ID: 1157513715

View in Genome Browser
Species Human (GRCh38)
Location 18:48296228-48296250
Sequence CTCCCCATGCAGGATGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 376
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 340}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157513692_1157513715 29 Left 1157513692 18:48296176-48296198 CCCCCACCACCTGCTCAGGCCCC 0: 1
1: 0
2: 6
3: 108
4: 952
Right 1157513715 18:48296228-48296250 CTCCCCATGCAGGATGGGGAGGG 0: 1
1: 0
2: 1
3: 34
4: 340
1157513695_1157513715 26 Left 1157513695 18:48296179-48296201 CCACCACCTGCTCAGGCCCCCTG 0: 1
1: 0
2: 5
3: 88
4: 589
Right 1157513715 18:48296228-48296250 CTCCCCATGCAGGATGGGGAGGG 0: 1
1: 0
2: 1
3: 34
4: 340
1157513704_1157513715 8 Left 1157513704 18:48296197-48296219 CCCTGGATGGCTGCCAGGCAGGC 0: 1
1: 0
2: 1
3: 31
4: 263
Right 1157513715 18:48296228-48296250 CTCCCCATGCAGGATGGGGAGGG 0: 1
1: 0
2: 1
3: 34
4: 340
1157513701_1157513715 10 Left 1157513701 18:48296195-48296217 CCCCCTGGATGGCTGCCAGGCAG 0: 1
1: 0
2: 0
3: 30
4: 336
Right 1157513715 18:48296228-48296250 CTCCCCATGCAGGATGGGGAGGG 0: 1
1: 0
2: 1
3: 34
4: 340
1157513708_1157513715 -5 Left 1157513708 18:48296210-48296232 CCAGGCAGGCCTGGGCTGCTCCC 0: 1
1: 1
2: 3
3: 83
4: 580
Right 1157513715 18:48296228-48296250 CTCCCCATGCAGGATGGGGAGGG 0: 1
1: 0
2: 1
3: 34
4: 340
1157513699_1157513715 20 Left 1157513699 18:48296185-48296207 CCTGCTCAGGCCCCCTGGATGGC 0: 1
1: 0
2: 2
3: 29
4: 227
Right 1157513715 18:48296228-48296250 CTCCCCATGCAGGATGGGGAGGG 0: 1
1: 0
2: 1
3: 34
4: 340
1157513694_1157513715 27 Left 1157513694 18:48296178-48296200 CCCACCACCTGCTCAGGCCCCCT 0: 1
1: 0
2: 0
3: 44
4: 482
Right 1157513715 18:48296228-48296250 CTCCCCATGCAGGATGGGGAGGG 0: 1
1: 0
2: 1
3: 34
4: 340
1157513697_1157513715 23 Left 1157513697 18:48296182-48296204 CCACCTGCTCAGGCCCCCTGGAT 0: 2
1: 0
2: 1
3: 23
4: 319
Right 1157513715 18:48296228-48296250 CTCCCCATGCAGGATGGGGAGGG 0: 1
1: 0
2: 1
3: 34
4: 340
1157513693_1157513715 28 Left 1157513693 18:48296177-48296199 CCCCACCACCTGCTCAGGCCCCC 0: 1
1: 0
2: 2
3: 54
4: 678
Right 1157513715 18:48296228-48296250 CTCCCCATGCAGGATGGGGAGGG 0: 1
1: 0
2: 1
3: 34
4: 340
1157513705_1157513715 7 Left 1157513705 18:48296198-48296220 CCTGGATGGCTGCCAGGCAGGCC 0: 1
1: 0
2: 0
3: 32
4: 368
Right 1157513715 18:48296228-48296250 CTCCCCATGCAGGATGGGGAGGG 0: 1
1: 0
2: 1
3: 34
4: 340
1157513691_1157513715 30 Left 1157513691 18:48296175-48296197 CCCCCCACCACCTGCTCAGGCCC 0: 1
1: 0
2: 13
3: 80
4: 808
Right 1157513715 18:48296228-48296250 CTCCCCATGCAGGATGGGGAGGG 0: 1
1: 0
2: 1
3: 34
4: 340
1157513702_1157513715 9 Left 1157513702 18:48296196-48296218 CCCCTGGATGGCTGCCAGGCAGG 0: 1
1: 0
2: 2
3: 22
4: 263
Right 1157513715 18:48296228-48296250 CTCCCCATGCAGGATGGGGAGGG 0: 1
1: 0
2: 1
3: 34
4: 340

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157513715 Original CRISPR CTCCCCATGCAGGATGGGGA GGG Intronic
900101865 1:965412-965434 CCCCCCATGCAGGCAGTGGAGGG - Exonic
900483974 1:2912791-2912813 CTTCCCCTTCAGGCTGGGGAGGG + Intergenic
900806566 1:4771493-4771515 CTCCCCATGCAGCAGGGGAGGGG + Intronic
901715352 1:11149258-11149280 CTCCCCTTCCAGGATGGGGCTGG + Intronic
902209363 1:14893597-14893619 CTCTCCCTACAGGCTGGGGAAGG + Intronic
902568716 1:17332793-17332815 CTATCCAGGCAGGCTGGGGAGGG + Intronic
902573763 1:17363667-17363689 CTCCCCATGCCTGATGTGGTAGG - Exonic
902617383 1:17631173-17631195 TTTCCCAGACAGGATGGGGAAGG + Intronic
903047562 1:20575836-20575858 CTCAGCATGGAGGCTGGGGAAGG + Intergenic
903349549 1:22710000-22710022 CTCCCAGTGCAGTTTGGGGATGG - Intergenic
904235683 1:29115522-29115544 CTCCCTATGCAGGATAGGGTGGG + Intronic
904272249 1:29357596-29357618 CTTCCCAGTCAGGCTGGGGAAGG - Intergenic
905110424 1:35590523-35590545 CTACACAGGCAGGATGGGGCAGG + Intronic
906405567 1:45539334-45539356 CTCCCCCTCCAGGAAGGAGAAGG - Intergenic
907388013 1:54138364-54138386 CTCCACATGCAAGCTGGGGTGGG - Intronic
911092565 1:94029512-94029534 CTGCACCTGCAGGATGGTGAAGG + Exonic
913224506 1:116687168-116687190 CTCCACAGGCAGAATGGGGAGGG - Intergenic
915105481 1:153532995-153533017 CTAGCCCTGCAGGTTGGGGAGGG + Intergenic
916574261 1:166053046-166053068 ATCCCCAGGCTGGGTGGGGATGG + Intergenic
916595071 1:166235535-166235557 CTCCCCTTGCAAGATGGGGCTGG - Intergenic
917118551 1:171625858-171625880 ATACCCTTGGAGGATGGGGATGG + Intergenic
917508059 1:175646998-175647020 CTCGGCAGGCAGGATGGGGCAGG + Intronic
918306689 1:183252720-183252742 CTGGCCCTGCAGCATGGGGACGG - Exonic
920298275 1:204973233-204973255 CTCCTCATGAGAGATGGGGAGGG - Intronic
920363210 1:205433618-205433640 TTCCCCATGCAAGAGGGTGAAGG + Intronic
921080757 1:211737064-211737086 CTCCCAGTGCAGCATGGGGTGGG - Intergenic
922876198 1:228941601-228941623 TTTCCCAAGCAAGATGGGGAAGG - Intergenic
923033305 1:230266704-230266726 GTCCCCATCCAGCATGGGCATGG + Intronic
923541363 1:234890559-234890581 CTCTCCATGCAGGCTGGGTGCGG - Intergenic
924099983 1:240593245-240593267 CTCCCCATGCATGACAGGAAGGG + Intronic
924459379 1:244244829-244244851 CTCCCATAGCGGGATGGGGAGGG + Intergenic
924740799 1:246793401-246793423 CTCCCAGGGCTGGATGGGGAGGG + Intergenic
924778722 1:247128872-247128894 TTCCCCCAGCAGGATGGGGTGGG + Intronic
924778739 1:247128934-247128956 TTCCCCCAGCAGGATGGGGTGGG + Intronic
924778756 1:247128996-247129018 TTCCCCGAGCAGGATGGGGTGGG + Intronic
924778772 1:247129057-247129079 TTCCCCCAGCAGGATGGGGTGGG + Intronic
924778789 1:247129119-247129141 TTCCCCCAGCAGGATGGGGTGGG + Intronic
924778807 1:247129181-247129203 TTCCCCCAGCAGGATGGGGTGGG + Intronic
924778824 1:247129243-247129265 TTCCCCCAGCAGGATGGGGTGGG + Intronic
924778841 1:247129305-247129327 TTCCCCCAGCAGGATGGGGTGGG + Intronic
924778859 1:247129367-247129389 TTCCCCCAGCAGGATGGGGTGGG + Intronic
924778876 1:247129429-247129451 TTCCCCCAGCAGGATGGGGTGGG + Intronic
924778894 1:247129491-247129513 TTCCCCCAGCAGGATGGGGTGGG + Intronic
924778911 1:247129553-247129575 TTCCCCGAGCAGGATGGGGTGGG + Intronic
924778927 1:247129615-247129637 TTCCCCGAGCAGGATGGGGTGGG + Intronic
924778943 1:247129677-247129699 TTCCCCCAGCAGGATGGGGTGGG + Intronic
924778960 1:247129739-247129761 TTCCCCGAGCAGGATGGGGTGGG + Intronic
924778976 1:247129801-247129823 TTCCCCCAGCAGGATGGGGTGGG + Intronic
924778993 1:247129863-247129885 TTCCCCGAGCAGGATGGGGTGGG + Intronic
924779009 1:247129925-247129947 TTCCCCCAGCAGGATGGGGTGGG + Intronic
924779026 1:247129987-247130009 TTCCCCGAGCAGGATGGGGTGGG + Intronic
1062825891 10:568240-568262 ATCCCCGTGCAGGGAGGGGATGG + Intronic
1063425492 10:5947096-5947118 CTCCCCATGCAGAATGGGACAGG + Intronic
1067064434 10:43095860-43095882 GGCACCATGCAGGATGGGGTGGG - Intronic
1067231310 10:44412898-44412920 TTCTCTAAGCAGGATGGGGAGGG + Intergenic
1067468032 10:46515878-46515900 CTCCCCAAGCAGGATGCAGAGGG + Intergenic
1070279305 10:75037245-75037267 CTCCTCCAGCAGGGTGGGGAGGG - Intergenic
1070677364 10:78421188-78421210 CCCCTCCTCCAGGATGGGGAAGG - Intergenic
1070935523 10:80291620-80291642 CCTCCCATGCAGCATGGAGAAGG + Intergenic
1071201506 10:83223942-83223964 CTCTGCATGCAGGATGAGTATGG + Intergenic
1071905757 10:90171920-90171942 CACCACTTGCAGGATGGGGTGGG - Intergenic
1074174013 10:110977533-110977555 CTAAACATGCAGGATGGGTACGG - Intronic
1075651451 10:124130297-124130319 CTCCCCTTCCAGCATGTGGAGGG - Intergenic
1075651454 10:124130299-124130321 CTCCACATGCTGGAAGGGGAGGG + Intergenic
1075791010 10:125084506-125084528 CTTCCCAGAGAGGATGGGGAAGG - Intronic
1075917840 10:126184911-126184933 TTCCCCACACAGGATGGTGATGG - Intronic
1075993138 10:126854844-126854866 CACCCCATGCAAAATGGGAAAGG - Intergenic
1076566108 10:131400631-131400653 CTCCCCACTCAGGTTGGGGCTGG - Intergenic
1076733928 10:132450499-132450521 CTCCTCAGTCAGGCTGGGGAGGG - Intergenic
1076820703 10:132938033-132938055 CTCTCTGTGCAGGCTGGGGACGG - Intronic
1076942858 10:133621420-133621442 GTCACCATGCAGGATGAGAAAGG + Intergenic
1077162027 11:1118124-1118146 CTCCCCATGCAGGTGGGTGGTGG - Intergenic
1078184525 11:9040466-9040488 TATCCCAGGCAGGATGGGGAGGG + Intronic
1078184540 11:9040526-9040548 TATCCCAGGCAGGATGGGGAGGG + Intronic
1078184555 11:9040586-9040608 TATCCCAGGCAGGATGGGGAGGG + Intronic
1078184571 11:9040646-9040668 TATCCCAGGCAGGATGGGGAGGG + Intronic
1078367691 11:10720354-10720376 CTCCCCTTGGAGGTGGGGGAAGG + Intergenic
1079026392 11:16951254-16951276 TCCTCCATGCAGCATGGGGAAGG + Intronic
1079335838 11:19569795-19569817 CTCCCCATCCAGGGTGGTTAGGG - Intronic
1084570573 11:69957166-69957188 CTGCCCCTGCAGGCTGGGGTGGG - Intergenic
1084604825 11:70166407-70166429 CTCCCCATGCTGGCTGAGGATGG + Intronic
1088558032 11:111082829-111082851 CTTCCCATGCAGGAGGGGTGTGG - Intergenic
1089157541 11:116413941-116413963 TTCCCCAGGCAGGATGAGGGAGG - Intergenic
1090234910 11:125140042-125140064 CTCCACATGAAGGAGGGGGTGGG - Intergenic
1090252791 11:125263271-125263293 CTGCCCTGGCAGGATGGGGGTGG - Intronic
1090804843 11:130196475-130196497 CTCCCCCTGCAGCATGGGCCCGG - Intronic
1090868826 11:130725263-130725285 CTGCCCAGGCAGGGTGGGGCTGG - Intergenic
1090948176 11:131449747-131449769 CTCCCCATGCAGGACTGGAGAGG + Intronic
1091116037 11:133014478-133014500 TTCCCCATGAAGGAAGGGCAGGG + Intronic
1091313923 11:134597483-134597505 CTCCTCATGCAGGCGCGGGAGGG + Intergenic
1091590377 12:1839171-1839193 CTCTCGCAGCAGGATGGGGACGG - Intronic
1091600681 12:1915968-1915990 GTGCCCATGAAGGTTGGGGAGGG + Intronic
1091730351 12:2876448-2876470 TTCCCCGCTCAGGATGGGGATGG - Intronic
1092728789 12:11509144-11509166 GTCCCCATGATGGACGGGGATGG - Intergenic
1095957220 12:47813689-47813711 CCCCCACAGCAGGATGGGGAGGG - Intronic
1097176946 12:57148823-57148845 TTCCCCATGCAGCATGGTGCAGG - Intronic
1097230382 12:57507493-57507515 CGCCCCATGCAGGAGGGAGGTGG - Intronic
1097448391 12:59704839-59704861 CTCCAGATGGAGGATGGGGTTGG + Exonic
1101397586 12:104362221-104362243 CCCCCCATGCAGCATGGGGAGGG + Intergenic
1101972608 12:109326368-109326390 CTCCACATGGGGGATGAGGAAGG + Intergenic
1102254675 12:111408641-111408663 CTCCCCAGCCAAGGTGGGGAGGG + Intronic
1103517864 12:121518985-121519007 TTCCCCAGGTGGGATGGGGATGG + Intronic
1103936494 12:124480208-124480230 CTCCCGCTGCAGGAGGAGGATGG + Intronic
1103987588 12:124778146-124778168 CTCCCCATGCAGGACGGGCCAGG - Exonic
1105242718 13:18622007-18622029 CTCCTCATCCAGGATGAAGAGGG - Intergenic
1107062674 13:36176467-36176489 TTCCCCAGGCATTATGGGGAGGG - Intronic
1107377520 13:39820687-39820709 CTCCCAGAGCAGGATGGAGATGG - Intergenic
1108526243 13:51288269-51288291 AGGCCCATGCAGGATGGGAAAGG - Intergenic
1113301074 13:109019831-109019853 TCCCCCATGAAGGATGGGAATGG + Exonic
1114209025 14:20600242-20600264 TTCACCAGGCAGAATGGGGAAGG + Intronic
1119599806 14:75967989-75968011 CTCCCCTAGTAGGCTGGGGAGGG - Intronic
1121341589 14:93108170-93108192 CAATTCATGCAGGATGGGGAAGG + Intronic
1121880997 14:97500137-97500159 TTCCCCATGCACGAAGGGGGTGG - Intergenic
1122272965 14:100576575-100576597 CTCCCAACACAGGATGGAGACGG - Intronic
1122632035 14:103111601-103111623 CTCCCCTGGCAGGGTGGGGCAGG + Intergenic
1122829595 14:104389325-104389347 CTCCCTGGGCAGGCTGGGGATGG - Intergenic
1123067769 14:105627011-105627033 GGCACCATGCAGGGTGGGGAGGG - Intergenic
1123091452 14:105744012-105744034 GGCACCATGCAGGGTGGGGAGGG - Intergenic
1123488580 15:20762598-20762620 CTCCTCATCCAGGATGAAGAGGG + Intergenic
1123545076 15:21331671-21331693 CTCCTCATCCAGGATGAAGAGGG + Intergenic
1123732295 15:23157448-23157470 CTGCCATTGCAGGGTGGGGAGGG - Intergenic
1123917757 15:25049360-25049382 TTTCACATGCAGGATGGGCATGG - Intergenic
1124137495 15:27048086-27048108 CTCCCCAGGCTGGAAGAGGATGG - Intronic
1124522257 15:30414156-30414178 CTGCCATTGCAGGGTGGGGAGGG + Exonic
1124536408 15:30552062-30552084 CTGCCATTGCAGGGTGGGGAGGG - Exonic
1124762243 15:32455530-32455552 CTGCCATTGCAGGGTGGGGAGGG + Exonic
1125907249 15:43404343-43404365 CTCCATATGGAGGATGGGGGCGG - Exonic
1125966793 15:43881209-43881231 CTCTCTGTGGAGGATGGGGATGG + Intronic
1127122903 15:55786633-55786655 CTCCCCAGGCAGGTAAGGGAAGG + Intergenic
1128577659 15:68787376-68787398 CTACCCCTGCAGGGAGGGGAGGG + Intronic
1129193209 15:73949605-73949627 CTCCCCAGGCAGGAAAGGGACGG - Intronic
1129411317 15:75352058-75352080 CATCCCATGGAGGGTGGGGATGG + Intronic
1130097952 15:80870223-80870245 CACCTCATGCAGGGTGGGTAGGG + Intronic
1130632483 15:85582709-85582731 CTCCCCAAGCAGGAAAAGGAAGG - Intronic
1131341307 15:91604006-91604028 CACCCACAGCAGGATGGGGAAGG + Intergenic
1132335949 15:101048854-101048876 CCCCCCTTGCAGGACGGGAAAGG + Intronic
1132428149 15:101737972-101737994 ATCCCAAGGCAGGATAGGGAGGG - Intronic
1202953422 15_KI270727v1_random:58942-58964 CTCCTCATCCAGGATGAAGAGGG + Intergenic
1132496464 16:265661-265683 CTCCCCCAGCAGGATGGGTGGGG + Exonic
1132698706 16:1213169-1213191 GGCCCCTTGGAGGATGGGGAGGG + Intronic
1132710597 16:1265446-1265468 CTCCCCATGCAGGGAGGTGCAGG - Intergenic
1132726236 16:1339479-1339501 CTCCACCTGCAGGTGGGGGAAGG - Exonic
1132789175 16:1675527-1675549 CTCCCCATCCACAATGGAGAAGG + Exonic
1132889015 16:2195317-2195339 ATCCCCCTGGAGGAAGGGGAGGG + Intronic
1132935479 16:2478408-2478430 CACCCCATGCAGAGTGTGGAGGG + Intronic
1132950987 16:2562394-2562416 CTCCCCATCCTGCCTGGGGAGGG + Intronic
1132963362 16:2637776-2637798 CTCCCCATCCTGCCTGGGGAGGG - Intergenic
1133685931 16:8165597-8165619 CTCCCCATGCACACTGGTGAAGG + Intergenic
1135303400 16:21349732-21349754 CTCCCCTGGCAGGAAGGGCAGGG - Intergenic
1135346302 16:21691455-21691477 CTCCACATCCAGGAGAGGGAAGG + Intronic
1135728538 16:24875754-24875776 CTCCCCATGCTGCATGGGTGAGG - Intronic
1136184611 16:28579638-28579660 CTCCCCATGCTGGCTGGGCGTGG + Intronic
1136187475 16:28596693-28596715 CTATCCAGGCAGGATGGTGAGGG + Intronic
1136300148 16:29328926-29328948 CTCCCCTGGCAGGAAGGGCAGGG - Intergenic
1136485307 16:30568043-30568065 CTCCCCAAGCAGGCTGGGCTGGG + Intergenic
1138417787 16:56881118-56881140 CTCCCTATGCAGGAGTGGGATGG + Intronic
1138419933 16:56892563-56892585 CTAGCCATGCAGGGTGGGGTGGG + Intronic
1138548167 16:57731667-57731689 CTCACCAAGTGGGATGGGGAAGG + Intronic
1139030776 16:62878212-62878234 ATCCCCATGTATCATGGGGAGGG + Intergenic
1140040362 16:71403450-71403472 CTCCACATTCAAGATGGGGCAGG - Intergenic
1140336289 16:74107961-74107983 CTCCCCCTGCTGGTGGGGGAGGG + Intergenic
1140997904 16:80278892-80278914 CTCCCCATGTAGGTGGGGGCTGG - Intergenic
1141622227 16:85242366-85242388 ACCCCCATGCAGGAAGGGGTGGG + Intergenic
1141670490 16:85489259-85489281 CAGCCCATCCAGGATGGGGAGGG - Intergenic
1141824307 16:86468330-86468352 CTGACTCTGCAGGATGGGGAGGG - Intergenic
1142061880 16:88035696-88035718 CTCCCCTGGCAGGAAGGGCAGGG - Intronic
1142273331 16:89102487-89102509 CTCCCCACTGAGGAAGGGGAAGG - Intronic
1142744049 17:1946285-1946307 CTCTGAATGCAGGAAGGGGAGGG + Intronic
1143381260 17:6497834-6497856 ACCCCCATGCAGGATGGGTTGGG - Intronic
1143659293 17:8314949-8314971 CTGCCCCTGCAGGATGGTGAGGG + Exonic
1143679357 17:8464918-8464940 CTCCTCAAGCAGGTTGAGGATGG - Intronic
1144946736 17:18973204-18973226 CTCCCAATGCAGCATGGGCTTGG + Intronic
1147265489 17:39231950-39231972 GGCCCCACGCAGGCTGGGGAGGG + Intergenic
1148564878 17:48626789-48626811 CTCCCCAGGCGGGTCGGGGAGGG + Intronic
1148778752 17:50110162-50110184 CTCCCCCAGGAGGATGGTGAGGG - Exonic
1149532015 17:57402961-57402983 CTCCCTAGGCAGGGTGGGGCTGG - Intronic
1150648514 17:66994852-66994874 CTTCCCAGGCAGGGTGGTGAAGG + Intronic
1151985845 17:77542974-77542996 AGCCCCATGCAGGCTGGGAACGG + Intergenic
1153951874 18:10064590-10064612 CTGCCAGTGCAGGATGGGGCGGG - Intergenic
1154158628 18:11963332-11963354 CTCCCCTAGCAGGATGGTCAAGG - Intergenic
1154497648 18:14974294-14974316 CTCCACAGGCAGGGTGGGGCAGG + Intergenic
1157513715 18:48296228-48296250 CTCCCCATGCAGGATGGGGAGGG + Intronic
1159388624 18:67759371-67759393 CCACCCAGGCAGGATGGGTAAGG - Intergenic
1160309646 18:77777614-77777636 CACCCCATGAAAAATGGGGAAGG + Intergenic
1160399709 18:78601295-78601317 CTTCCCAAGGAGGATGGAGAGGG + Intergenic
1160670890 19:362475-362497 CTCCACATTCAGGCTGGGCATGG + Intronic
1160774208 19:847733-847755 GTCTCCCTGGAGGATGGGGACGG - Intronic
1161659943 19:5539833-5539855 CTCTCCAGGCACGAGGGGGAAGG + Intergenic
1161990416 19:7681289-7681311 CTCCCCATGCATGGTGGGGGCGG + Intronic
1163372119 19:16907112-16907134 CTCCTCCTGCAGGGTGGGGTGGG + Exonic
1163454620 19:17399257-17399279 CAGCCCAGGCAGGATGGGGGTGG + Intergenic
1163745520 19:19044176-19044198 TTGCCCATGCATGCTGGGGAGGG - Intronic
1164667575 19:30051701-30051723 CTCACCATGCAGGACAGGGAGGG - Intergenic
1164718859 19:30416605-30416627 CTTCCCAGGGAGGATGGGGAGGG - Intronic
1164933114 19:32190464-32190486 CTCCCCAGCCAGCATGGGGCAGG + Intergenic
1164983549 19:32631700-32631722 CTCCCTGTGGGGGATGGGGATGG + Intronic
1165140815 19:33698921-33698943 GGCACCATGCAGGGTGGGGAGGG + Intronic
1165810307 19:38607961-38607983 GACCCCAGGGAGGATGGGGAGGG - Intronic
1166312127 19:41969001-41969023 GACCCCATGCAGGATGGGGCGGG - Intronic
1166352550 19:42206918-42206940 CTCACCAGGCAGGGTGGGGCTGG - Intronic
1167068656 19:47206243-47206265 CTTCCCAAGCAAGATGGGGTAGG - Intronic
1167524801 19:49977065-49977087 TGCCTCATGGAGGATGGGGAAGG + Intronic
1167708124 19:51093866-51093888 CTCCCTGTGCAGGATGGTGGAGG - Intergenic
925859903 2:8163988-8164010 CTCCCCAGCCTGAATGGGGATGG + Intergenic
926686746 2:15704096-15704118 TTCCCCAGGGAGGCTGGGGAGGG + Intronic
927113303 2:19879340-19879362 TTCTTCATGCAGGATGGGGGCGG - Intergenic
927974421 2:27327226-27327248 CTGCGCATGCAGGAGGGAGAGGG - Exonic
928209309 2:29311935-29311957 CTCCCCAGCCAGCATGGGCATGG - Intronic
928302336 2:30136923-30136945 TGCCCCATGCAGGATAGGGCAGG + Intergenic
928696619 2:33856015-33856037 CTCCCCAAGGAGTTTGGGGATGG + Intergenic
929598047 2:43188379-43188401 CACCCCATCTAGGATGGGCACGG - Intergenic
930079348 2:47433664-47433686 CGCCCCATCCAGGAGGGAGATGG - Intronic
930597011 2:53401361-53401383 CTCCCCATGTGTGCTGGGGATGG - Intergenic
931719106 2:65054676-65054698 CTCCCAAGGCAGGATGGGTGTGG - Intergenic
932203714 2:69858165-69858187 TTCCCCCTGCAGGCTGGGGAGGG + Intronic
932344784 2:70988445-70988467 CCCCCCAAGGAGGGTGGGGATGG + Exonic
933157715 2:78993352-78993374 CTCCCCTAGCAGCATGGGCACGG - Intergenic
933696991 2:85226992-85227014 GTGACCCTGCAGGATGGGGATGG + Intronic
934515841 2:94985872-94985894 CTCCCCAGGCAGGGTGGCCAGGG - Intergenic
934758360 2:96839871-96839893 CTCCTCATGCAGGAAGGTCAGGG + Intronic
935219217 2:100997785-100997807 CCTCCCATGTAGAATGGGGATGG + Intergenic
937251950 2:120529557-120529579 GTACCCATGCAGGCTGGGAAAGG - Intergenic
937345519 2:121123217-121123239 CTCGCCAGGCAAGATGGGGATGG + Intergenic
941006851 2:160257098-160257120 CTCCCCAGCCAAGATGGGAATGG + Intronic
941519314 2:166519558-166519580 CAGCTCATGCAGGAGGGGGAGGG - Intergenic
942235680 2:173902318-173902340 CTGCCAAGGCAGGATTGGGAGGG + Intergenic
945023233 2:205595041-205595063 CTCCCCTTGCAGGGTTGTGATGG - Intronic
945923820 2:215783176-215783198 CTCCCCTCCCAGGATGGGAAAGG + Intergenic
946175342 2:217919073-217919095 CTCCCTATTCAGGGTGGTGATGG - Intronic
946804503 2:223457794-223457816 CTCCTCATGTAGGATGGCCAAGG + Intergenic
947012620 2:225582726-225582748 CTCCCCATGCTGACGGGGGAGGG - Exonic
947529733 2:230901189-230901211 CTCCCTTGGCAGGATGGGGCTGG - Intergenic
948514156 2:238493042-238493064 CTCCCCTTCCTGGTTGGGGAGGG + Intergenic
948784439 2:240344834-240344856 CATCCCAGGCAGGATGGGGTGGG + Intergenic
948909798 2:240997340-240997362 CACCCCATGCAGGGTGGGAGAGG + Intergenic
1171085741 20:22236622-22236644 CTGCCCAAGGAGGATGGGAAGGG - Intergenic
1171227787 20:23455846-23455868 CTCCCCATGCAGGGCCAGGAGGG - Intergenic
1172165273 20:32894966-32894988 CTGCCCTTGCAAGATGGGGCTGG + Intronic
1174398686 20:50264026-50264048 TTCCCCATGGAGGATGCGGTTGG + Intergenic
1175981052 20:62738840-62738862 CTCCTCATGATGGAAGGGGATGG - Intronic
1176449761 21:6851976-6851998 CTCCTCATCCAGGATGAAGAGGG - Intergenic
1176827933 21:13717000-13717022 CTCCTCATCCAGGATGAAGAGGG - Intergenic
1179804084 21:43826188-43826210 CTCCCAGGGCAGGATGGGGAGGG - Intergenic
1179982175 21:44901319-44901341 CTGCCCATGCAGGAAAGGGCAGG - Intronic
1181324195 22:22032325-22032347 ATCCCCAAGAAGGATGGAGATGG - Intergenic
1181556468 22:23674460-23674482 CTCCCCAGGCAGCATGGGGGCGG + Intergenic
1182288848 22:29263969-29263991 CTGGCCATGCTGGCTGGGGAGGG - Exonic
1183349184 22:37325144-37325166 CTCCGCATTAAGGAGGGGGACGG + Intergenic
1183825668 22:40384915-40384937 ATCCCCATTCAGAATAGGGATGG + Intronic
1184037481 22:41925650-41925672 AGCCCAATGCAGGGTGGGGAGGG + Intronic
1184221348 22:43102062-43102084 CTCCCTCTCCAGGGTGGGGATGG - Intergenic
1184314606 22:43675025-43675047 CTACCTATGCAGGACGGGTACGG + Intronic
1184427717 22:44422995-44423017 CTCCCTGAGGAGGATGGGGAGGG - Intergenic
1184678881 22:46059050-46059072 CTTCCCATGCAGGAGAGGGCTGG + Intronic
1184782458 22:46656052-46656074 CTCCCCGTGGAGGCTGGGGTGGG - Intronic
1185035889 22:48476728-48476750 TCCCCCAGGCAGGATGGAGAAGG + Intergenic
949441636 3:4087377-4087399 CTCCACCTGCAAGATGGGAATGG - Intronic
950003715 3:9677691-9677713 CTGCCCCTACAGGCTGGGGAAGG - Intronic
950083284 3:10238940-10238962 CTCCCCACAGAGAATGGGGAAGG + Exonic
951508904 3:23480013-23480035 CTCCACCTTCAGGCTGGGGATGG - Intronic
952967580 3:38630784-38630806 GACCCCATGCAGGGTGAGGAGGG - Intronic
954581591 3:51706188-51706210 CTCCCACAGCAGGATGGGGAAGG - Intergenic
955015412 3:55064714-55064736 CTGGCCCTGCAGGATGGAGATGG + Intronic
955994123 3:64660559-64660581 AGCCCCAGGCAGGATGGGGCAGG - Intronic
956124467 3:65998179-65998201 CTTCCCATGAAGGCTGGGGGAGG - Intronic
956226218 3:66961999-66962021 CAGCCCAAGCAGAATGGGGAGGG - Intergenic
956701761 3:71965161-71965183 CTCCCCATGGAGGATGGAAGGGG - Intergenic
958192752 3:90204461-90204483 CTCTGCATGCTGGATGGAGATGG - Intergenic
958739828 3:98055987-98056009 CTGGCCATGCAAGATGGTGATGG - Intergenic
959626431 3:108457271-108457293 TTCTCCGTGCAGGAGGGGGAAGG + Intronic
960156065 3:114298152-114298174 CACTACATGCAGGGTGGGGAAGG - Intronic
960673021 3:120170209-120170231 CTCCCCTTGTAGAATTGGGAAGG + Intronic
961441424 3:126955525-126955547 CTCCCCTGGCAGGAAGGGGAAGG + Intronic
962273614 3:133996164-133996186 GTGCCCTGGCAGGATGGGGAAGG + Intronic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
965681518 3:171256731-171256753 CTCCCAAGTCAGAATGGGGATGG - Intronic
966212124 3:177464211-177464233 CTCCCCAGGTAGAATGGTGAGGG - Intergenic
968922703 4:3530917-3530939 CTCCCCATTCCTCATGGGGAGGG + Intronic
969438177 4:7200340-7200362 CTCCCCAGGGAGGAGAGGGAAGG - Intronic
969449666 4:7265847-7265869 CTCCCTCTGCAGGAAGGGAATGG - Intronic
969710235 4:8839106-8839128 CTCCTCATGCGGGACGGGAAAGG + Intergenic
970479676 4:16460346-16460368 CTCCACAGGCAGGCTGGGGTAGG - Intergenic
973644192 4:52933570-52933592 TTCCTTCTGCAGGATGGGGATGG + Intronic
977502009 4:97852453-97852475 CTCACCATGAAGTATGTGGAAGG + Intronic
980022887 4:127730535-127730557 CTCACGATGCATGATGGAGAAGG - Exonic
982117441 4:152109234-152109256 ATACCCATGGAGCATGGGGATGG - Intergenic
984210339 4:176839716-176839738 CCACCCATGGAGGATGGAGATGG - Intergenic
984864723 4:184271867-184271889 TTTCCCATGCTGGAAGGGGAAGG + Intergenic
985025987 4:185739932-185739954 TTCCCCATGCATGAGGGGGAAGG - Intronic
985480350 5:106670-106692 CTCCCCCTGCAGCAGGGTGAGGG + Intergenic
985678704 5:1245113-1245135 CTGCCCATGTGGCATGGGGACGG + Intronic
985761498 5:1751488-1751510 TTCCCCATGGAGGAAGGAGAGGG - Intergenic
987197095 5:15537532-15537554 CATCCCCTGCAGGATGGGGTTGG + Intronic
992171036 5:74102276-74102298 CTACTCATGAAGGAAGGGGAGGG - Intergenic
992373373 5:76168192-76168214 CTCCCCATGCAGGACTGGGGAGG - Intronic
993224732 5:85153304-85153326 CTGCCTGAGCAGGATGGGGAAGG - Intergenic
994171277 5:96662216-96662238 CTCCGCGGGCAGGAAGGGGAGGG + Exonic
994465195 5:100118514-100118536 CTCCCCATCATAGATGGGGAAGG - Intergenic
995785811 5:115826169-115826191 CGCCTCATGCAGGAAGTGGAAGG - Intergenic
997467968 5:134100773-134100795 CCTCCCATCCAGGATGGGCAGGG + Intergenic
997800504 5:136856199-136856221 CACCACATGAAGAATGGGGAGGG + Intergenic
999080996 5:148843599-148843621 CTTTCCATGAAAGATGGGGAGGG - Intergenic
999262978 5:150249022-150249044 CTTCCACTGCAGGATGGGGATGG + Intronic
999653301 5:153788376-153788398 CTCCCAATGCAGGGAGGAGAAGG - Intronic
999660361 5:153856335-153856357 CTGCCCATCCAGAATGGGGGAGG + Intergenic
1000543166 5:162566148-162566170 CCACCCAGGCAGGAAGGGGAGGG + Intergenic
1001041354 5:168337856-168337878 CTAGCCATGCAGGAAGAGGATGG + Intronic
1001406244 5:171479658-171479680 TTCCCCAGGCAGGATGGGAGGGG + Intergenic
1001479966 5:172081887-172081909 CTCCCCATGTTGGAAGGGGAAGG - Intronic
1001487088 5:172127545-172127567 CTCCCAAGGCAGGAGGAGGAAGG - Intronic
1001934243 5:175693321-175693343 GTCTCCAGGCAGGGTGGGGAGGG - Intergenic
1002089924 5:176798456-176798478 CTCCCCTTGAAGGAAGGGAAAGG + Intergenic
1003286035 6:4734638-4734660 CTCCTAATTCAGGAAGGGGAGGG + Intronic
1003992415 6:11499201-11499223 CTCCCCCAGCAGGAAGTGGATGG - Intergenic
1006075262 6:31528638-31528660 CTCGCCATGCAGCTTGGAGAAGG + Intergenic
1006182698 6:32163713-32163735 CTCCCCAAGGAGGGTGGGGGTGG + Intronic
1006285921 6:33094078-33094100 CTCCCCATGCTGGGCTGGGAGGG - Intergenic
1006357371 6:33567894-33567916 CACCCCCAGCAGGGTGGGGAGGG - Intergenic
1006424568 6:33956139-33956161 CTCCCCAAGCAGGAAGGGCAAGG - Intergenic
1006536737 6:34705207-34705229 CTCCCAAAGCATGATGGGAAAGG + Intergenic
1007788720 6:44297136-44297158 CACCCCAGGTAGGATGGGGGAGG - Intronic
1007941494 6:45785694-45785716 TTCCCCCTGCAGGATGGAGCTGG + Intergenic
1010474943 6:76275789-76275811 CTCCCTATGGAGGAGGGGAAAGG - Intergenic
1014154978 6:118099742-118099764 CTCCCAATGCAGGATGCACAAGG - Intronic
1015496714 6:133890148-133890170 CACCCCAGGGAGGATGGCGATGG - Intronic
1016459376 6:144266141-144266163 CTCCTCCTGCTGGATGGGGGAGG - Intergenic
1018060007 6:160082829-160082851 CTCCTGAGGCAGCATGGGGAAGG + Intronic
1018129551 6:160715990-160716012 CTCACCATGCAGTATGGGGCTGG - Intronic
1020109532 7:5440216-5440238 GAACCCATGCAGGGTGGGGATGG - Intronic
1020149048 7:5667518-5667540 CTGCTCCTGCAGGATGGAGAAGG - Intronic
1022452319 7:30526202-30526224 CTGCCATTGCAGGGTGGGGAGGG + Intronic
1022781522 7:33589294-33589316 CGTCCCATGCAGGATGGAGAAGG + Intronic
1026018813 7:66692960-66692982 CCCCCCATGCCGGAAGGGGCTGG + Intronic
1028451128 7:90984547-90984569 CTCCACCTACATGATGGGGAGGG - Intronic
1029539029 7:101172319-101172341 CCCTCCGTGCGGGATGGGGAAGG + Exonic
1032705361 7:134416752-134416774 CTCTTCATGAGGGATGGGGATGG + Intergenic
1033038982 7:137901300-137901322 CTACCAATGGAAGATGGGGAAGG - Intronic
1033195143 7:139321311-139321333 CTTCCCAGGCAGGAGGGGGTGGG + Intergenic
1034437715 7:151071049-151071071 CTGCCAAAGCAGCATGGGGATGG - Intronic
1034438974 7:151077017-151077039 CTCCCCCTGCAGGGTGGTGCTGG - Exonic
1034530809 7:151695354-151695376 CTCCCCCTGCAGGAAGTGGATGG - Intronic
1035244510 7:157553598-157553620 CTCCCCATGTTGTCTGGGGATGG - Intronic
1035590913 8:812323-812345 CTGCCCATGGGGGATGGTGAGGG + Intergenic
1036756323 8:11473592-11473614 CTCCCTGGCCAGGATGGGGATGG - Intronic
1037805470 8:22056027-22056049 CCCCCTGGGCAGGATGGGGAAGG - Intronic
1038708721 8:29921195-29921217 CTGCTCATGCAGGAGAGGGAAGG - Intergenic
1039603897 8:38865331-38865353 CTCACCATTCAGAATGGGGGTGG + Intergenic
1039899511 8:41741114-41741136 CACCCCATGGAGGTAGGGGAGGG + Intronic
1043800896 8:84608330-84608352 CACCTCATGCAGGACTGGGATGG + Intronic
1048874952 8:138829277-138829299 CTGCCCATGCAGGAGGAAGATGG + Intronic
1048971655 8:139648460-139648482 CAACCCATGCAAGATGGTGATGG + Intronic
1049574316 8:143383422-143383444 CGGCCCAAGCAGGCTGGGGAGGG - Exonic
1049748537 8:144273062-144273084 CTCCACAAGCAGCGTGGGGAGGG + Intronic
1049958044 9:711454-711476 CTCCCCATGGAGGAAGTGGTGGG - Exonic
1050096348 9:2071083-2071105 CTCCCAGAGCAGGATGGGAAGGG + Intronic
1051367308 9:16330090-16330112 CTTCCCACGCAGGGTGGGGCAGG + Intergenic
1054951678 9:70858911-70858933 CTGCCTCTCCAGGATGGGGAAGG + Intronic
1056778600 9:89532724-89532746 ATCCCTATGCAGTATGGTGAGGG - Intergenic
1057211942 9:93205317-93205339 CTCCCCATGAAGGCTGGTGCTGG - Intronic
1057259994 9:93577689-93577711 CTCCCTAAGGAAGATGGGGAGGG + Intronic
1057476360 9:95406116-95406138 CTCCCCTTTCAAGATGTGGAAGG - Intergenic
1057604168 9:96486893-96486915 CTCCCACTGCAGGAAGGGGCAGG - Intronic
1057750852 9:97791712-97791734 ATGCCCATGCATGTTGGGGAGGG + Intergenic
1057915687 9:99053469-99053491 CTCCCCTGGAAGGAGGGGGAGGG + Intronic
1060052635 9:120388122-120388144 CTCCCCAGACACGATGGTGAGGG - Intergenic
1060256041 9:122031842-122031864 CTCCCCAGGCATGACGGAGATGG - Exonic
1061053320 9:128208674-128208696 CTCCCCAAGCAGGATGGGTCTGG - Intronic
1061059171 9:128242166-128242188 CTCCCCATGGGGGATGGGGTAGG - Intronic
1061281828 9:129602016-129602038 CTGCCCAAGAAGGATGGGGAGGG - Intergenic
1203519423 Un_GL000213v1:32541-32563 CTCCTCATCCAGGATGAAGAGGG + Intergenic
1187877231 X:23814484-23814506 CTCCCCTTGCCGGATGGGCGTGG + Intergenic
1190801887 X:53796717-53796739 CTACCCATGAAGTAAGGGGAAGG - Intergenic
1191225706 X:58040662-58040684 GAGGCCATGCAGGATGGGGAAGG - Intergenic
1192521912 X:71809725-71809747 CTGCCCATCCAGAATGGGGGAGG + Intergenic
1193694442 X:84690586-84690608 CTCTCCATAGAGGATGAGGAAGG - Intergenic
1196883834 X:120224144-120224166 CACCCCTTCCAGGTTGGGGAGGG - Intergenic