intergenic
1079008589 11:16810273-16810295 TTCAAGATCCAGATGAAGGAAGG - Intronic
1079474859 11:20819509-20819531 GTCAAGATTCAGAGGCAGAAAGG + Intronic
1080027326 11:27628228-27628250 ATAAAGATACAGAGGAAGGCAGG - Intergenic
1080401614 11:31941612-31941634 GTCAAGAGGCAGAGGGAGCAAGG + Intronic
1081098610 11:38972073-38972095 CTCCAGATACAGATGGGAGATGG + Intergenic
1081235564 11:40643470-40643492 CTGATGATACAAAGGGTGGAGGG - Intronic
1081993674 11:47350663-47350685 CTCAGGAGAGAGAGGGTGGAGGG - Intronic
1082771197 11:57208897-57208919 CTCAAGAGGCTGAGGCAGGAGGG + Intergenic
1083002023 11:59301212-59301234 CTCAAGAAACAGAAGGAAGTGGG + Intergenic
1084330824 11:68429143-68429165 CTCAAGAGGCTGAGGCAGGAGGG + Intronic
1084415366 11:69029264-69029286 TTTAGGAAACAGAGGGAGGAGGG - Intergenic
1084825027 11:71723485-71723507 TTCAAGCTAGAGAGGGAGAAAGG + Intergenic
1085064757 11:73484077-73484099 CTGAAGATAAGGAGGGAGGAAGG - Intronic
1086212304 11:84335247-84335269 ATGAAGGAACAGAGGGAGGAAGG + Intronic
1087529950 11:99367714-99367736 CACAAGAGAAAGAGGGAGGTAGG + Intronic
1088811485 11:113395564-113395586 CTCTAGAAATAGAGGCAGGAAGG - Intronic
1090758072 11:129812541-129812563 CTCAAGGGAAAGTGGGAGGAGGG + Intergenic
1091661262 12:2385524-2385546 CTAAGGCTACAGAGGGAGGGAGG - Intronic
1092139423 12:6172506-6172528 CTGAAGTTCCAGAGGGAGGAAGG + Intergenic
1092629267 12:10361072-10361094 TTGTAGAGACAGAGGGAGGAGGG + Intergenic
1092752597 12:11732689-11732711 CTCTAGAGGCAGAAGGAGGACGG - Intronic
1093585229 12:20827961-20827983 CTCAAGGTACAGAGAGAGAGTGG + Intronic
1093890342 12:24512523-24512545 GCCAAGATACAGAGGGAAAAAGG - Intergenic
1094526356 12:31233845-31233867 CTCATGAAAAAGAGGGAGAAAGG - Intergenic
1094614361 12:32022810-32022832 GTAAAGAGACAGAGGGAGGGGGG - Intergenic
1095536897 12:43259929-43259951 CTCAAAATACACAGACAGGAGGG + Intergenic
1095878737 12:47109265-47109287 CTCCATTTACAGAGAGAGGAAGG - Intronic
1096362743 12:51002238-51002260 TTCAAGAGACAGAGGTAGGAAGG + Intronic
1096418477 12:51434690-51434712 CTAGAGAAACAGAGGGAGGGAGG - Intronic
1096828409 12:54296550-54296572 ATGAAGATACAGGGGCAGGAGGG - Intronic
1097861608 12:64523634-64523656 CTCCAGTTACAGGAGGAGGAAGG - Intergenic
1098281719 12:68868692-68868714 GACAGGATACAGTGGGAGGAGGG - Intronic
1100129794 12:91477590-91477612 GCCAAAATACAGAGGCAGGAAGG - Intergenic
1100641486 12:96485721-96485743 CTCAAAAAAAAGAGAGAGGAGGG - Intergenic
1101408899 12:104453241-104453263 GACAAGATGAAGAGGGAGGAAGG - Intergenic
1101458493 12:104863325-104863347 TTCAAGAAACTGAGGCAGGAGGG + Intronic
1103024550 12:117562996-117563018 CTCTGGAGACAGAGGGAAGAGGG + Intronic
1103081319 12:118026274-118026296 ATCAAAATACAAAGTGAGGAGGG - Intronic
1103665868 12:122565215-122565237 CTCAAGAGAAAGAGGGACCAAGG - Intronic
1103842030 12:123872701-123872723 CTCAAGAGACTGAGGAAGAAGGG + Intronic
1104195282 12:126531239-126531261 CTCAAGAGGCTGAGGCAGGAGGG - Intergenic
1104206394 12:126642763-126642785 CTCATTATACCGAGGGGGGAAGG + Intergenic
1106014111 13:25851948-25851970 CTCAGGAAACTGAGGCAGGACGG - Intronic
1107712741 13:43166748-43166770 CTGAAAATACAGAGGATGGATGG + Intergenic
1108350208 13:49585158-49585180 CTCAAAAAAGAGAGGGAGGCAGG + Intronic
1108915027 13:55597926-55597948 CTCCAGATACAGAGAGACAATGG - Intergenic
1110406915 13:75160910-75160932 CTCCAGATCCAGAAGGAGGGTGG - Intergenic
1110483290 13:76008523-76008545 CTAAAGATACAAAAGGAGTAAGG - Intergenic
1110953456 13:81522753-81522775 GTAAAGAGACAGAGGGAGGGGGG + Intergenic
1111494939 13:89035309-89035331 AGCAAGAGAAAGAGGGAGGAGGG - Intergenic
1112306031 13:98274404-98274426 CAGAAGAGACTGAGGGAGGAAGG + Intronic
1112369750 13:98784395-98784417 GTGAAGACACAGGGGGAGGATGG - Intergenic
1113095791 13:106662691-106662713 CTCAGGAGACTGAGGCAGGAGGG - Intergenic
1113591723 13:111506228-111506250 CTCCAGATGCAAAGGCAGGAGGG - Intergenic
1113991164 14:16029376-16029398 AGCAAGAAACAGAGAGAGGAAGG - Intergenic
1114404636 14:22444899-22444921 CTGAAAATACAGAGGGACTACGG - Intergenic
1114767396 14:25389497-25389519 GTTAAGAGTCAGAGGGAGGAAGG - Intergenic
1115112748 14:29843221-29843243 GTGAAGATACAGAGAGAAGATGG + Intronic
1117224979 14:53647282-53647304 AGAAAAATACAGAGGGAGGAAGG - Intergenic
1117701646 14:58419806-58419828 CTCAAGAGGCTGAGGTAGGAAGG + Intronic
1118213875 14:63790001-63790023 CTCATTCTACAGAGGGAGGGTGG - Intergenic
1118470987 14:66075181-66075203 CTCAGGCTGCAGAGGGAGGCAGG - Intergenic
1118837238 14:69485606-69485628 CTCAGGCTAAGGAGGGAGGAAGG + Intronic
1119582738 14:75801604-75801626 CACAAAATACAGAGGGTGGGGGG - Intronic
1119662095 14:76459410-76459432 CTGGAGAAACAGAGGGTGGAGGG + Intronic
1120252657 14:82077968-82077990 CTCAACAATCAGAGGGAGGTAGG - Intergenic
1120978082 14:90267000-90267022 CTCAGGATACAGAGGCAGTTAGG - Intronic
1121251614 14:92503985-92504007 TGCAAGATAAAGAGGGAGAAGGG - Intergenic
1122720424 14:103718836-103718858 CTCTAGATTCAGAGCCAGGAAGG + Intronic
1124653981 15:31493970-31493992 CTCAAAGCAGAGAGGGAGGAGGG + Intronic
1125124992 15:36209776-36209798 GTGAAGATAGAGAGGGAAGAAGG + Intergenic
1125200072 15:37095431-37095453 CTCTAGGGAGAGAGGGAGGAAGG - Intronic
1125607610 15:40950368-40950390 CTCAGGAGACCGAGGCAGGAGGG - Intergenic
1125994131 15:44140773-44140795 CTCAAGAGGCTGAGGTAGGAGGG + Intronic
1126272089 15:46831785-46831807 CTCAAGATTCATAGGGCAGAAGG + Intergenic
1127217044 15:56834207-56834229 CTCAAGGTACAGAGGCTAGAAGG + Intronic
1127224630 15:56917165-56917187 CCCCAGATACGGAGGGCGGACGG - Intronic
1127315463 15:57790389-57790411 GACAAGCTACAGAGGGAGGCTGG - Intergenic
1129425643 15:75460577-75460599 CTCAAGAGGCTGAGGCAGGAAGG + Intergenic
1130091534 15:80825057-80825079 CACCAGCTAAAGAGGGAGGAAGG + Intronic
1130102783 15:80906517-80906539 CTCATGTTACAGAAGGATGAAGG - Intronic
1130116624 15:81010805-81010827 CTCCAGAAAGAGAGGGATGAGGG - Intronic
1131757041 15:95576040-95576062 CCCAGGACACAGTGGGAGGATGG - Intergenic
1132023880 15:98388240-98388262 CACATGATACAGAGGGAGACTGG + Intergenic
1132773552 16:1578817-1578839 CTCAGGAGACTGAGGCAGGAGGG - Intronic
1133675620 16:8068760-8068782 ATAAAGATACTGAGGGAGCAAGG + Intergenic
1134511362 16:14850338-14850360 TTCTAGAGAAAGAGGGAGGAGGG + Intronic
1134699006 16:16248835-16248857 TTCTAGAGAAAGAGGGAGGAGGG + Intronic
1134972831 16:18545838-18545860 TTCTAGAGAAAGAGGGAGGAGGG - Intronic
1135031480 16:19042280-19042302 CTCGAGAGACTGAGGCAGGAGGG - Intronic
1135075234 16:19387473-19387495 CTCAAGAGAGAGAAAGAGGAAGG + Intergenic
1135117493 16:19735956-19735978 CTCAAGAGGCTGAGGCAGGAAGG + Intronic
1136619248 16:31417042-31417064 CTCAAAAAAAAGAGGGAGGGAGG - Intronic
1136910349 16:34140508-34140530 AGCAAGAAACAGAGAGAGGAAGG - Intergenic
1137482953 16:48867506-48867528 CTCAAGCTGCAGAGAGAGAAGGG - Intergenic
1137532445 16:49287949-49287971 CTGAAGATGGAGAAGGAGGAAGG - Intergenic
1137553733 16:49457118-49457140 CTCAGGAGACTGAGGCAGGAGGG + Intergenic
1137694141 16:50449904-50449926 CTCAAGCTACAGACTGACGAGGG + Intergenic
1138426684 16:56938787-56938809 CTATAGATTCAGATGGAGGATGG + Intronic
1138479828 16:57294891-57294913 CTCAGGAGACTGAGGCAGGAGGG + Intergenic
1138756340 16:59490654-59490676 CTAAAGACACAGAGTCAGGAAGG + Intergenic
1139056710 16:63194554-63194576 GTCAGGAGACAGAGGCAGGAGGG + Intergenic
1139249322 16:65479880-65479902 CTGAAGAAATAGAGGTAGGAGGG + Intergenic
1139308826 16:66011196-66011218 CCCAGGAAACAGAGGGAGCATGG - Intergenic
1139619010 16:68121972-68121994 CTCAAGATCTACGGGGAGGAAGG - Exonic
1139647270 16:68340471-68340493 CTCAGGAGACTGAGGCAGGAGGG + Intronic
1140292512 16:73673876-73673898 CTCCAGATACAGATCCAGGAAGG + Intergenic
1140682035 16:77394568-77394590 CTTAATATACAGAAAGAGGAGGG + Intronic
1141198381 16:81878586-81878608 CTCAAGAGACAGTAGGAAGAAGG - Intronic
1141879464 16:86848146-86848168 CTCCAGATTCAGAGGCAGGCAGG - Intergenic
1141985632 16:87577864-87577886 CTCAAGAGGCTGAGGCAGGATGG + Intergenic
1142201984 16:88765452-88765474 CTCAAGGCACAGAGAGGGGAGGG - Intronic
1203142315 16_KI270728v1_random:1776240-1776262 CTCATGACACATAAGGAGGATGG - Intergenic
1142763275 17:2053181-2053203 CACAAGATACATGGGGCGGAGGG + Intergenic
1143505704 17:7363819-7363841 CCCAAGAGACAGAGAGTGGAAGG - Intergenic
1143986195 17:10916497-10916519 ATCAACATAAAGAGGGAGAAAGG + Intergenic
1145206857 17:20989097-20989119 CTCTACATACAGAAGCAGGAGGG + Intergenic
1145416493 17:22717501-22717523 GGCAAGGGACAGAGGGAGGAAGG - Intergenic
1145981241 17:29012965-29012987 ATCAAGAAACTGAGGGAGGCTGG + Intronic
1146469111 17:33110394-33110416 TTCCAGATGCAGAGGGACGAAGG - Intronic
1146730989 17:35193858-35193880 CTCAAGGCAGAGAGTGAGGACGG + Exonic
1148204371 17:45770708-45770730 ACCAAGGTCCAGAGGGAGGAAGG + Intergenic
1148463032 17:47848905-47848927 CTCAGGATACAGATGGGAGAGGG + Intronic
1148658627 17:49309014-49309036 TACAAGAGAAAGAGGGAGGAAGG + Intronic
1150417264 17:64997565-64997587 TTCAAGATGAAGAGTGAGGAGGG - Intergenic
1150639903 17:66942518-66942540 CTGGAGGGACAGAGGGAGGAGGG + Intergenic
1150825423 17:68470611-68470633 GCCAAGATACATAGTGAGGAAGG + Intergenic
1150941249 17:69696934-69696956 CTCAATATCCAGAGGCAGAAAGG - Intergenic
1150988263 17:70224524-70224546 CTAAAAATTCAGAGAGAGGAAGG - Intergenic
1151021553 17:70623151-70623173 CTGAAGATAGAGAGGGTTGATGG - Intergenic
1152251609 17:79215473-79215495 CTCAAGGAACAGATGGAGAAAGG - Intronic
1152469606 17:80483354-80483376 CTGAGGGTGCAGAGGGAGGACGG + Intergenic
1152728049 17:81957317-81957339 GTAAAGAGACAGAGAGAGGAAGG - Intronic
1152859879 17:82690162-82690184 CTGAAGAATCAGAGGGAGCATGG + Intronic
1153469754 18:5430669-5430691 CTCAGGAGGCTGAGGGAGGAGGG - Intronic
1154274994 18:12950927-12950949 CTCAAGAGGCTGAGGCAGGAGGG - Intronic
1156585197 18:38424283-38424305 TTCAAGAAAGAGATGGAGGAGGG - Intergenic
1157511174 18:48275987-48276009 CTCAAGATACAGAGGGAGGAGGG + Intronic
1158060981 18:53341206-53341228 CTCAACAGACAGAGGGAGGGAGG + Intronic
1158533710 18:58287463-58287485 CTCATGATCCTGAGGGAGGCTGG - Intronic
1159300976 18:66567274-66567296 AGCAAGAAGCAGAGGGAGGAAGG + Intronic
1159794214 18:72822228-72822250 CTCAAGTCTCAGAGGGTGGAGGG + Intronic
1160107607 18:75992959-75992981 CTTAACATACAGGGGGAGAAAGG + Intergenic
1160400314 18:78605964-78605986 CTTAGGATGCAGAGGGAGGATGG - Intergenic
1160628686 18:80230518-80230540 CCCAAGATCCAGAGTGATGATGG + Intronic
1161465731 19:4429255-4429277 CTGAAGGGACAGATGGAGGAGGG - Intronic
1161532551 19:4798802-4798824 CTCAGGATGCGGAGGCAGGATGG - Exonic
1163212201 19:15849413-15849435 CTCAGGAGGCAGAGGCAGGAGGG - Intergenic
1163821637 19:19499541-19499563 CCCAGGATACAGAGGGAGGAGGG + Intronic
1164109299 19:22140184-22140206 CTCCTGATGCAGAGGGAGGCTGG + Intergenic
1164240648 19:23385217-23385239 ATCAAGCTGCAGGGGGAGGAGGG - Intronic
1165040189 19:33063596-33063618 CTCAGGACCTAGAGGGAGGAAGG + Intronic
1165179508 19:33955722-33955744 CTCAAAATAAAGAGAAAGGAAGG - Intergenic
1165312752 19:35038923-35038945 CTCGAGTTACACAGGGAGGCAGG + Intronic
1165409580 19:35651087-35651109 CTCAACATACACAGAGATGAGGG - Intronic
1165412877 19:35673209-35673231 CTGGGGAGACAGAGGGAGGACGG - Intronic
1165891911 19:39117728-39117750 CTGAAGATCTGGAGGGAGGAAGG - Intergenic
1167035422 19:46992544-46992566 CTCCAGATAGGCAGGGAGGAGGG - Intronic
1167793008 19:51692373-51692395 CTCATGAGTCTGAGGGAGGAAGG + Intergenic
1168155643 19:54472177-54472199 CTCATGAGTCTGAGGGAGGAGGG - Intronic
1168155698 19:54472326-54472348 CTCATGAGTCTGAGGGAGGAGGG - Intronic
1168155917 19:54472923-54472945 CTCATGAGTCTGAGGGAGGAGGG - Intronic
1168254414 19:55157878-55157900 CTCCAGGATCAGAGGGAGGAGGG - Intronic
1168254839 19:55159642-55159664 CTCCAAATCCGGAGGGAGGATGG + Intronic
924961266 2:36602-36624 ATCAAGAAAGGGAGGGAGGAGGG - Intergenic
925428493 2:3771132-3771154 CGGAGGATGCAGAGGGAGGACGG - Intronic
925588949 2:5491156-5491178 GTCAGGATGCAGAGGGAGCAGGG + Intergenic
926686948 2:15705311-15705333 GCCAAGATACAGAGGCAGGCGGG - Intronic
926746338 2:16161435-16161457 CTGGAAATACACAGGGAGGATGG + Intergenic
926838682 2:17053403-17053425 CTCAAGAGGCTGAGGCAGGAGGG - Intergenic
926924124 2:17969363-17969385 ATCACGATACAGAGGCAGCAGGG + Intronic
926948297 2:18213459-18213481 GTCAAAATACACAGGAAGGACGG + Intronic
927352491 2:22133754-22133776 CAAATGATAGAGAGGGAGGAGGG - Intergenic
927802969 2:26118312-26118334 CTCAAAAAAAAGGGGGAGGAGGG - Intronic
928031636 2:27784628-27784650 ATAAAGACACAGAAGGAGGAAGG + Intronic
929505891 2:42527745-42527767 CTCAAGACACTGAGGTAGGAGGG + Intronic
929826007 2:45310242-45310264 CTCAGGATACTGAGAGAGGATGG - Intergenic
929826031 2:45310340-45310362 CTCAGGATACTCAGAGAGGATGG - Intergenic
929826133 2:45310753-45310775 CTCAGGATACGCAGAGAGGATGG - Intergenic
929826158 2:45310851-45310873 CTCAGGATACTCAGAGAGGATGG - Intergenic
930713044 2:54567212-54567234 CTTAAAGTACAGAGTGAGGATGG + Intronic
930775546 2:55166750-55166772 CTGAAGATACAAAGGGATCAAGG + Intergenic
931202073 2:60106993-60107015 TTCAGGATACAGATGGAGGGAGG + Intergenic
931269698 2:60690537-60690559 CTAAAGAAAGAGAGGGATGAAGG - Intergenic
931617468 2:64174663-64174685 ATCAAGCTATAGAGGGAGAAGGG - Intergenic
932959305 2:76394133-76394155 GTGAAGATGCAGAGGGAAGATGG - Intergenic
933992295 2:87642477-87642499 ATCAAGATACAGGGGCAGGGAGG + Intergenic
934721214 2:96578257-96578279 CTCAAGAGACTGAGGTGGGAAGG - Intergenic
936301555 2:111308362-111308384 ATCAAGATACAGGGGCAGGGAGG - Intergenic
936634144 2:114236144-114236166 CCCAAGAAAGAGAGAGAGGAAGG + Intergenic
936634161 2:114236285-114236307 CCAAAGAGACAGAGAGAGGAAGG + Intergenic
937677616 2:124609162-124609184 CTCAGTATACAGTGGGAGCAAGG + Intronic
937752734 2:125497474-125497496 GTACAGAGACAGAGGGAGGAGGG - Intergenic
938954635 2:136286486-136286508 TTCAAGTTTCAGAGGGAGCATGG - Intergenic
940509228 2:154591623-154591645 CTCAAGAGAAAGAGGCAAGATGG + Intergenic
940717968 2:157249346-157249368 CTCAAAACATTGAGGGAGGAAGG - Intergenic
941981612 2:171464451-171464473 TTGAAGACACAGAGGGAGAAAGG - Intronic
942608444 2:177716236-177716258 CTCCAGCTACAGAGAGGGGATGG + Intronic
942922240 2:181389577-181389599 CTGAAGAAACAGATGCAGGAAGG - Intergenic
943453455 2:188074313-188074335 ATCAAGATACAGAAGAAGGTTGG - Intergenic
943726368 2:191255777-191255799 CTCAAAATGCAGAGGGGGTAGGG - Intronic
943783638 2:191851898-191851920 TTCATGATACAGAGAGTGGATGG - Intergenic
943974725 2:194459152-194459174 CTCATGATACATGGGGAGTATGG + Intergenic
944454924 2:199883525-199883547 CTCAAGTTAATGAGGGTGGAGGG - Intergenic
944839144 2:203608657-203608679 GTCAAGGTGCAGAGGGAGTATGG - Intergenic
945942668 2:215965470-215965492 CAGGGGATACAGAGGGAGGAAGG + Intronic
946026389 2:216674202-216674224 CTCAAGATGCAAAGGGAGAATGG + Exonic
946664263 2:222032760-222032782 CTAAACATCCAGGGGGAGGAGGG - Intergenic
946842726 2:223834647-223834669 CTCAAGAAGCTGAGGTAGGAGGG + Intronic
947286756 2:228525326-228525348 CTTAAGAATGAGAGGGAGGAGGG + Intergenic
947442812 2:230138009-230138031 CAGAAGACACAGAGGGAGGTAGG - Intergenic
947507193 2:230716892-230716914 CTCAAGAGGCTGAGGCAGGAGGG + Intronic
947812214 2:233011693-233011715 CTCAGGAGGCAGAGGCAGGAGGG - Intronic
947830233 2:233134378-233134400 CTCAAGATTTAGAGGAGGGATGG + Intronic
948870571 2:240795835-240795857 CTCAAGGTTCAGGGGCAGGAGGG + Intronic
1169172992 20:3480594-3480616 CCTAACATACAGAGGGAGGGAGG + Intronic
1169712410 20:8579848-8579870 ATCAGGAGACAGAGGGAGCAAGG + Intronic
1171079071 20:22159656-22159678 CACTAGAGAGAGAGGGAGGAGGG - Intergenic
1171444652 20:25195217-25195239 GTCAAGAAACGGTGGGAGGAGGG + Intergenic
1171456223 20:25274106-25274128 CTCAAGATAGACAGTGGGGACGG - Intronic
1171770723 20:29320330-29320352 AGCAAGAAACAGAGAGAGGAAGG + Intergenic
1171813419 20:29763097-29763119 AGCAAGAAACAGAGAGAGGAAGG + Intergenic
1171905817 20:30899239-30899261 AGCAAGAAACAGAGAGAGGAAGG - Intergenic
1172733566 20:37109074-37109096 CTCAAGAGGCTGAGGGAGGTAGG + Intronic
1174005283 20:47405980-47406002 CTCAGGATGCTGAGGAAGGAGGG - Intergenic
1174257552 20:49269351-49269373 TTCAGGATAGAGTGGGAGGAGGG + Intronic
1174710299 20:52697437-52697459 CTCAAGAGGCTGAGGCAGGAGGG - Intergenic
1174790067 20:53469751-53469773 AGAAAGATAGAGAGGGAGGAAGG + Intronic
1174988129 20:55478940-55478962 AACAAGATTCAGAGGGAGGAGGG + Intergenic
1175010969 20:55735628-55735650 CTCAGGAGAAAGAGGAAGGATGG - Intergenic
1176668484 21:9709608-9709630 ATCAAGACGCAGAGGAAGGAAGG + Intergenic
1176984534 21:15420785-15420807 CTCAGGTCACTGAGGGAGGATGG + Intergenic
1178251167 21:31004611-31004633 TCCAAGATGCAGAGGGAGCAAGG + Intergenic
1178826860 21:36024525-36024547 CTCAGGAGACGGAGGCAGGATGG + Intergenic
1179721802 21:43320549-43320571 CTGAAGATACAGGGAGAAGACGG + Intergenic
1180316104 22:11278148-11278170 AGCAAGAAACAGAGAGAGGAAGG + Intergenic
1180338467 22:11599797-11599819 ATCAAGAAACAGAGAAAGGAAGG - Intergenic
1180339233 22:11605340-11605362 AGCAAGAAACAGAGAGAGGAAGG - Intergenic
1181737496 22:24893241-24893263 CTGAAGACACAAAGGGAGCAAGG - Intronic
1181802693 22:25357919-25357941 CTCAGCACCCAGAGGGAGGAAGG + Intronic
1181948774 22:26539397-26539419 AGCAAGGGACAGAGGGAGGAAGG + Intronic
1182734288 22:32520243-32520265 CTCTAGAGACTGAGGCAGGAGGG - Intronic
1183523602 22:38310732-38310754 CTTATGATGCAGAGGGAGAAGGG + Intronic
1183873691 22:40760694-40760716 CTCAGGAGACTGAGGCAGGAGGG + Intergenic
1183924164 22:41193847-41193869 CTCAAAAAAGGGAGGGAGGAAGG + Intergenic
1183973333 22:41495132-41495154 CTCAAGAGGCTGAGGCAGGAGGG - Intronic
1184457324 22:44618569-44618591 CTCCAGGTGCAGAGGGAGAAGGG + Intergenic
1184696510 22:46142372-46142394 CTCAGGAGGCAGAGGCAGGAGGG + Intergenic
1185061598 22:48609889-48609911 GTTAGGACACAGAGGGAGGACGG - Intronic
1185157564 22:49203356-49203378 CTCAAGATGCAGAGGAAGGAAGG + Intergenic
1185354642 22:50360468-50360490 CTCAGGAAACTGAGGCAGGAGGG - Intronic
949493158 3:4608492-4608514 CTCAAGAAGGATAGGGAGGAAGG + Intronic
949996723 3:9623117-9623139 CTACAGTTACAGAGGGAGCATGG + Intergenic
950345813 3:12291491-12291513 CTCAAAATACAGAGGTAGATTGG + Intronic
950358958 3:12437001-12437023 CTCCACACACAGCGGGAGGAAGG - Intergenic
951778051 3:26332136-26332158 CTGGAGATACTGAGAGAGGAGGG + Intergenic
952439960 3:33316697-33316719 CTCAAAATACAGGTGGATGAGGG - Intronic
952582893 3:34855425-34855447 GTCAAGAGGCAGAGGGAGAAAGG + Intergenic
953563364 3:44011947-44011969 CCCAGGATACAGAGCTAGGAGGG - Intergenic
954034089 3:47841173-47841195 CTCAAGGTACAGATGGAGGATGG + Exonic
954485269 3:50844321-50844343 CTCAGGAGGCTGAGGGAGGACGG - Intronic
955817424 3:62860388-62860410 CTGCAGATACTGAGGGATGATGG - Intronic
955914844 3:63896550-63896572 CTGAAGAAACAGATTGAGGAAGG - Intronic
956001193 3:64731695-64731717 AGCAAAATAAAGAGGGAGGAGGG - Intergenic
956797865 3:72732421-72732443 CTAAAGAGAGAGAGAGAGGAAGG - Intergenic
956798303 3:72735695-72735717 CTAAAGAGAGAGAGAGAGGAAGG + Intergenic
958574244 3:95927060-95927082 CTACAGAAACAGAGGGAGGGGGG + Intergenic
961484387 3:127206971-127206993 CCCAAGAGGCAGAGAGAGGAGGG - Intergenic
962311568 3:134330594-134330616 TTCAAGATAGAGAGGAAGGTGGG - Intergenic
962458906 3:135591058-135591080 CTACAGAGACAGAGGGAGGGTGG - Intergenic
963027284 3:140932600-140932622 CTCAGGAGACTGAGGCAGGAGGG + Intergenic
963327355 3:143877153-143877175 CTCAAGATGGAGGAGGAGGAGGG - Intergenic
965440452 3:168706648-168706670 CTCAAAATACAGAGGAAGTTTGG + Intergenic
965631166 3:170734392-170734414 CCCAAGCTACAGAGGGAGAGAGG - Intronic
969922911 4:10557527-10557549 CCCTAGATGCAGAGGGATGAGGG - Intronic
970199683 4:13590973-13590995 CTCAAGGGACTGAGGTAGGATGG + Intronic
970463090 4:16295573-16295595 CTCAAAATATAGAGGGAGGTGGG + Intergenic
972752567 4:42006577-42006599 CTCAAGATGTTGAGGTAGGAGGG + Intronic
973759548 4:54103688-54103710 GTCAAGGGACATAGGGAGGAGGG + Intronic
973973144 4:56235140-56235162 TTAAAGATACAGTGGGAGTAGGG + Intronic
975460767 4:74650976-74650998 CTCAGGAGGCTGAGGGAGGATGG + Intergenic
975533435 4:75424331-75424353 CTTAAGAAACAGAGGAAGGCAGG - Intergenic
976172776 4:82321444-82321466 CTCAAGAGGCTGAGGCAGGAGGG + Intergenic
976278734 4:83305677-83305699 CACCAGATACAGTTGGAGGAAGG + Intronic
976639591 4:87323949-87323971 CTCAAGTGGCAGAAGGAGGAAGG + Intergenic
976703385 4:87995510-87995532 ATCAAGAAACAGGAGGAGGAGGG + Intergenic
978558473 4:110006235-110006257 CTCAAGAGACTGAAGCAGGAGGG + Intronic
979212346 4:118120318-118120340 CTCAGGAGGCAGAGGGAGCAGGG + Intronic
979980431 4:127248037-127248059 CTAAAGCTGCAGAGGTAGGATGG - Intergenic
980449889 4:132957639-132957661 GTCAAGATACAGAGGGAAGGTGG + Intergenic
982342753 4:154320449-154320471 CTCACGATCCAGACGAAGGAAGG - Exonic
982448164 4:155519122-155519144 GTAAAGAAACAAAGGGAGGAGGG + Intergenic
982743959 4:159087006-159087028 CTTGAGAGACAGAGGCAGGAGGG + Intergenic
983236941 4:165190205-165190227 CTCAGGAGACTGAGGCAGGAGGG + Intronic
983647133 4:170003420-170003442 CTCAATACACAGATGAAGGAGGG + Intronic
983868169 4:172792845-172792867 ATATAGATAAAGAGGGAGGAAGG - Intronic
984674899 4:182535630-182535652 CTCCAGAGACTGAGGTAGGAGGG + Intronic
984736478 4:183113268-183113290 ATGTAGAAACAGAGGGAGGAGGG + Intronic
985004969 4:185525201-185525223 CTCAAGATACTGCGGGATGTTGG - Intronic
985406295 4:189641900-189641922 ATCAAGACGCAGAGGAAGGAAGG - Intergenic
985763375 5:1763365-1763387 CTCTAGACACAGAGGGTGGCCGG + Intergenic
985864568 5:2504326-2504348 CACATGATACAGAGGGTGGAAGG - Intergenic
985884313 5:2664796-2664818 TTTGAGATAGAGAGGGAGGAAGG + Intergenic
986108155 5:4680770-4680792 ATTAAAATACAGAGGGATGAAGG + Intergenic
986158796 5:5204431-5204453 ATCAAGATACAGAGTGTGGTAGG + Intronic
986759794 5:10869479-10869501 TTCAAGGTAGAGAGGAAGGAAGG - Intergenic
986952868 5:13112234-13112256 AGCAAGAGACAGAGGGAGGGAGG - Intergenic
987438021 5:17921812-17921834 ACCAAGATACAGAGGTAGGGAGG + Intergenic
987910430 5:24136864-24136886 CTCAAGATTGAGAGGCAGGAAGG + Intronic
988035165 5:25818248-25818270 GTCAAGATACAGGGAGAAGATGG + Intergenic
988483276 5:31647138-31647160 CTCAAGATAAAGACGGAGCCTGG - Intronic
989134032 5:38135691-38135713 AGCAAGAGACAAAGGGAGGAAGG - Intergenic
989138834 5:38182141-38182163 CCCAAGAGAAAGAAGGAGGATGG - Intergenic
990767866 5:59207267-59207289 TTTAATATACAGAGGGAAGAGGG + Intronic
990873500 5:60459484-60459506 CCCAAGATACAGAGAAAGGAGGG + Intronic
991006831 5:61836167-61836189 CTCAAGAGAGAGATGGTGGAAGG + Intergenic
991509511 5:67361230-67361252 CTCAAGAGAAGGAGTGAGGATGG - Intergenic
991723026 5:69511517-69511539 CTCAGGAGACTGAGGTAGGAGGG - Intronic
992391888 5:76337239-76337261 CTGAAGACACAGAGAGAAGATGG - Intronic
993313415 5:86367870-86367892 TTCACTATACTGAGGGAGGATGG + Intergenic
994595050 5:101821531-101821553 CTCAAGAGGCTGAGGCAGGAGGG - Intergenic
995469968 5:112490955-112490977 ATAGAGACACAGAGGGAGGAAGG + Intergenic
995810169 5:116097803-116097825 AACAAGAGAGAGAGGGAGGAGGG + Intronic
996410954 5:123158353-123158375 TTGGAGATGCAGAGGGAGGAAGG + Intronic
996474919 5:123906526-123906548 CTCAGGAGACAGAGAGAGAAGGG + Intergenic
996833806 5:127768994-127769016 CTCATGCTACAGAGAAAGGAGGG - Intergenic
997002667 5:129781037-129781059 CTCCAGCTACATAGGGAGGCTGG - Intergenic
997183262 5:131855522-131855544 CAAAAGAGAGAGAGGGAGGAAGG + Intronic
997512692 5:134464454-134464476 CTCAGGATGCTGAGGCAGGAGGG - Intergenic
998086572 5:139330896-139330918 CTCAGGAGACTGAGGTAGGAGGG - Exonic
999633158 5:153592606-153592628 TCCAAGATAGAAAGGGAGGAGGG - Intronic
999916511 5:156268590-156268612 CTCAAAATAGAAAGGAAGGAAGG - Intronic
1001482551 5:172098493-172098515 CACAGGATGCAGAGGAAGGATGG + Intronic
1001886273 5:175293388-175293410 CTCAGGCTCCAGTGGGAGGAGGG - Intergenic
1001911778 5:175525714-175525736 CTCAGGATGCTGAGGCAGGAGGG - Intronic
1003460232 6:6321864-6321886 TTGGAGATGCAGAGGGAGGAGGG - Intergenic
1003860817 6:10320093-10320115 TTCATGATACAGAGGGAGGGAGG - Intergenic
1007474502 6:42109843-42109865 TGGAAGATACAGAGGTAGGAGGG + Intronic
1007727739 6:43926869-43926891 CTCAGGCGGCAGAGGGAGGAGGG - Intergenic
1007825413 6:44596191-44596213 CTAAGGATATGGAGGGAGGAAGG - Intergenic
1009733891 6:67649194-67649216 CTCAAAATACAAAGAGAAGAAGG - Intergenic
1010106388 6:72174117-72174139 CTCAAATCACAGATGGAGGAGGG - Intronic
1011647272 6:89471815-89471837 TTCAAGATAGAGAAGGAGGGAGG + Intronic
1011720538 6:90151390-90151412 CTCAGGAGACTGAGGCAGGAGGG - Intronic
1012774002 6:103479949-103479971 CTCAATATCCACAGGGAGAAAGG + Intergenic
1012988311 6:105898563-105898585 CCCAATGTACTGAGGGAGGATGG + Intergenic
1013958269 6:115866429-115866451 GTCTAGCTACAGAGGAAGGAGGG - Intergenic
1014641559 6:123916880-123916902 CTCTTGATACAGAGAGAGGTAGG - Intronic
1015349767 6:132203913-132203935 CAGAAGTTAGAGAGGGAGGAAGG - Intergenic
1015450968 6:133365584-133365606 GTCAGGATGCAGAAGGAGGAAGG + Intronic
1015765284 6:136709822-136709844 CTCAAGAGGCAGAGGCAGGAGGG + Intronic
1016379174 6:143456176-143456198 ATTTAGACACAGAGGGAGGAAGG + Intronic
1016800004 6:148158737-148158759 CTCAACATACATAGGAAGGAAGG + Intergenic
1017039323 6:150295117-150295139 CTGAAGAGACAAAGGGAGGAAGG + Intergenic
1017996243 6:159534036-159534058 CTCAGCAAACAGAGTGAGGATGG + Intergenic
1018154307 6:160971389-160971411 CTCAAAACACACAGGGAGGTAGG + Intergenic
1018504206 6:164446172-164446194 ATCAAAAAGCAGAGGGAGGATGG + Intergenic
1018988992 6:168659333-168659355 GCCAAGAGACAGAGGGAGCAAGG + Intronic
1020005579 7:4782335-4782357 CTCCCGACACAGAGGGAGGGAGG - Intronic
1020537504 7:9419520-9419542 CTCAAGAGGCTGAGGCAGGAGGG + Intergenic
1020851926 7:13364380-13364402 ATAAAGACACAGAGGGAGGGGGG - Intergenic
1022181631 7:27926109-27926131 CTCAAGATGGAGAGGAAGGCTGG + Intronic
1022492637 7:30832583-30832605 CCCAGGAAACAGAGGGCGGAGGG - Intronic
1022760144 7:33339910-33339932 TCCAATACACAGAGGGAGGAGGG + Intronic
1022845744 7:34207998-34208020 TTTAAGAAACAGAGGGAAGATGG + Intergenic
1023254719 7:38301735-38301757 CTCAAGAGGCTGAGGCAGGAGGG - Intergenic
1023484166 7:40666345-40666367 CTCAAGAAAGAAAGGAAGGAAGG + Intronic
1023544686 7:41305893-41305915 CTCAAGATATAGAAAAAGGAGGG - Intergenic
1023574589 7:41612874-41612896 CTCTAAATTCAGAGTGAGGAAGG - Intergenic
1024094254 7:45971807-45971829 CTGATGATTCAGAGTGAGGAGGG - Intergenic
1024536558 7:50439658-50439680 CTTAAGATCCAGTGGGATGAAGG + Intergenic
1026418234 7:70205288-70205310 CTCAGGAGACAGAGGCAGGAGGG - Intronic
1026669836 7:72380337-72380359 CTTAAGAAACAGAGGTAGGCTGG + Intronic
1028264335 7:88704782-88704804 ATCAACATACAGCGGGAGGGGGG - Intergenic
1028847333 7:95496738-95496760 CTCAGGAGACTGAGGTAGGAGGG + Intronic
1030217256 7:107057121-107057143 TTCAAGCAACAGAGGGAGGAAGG - Intronic
1030412845 7:109203499-109203521 ACCAAGAAACACAGGGAGGAAGG + Intergenic
1031626992 7:124003591-124003613 ATCAAGATTCAGGAGGAGGATGG - Intergenic
1031714870 7:125096541-125096563 CTGGAGATTCAGAAGGAGGAGGG - Intergenic
1032104054 7:129010273-129010295 CTCAAGAGGCTGAGGCAGGAAGG - Intronic
1032337737 7:131042146-131042168 GTAAAAATACAGAGGGAAGAAGG + Intergenic
1032461979 7:132118656-132118678 TTCCAGATACAAAAGGAGGATGG + Intergenic
1033636464 7:143216332-143216354 CTCATGACACAGAGGGTGGGTGG - Intergenic
1034399485 7:150852653-150852675 AACAGGACACAGAGGGAGGAGGG + Intronic
1034851117 7:154494926-154494948 CTCGAGATACAGACAGAGGAGGG + Intronic
1034869244 7:154668863-154668885 GTCGAGAGAGAGAGGGAGGAAGG - Intronic
1035090258 7:156304556-156304578 CTGCAGATACAGAGCGAGAACGG - Intergenic
1037390324 8:18386400-18386422 CTCAAAATTCAAAGGGTGGAAGG - Intergenic
1037848198 8:22303501-22303523 CTCCAGAGACTGAGGGAGGTGGG - Intronic
1038047573 8:23778998-23779020 CTTCAGATAAAGAGGGACGACGG + Intergenic
1038579974 8:28739432-28739454 CCCAGGAGACAGAGGCAGGAGGG - Intronic
1038864562 8:31425596-31425618 CTCAAAAGACAGAGGGGGGGAGG - Intergenic
1039119320 8:34128365-34128387 CTCAAAATTCAGAGGCAGGGGGG + Intergenic
1040973444 8:53163444-53163466 CTGAGGATACAGAGCCAGGACGG - Intergenic
1041225429 8:55692726-55692748 ATCAGGAGGCAGAGGGAGGATGG - Intergenic
1041386757 8:57312419-57312441 TTCAAGATACAATGGGAGTATGG - Intergenic
1041964072 8:63654127-63654149 AGCAAGAGACAGAGCGAGGAGGG + Intergenic
1042139721 8:65665729-65665751 CTCAGGAAGCTGAGGGAGGAGGG - Intronic
1042400379 8:68338464-68338486 CTGAAGATGCAGAAGGAGTAAGG - Intronic
1044913230 8:97084380-97084402 CTCAAGAAAAAGATGGGGGAGGG - Intronic
1047192812 8:122693676-122693698 CTGAACATAGAGAGGCAGGAAGG + Intergenic
1047193544 8:122700495-122700517 CTGAAGACACAGGGAGAGGATGG + Intergenic
1047248716 8:123166057-123166079 ATAAAGATACAGAGGGAGTCGGG + Intergenic
1047487646 8:125346331-125346353 CTCAAGATAAAGATGGAGAATGG + Intronic
1047720944 8:127638511-127638533 GTCAAGATCCAGATGCAGGATGG - Intergenic
1047915754 8:129582252-129582274 CTCAAGGTGCAGAGGGAGATTGG + Intergenic
1048085232 8:131170171-131170193 CTCAAGAGACTGAGGCAGAAAGG - Intergenic
1048129519 8:131678917-131678939 TTCAAGACTCAGTGGGAGGATGG + Intergenic
1048290571 8:133178364-133178386 CCCAACATACATTGGGAGGAGGG + Intergenic
1048522147 8:135166388-135166410 CCCAAGAGAGAGAGGGAGGGTGG - Intergenic
1048557466 8:135494576-135494598 CTCAAGAAACAAAAGGAGGAGGG - Intronic
1050043261 9:1517565-1517587 CTCAACTTAATGAGGGAGGAAGG - Intergenic
1050541174 9:6671676-6671698 CTCCAGAGACTGAGGTAGGAGGG - Intergenic
1051208809 9:14719638-14719660 AGCAAGATAGAGAGGGAGGAAGG - Intergenic
1051267104 9:15319729-15319751 CTCAGGAGACTGAGGCAGGAGGG - Intergenic
1052434578 9:28409867-28409889 TTCACGATAGAGAGGGAGAAAGG + Intronic
1052863828 9:33453153-33453175 CTCAAGATGCCCTGGGAGGAGGG - Intergenic
1053049321 9:34945669-34945691 TACAGGAGACAGAGGGAGGAAGG - Intergenic
1055533622 9:77213606-77213628 CTCAAGAGGCTGAGGCAGGAAGG - Intronic
1055638559 9:78300821-78300843 CTCAGGATGCTGAGGCAGGAGGG - Intronic
1055995862 9:82159266-82159288 TTCAAGAGACAGAGGGATAAAGG - Intergenic
1056131014 9:83586514-83586536 CTCAGGCCACAGAGGCAGGAAGG + Intergenic
1056155217 9:83827850-83827872 CTCAAGATACAGAGAGACATGGG + Intronic
1056355270 9:85795263-85795285 CTCAAGATACAGAGAGACATGGG - Intergenic
1056388574 9:86119468-86119490 GTCAGGAGACAGAGGGAGCAAGG + Intergenic
1058530584 9:105901710-105901732 CTCAGGAAAGAGAGGGAGGCAGG - Intergenic
1059328668 9:113520612-113520634 CTCCAGACCCAGAGGGAGGCTGG - Intronic
1059351103 9:113665654-113665676 CTGAAGAAAAAGAGAGAGGATGG - Intergenic
1059664750 9:116436082-116436104 CTAAAAATACAGAGTGAAGATGG - Intronic
1059739707 9:117137675-117137697 TTCAAGAGAAAGAGGGAGGGTGG + Intronic
1060406656 9:123376219-123376241 CTGGAGGTACAGAGGGAGGCTGG + Intronic
1060522149 9:124300057-124300079 CTGAGGACACAGAGGGAGAAGGG + Intronic
1060541841 9:124436210-124436232 CTCAGGAGACTGAGGTAGGAAGG + Intergenic
1060807221 9:126585489-126585511 CCCAAGATACACAGGTAGAATGG + Intergenic
1062679090 9:137767225-137767247 CTCAAGAGGCTGAGGCAGGAGGG - Intronic
1203657382 Un_KI270753v1:11337-11359 ATCAAGACGCAGAGGAAGGAAGG - Intergenic
1185448561 X:271233-271255 CCCAGGACACAGAGGGAGGAAGG + Intergenic
1185574604 X:1161061-1161083 CCCACGATACAGAGGGATTATGG + Intergenic
1186492868 X:9988185-9988207 CTCAAGAAGCTGAGGGAGGAGGG + Intergenic
1187472616 X:19582445-19582467 CTGAAGATACCGAGGAAGGAGGG - Intronic
1187834488 X:23417578-23417600 CTCAGGAGACTGAGGCAGGAGGG - Intergenic
1189075544 X:37910257-37910279 GTAAAGATACAGGGGGAAGATGG - Intronic
1189504298 X:41595495-41595517 CTCAAGATGGGGAGGTAGGAGGG + Intronic
1190780555 X:53590595-53590617 CTCAAGCTAAAGAGAGAGGAAGG + Intronic
1191670577 X:63745018-63745040 CACAATTCACAGAGGGAGGAGGG + Intronic
1192416423 X:70985036-70985058 CTCAAGAAAGAAAGAGAGGAAGG + Intergenic
1193424759 X:81328310-81328332 CTTAAGATGCTGAGGTAGGAGGG + Intergenic
1195548187 X:106137372-106137394 CTCAAGACATACAGGGAAGAAGG - Intergenic
1195598954 X:106724537-106724559 CTAAAGTAACAGAGGGAGGGTGG - Intronic
1196100208 X:111839822-111839844 CTCAGGAGACTGAGGCAGGAGGG - Intronic
1197043310 X:121966655-121966677 CTGAAGAGACAGAGGTAGAAAGG + Intergenic
1197816088 X:130500158-130500180 GGCAAGATAAAAAGGGAGGAAGG - Intergenic
1198234310 X:134722161-134722183 CTCAGGAGACTGAGGCAGGAGGG - Intronic
1199193840 X:145003745-145003767 CTGAAGATGGAGAAGGAGGAGGG + Intergenic
1199579498 X:149347189-149347211 CTCAAGAAGAAAAGGGAGGAAGG - Intergenic
1199680981 X:150224505-150224527 TTCAAGATACACAGGGAAGTAGG - Intergenic
1201074241 Y:10175163-10175185 AGCAAGAAACAGAGAGAGGAAGG - Intergenic
1201194323 Y:11476740-11476762 CTTAAAATAGGGAGGGAGGAAGG + Intergenic
1201509591 Y:14744245-14744267 CAGAAGATAAAGAGTGAGGATGG + Intronic
1201730254 Y:17194220-17194242 CTCAGAATTCAGAGGGAGCAAGG + Intergenic
1201900461 Y:19042783-19042805 TTACAGAGACAGAGGGAGGAGGG - Intergenic