ID: 1157514270

View in Genome Browser
Species Human (GRCh38)
Location 18:48299696-48299718
Sequence ATGAAGAGGCTGAAGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1144
Summary {0: 1, 1: 0, 2: 10, 3: 73, 4: 1060}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157514255_1157514270 30 Left 1157514255 18:48299643-48299665 CCAGAGGCCAGTCCAGCTGTGGG 0: 1
1: 1
2: 1
3: 35
4: 388
Right 1157514270 18:48299696-48299718 ATGAAGAGGCTGAAGGAGGATGG 0: 1
1: 0
2: 10
3: 73
4: 1060
1157514259_1157514270 18 Left 1157514259 18:48299655-48299677 CCAGCTGTGGGTGAGTAGGAAAC 0: 1
1: 0
2: 1
3: 12
4: 162
Right 1157514270 18:48299696-48299718 ATGAAGAGGCTGAAGGAGGATGG 0: 1
1: 0
2: 10
3: 73
4: 1060
1157514266_1157514270 -7 Left 1157514266 18:48299680-48299702 CCAGGGGAAAGGGAGGATGAAGA 0: 1
1: 0
2: 0
3: 61
4: 534
Right 1157514270 18:48299696-48299718 ATGAAGAGGCTGAAGGAGGATGG 0: 1
1: 0
2: 10
3: 73
4: 1060
1157514257_1157514270 23 Left 1157514257 18:48299650-48299672 CCAGTCCAGCTGTGGGTGAGTAG 0: 1
1: 0
2: 3
3: 11
4: 167
Right 1157514270 18:48299696-48299718 ATGAAGAGGCTGAAGGAGGATGG 0: 1
1: 0
2: 10
3: 73
4: 1060

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157514270 Original CRISPR ATGAAGAGGCTGAAGGAGGA TGG Intronic
900474926 1:2871664-2871686 ATGAAGAGGCTGTGAGAGGTGGG - Intergenic
900665150 1:3810262-3810284 ATTATGAGACTGAAGGAAGAGGG - Intergenic
900735781 1:4298634-4298656 ATGGAGTGGGTGAATGAGGAGGG + Intergenic
900861293 1:5234276-5234298 GTGAATAGTCTGAAGGTGGAGGG - Intergenic
900886735 1:5420705-5420727 TTGAAGGGGCTGCAGGTGGAAGG + Intergenic
901077400 1:6563915-6563937 ATGAAGAGGGTGAAGTGGCAAGG + Intronic
901773416 1:11542917-11542939 GAGAAGAGGCAGGAGGAGGATGG - Intergenic
902275036 1:15333347-15333369 GGGAAGAGGAGGAAGGAGGAGGG + Intronic
902404761 1:16176562-16176584 AGGAGGAGGATGGAGGAGGATGG - Intergenic
902430962 1:16362733-16362755 CTCAGGAGGCTGAAGCAGGAGGG + Intronic
902515859 1:16989317-16989339 CTCAAGAGGCTGAGGCAGGAGGG - Intronic
902687521 1:18088312-18088334 AGAAAGAGGCTGAGGCAGGATGG + Intergenic
902713942 1:18259651-18259673 GGGATGAGGCTCAAGGAGGAAGG + Intronic
903053179 1:20616674-20616696 ATGAAAAAGCTGAAGGAGGCAGG + Intronic
903131379 1:21281611-21281633 ATGAGAAGCCTAAAGGAGGAAGG - Intronic
903588137 1:24432625-24432647 AGTAAGTGGCTGAAGAAGGATGG - Intronic
903687486 1:25142537-25142559 CTGGAAAGGCTGGAGGAGGAAGG + Intergenic
903947067 1:26970682-26970704 ATGCAGAGGGTGAGGGAAGAGGG + Intergenic
903955450 1:27022241-27022263 ACGCAGAGACTGAAGGATGAGGG - Intergenic
904223172 1:28990392-28990414 ATAAAGAGGGGGAAGGAGGGAGG - Intronic
904418955 1:30379267-30379289 ATAAACAGGCTGCTGGAGGATGG + Intergenic
904586850 1:31585452-31585474 ATGAAGGAGCTGATGGAGAATGG + Exonic
904602961 1:31683815-31683837 AGGAAGAAGCTGGAGGAGAAGGG - Intronic
904633827 1:31864213-31864235 GTCAAGAGGCAGAAGGAGCAGGG + Intergenic
904761489 1:32807843-32807865 ATGAAGAGACTGAAGGAGAATGG - Intronic
904883322 1:33716996-33717018 AGGAAGAGGCAGGTGGAGGATGG + Intronic
904909454 1:33922876-33922898 ATGGATGGGCTGGAGGAGGAAGG - Intronic
904927344 1:34059371-34059393 ATGAGGGGGCTGAGGGAAGAGGG - Intronic
905137839 1:35813780-35813802 AGGAAGAGGAAGAAGGAAGAAGG + Intronic
905251383 1:36650932-36650954 AGGCAGAGGCAGAAGGAGGTTGG + Intergenic
905313572 1:37066870-37066892 ATGAAGATGGGGAAGGAGGGAGG - Intergenic
905349689 1:37336874-37336896 TTGAAGAGGCAGAAGTGGGAGGG + Intergenic
905722795 1:40220881-40220903 TTTGAGAGGCTGAGGGAGGAGGG + Intronic
906684709 1:47755926-47755948 ATGATGAAGATGAGGGAGGACGG - Intergenic
907087828 1:51693262-51693284 CTTAGGAGGCTGAAGCAGGAGGG + Intronic
908561770 1:65313158-65313180 CTCAAGAGGCTGAGGCAGGAGGG - Intronic
908872244 1:68626731-68626753 CTCAGGAGGCTGAAGCAGGAGGG - Intergenic
908949383 1:69541214-69541236 ATGAAAAGGCAGAAAGATGAGGG - Intergenic
910189813 1:84583934-84583956 GCCAAGAGGCTGAAGGGGGAGGG - Intergenic
910427408 1:87131143-87131165 ATGAAGAGGCCAAAGCACGAAGG + Intronic
910556071 1:88534372-88534394 AAGAAGAGGCTGCAGAAAGATGG - Intergenic
910602442 1:89046403-89046425 ATGAAATGCCTGAAGAAGGAAGG + Intergenic
910638431 1:89434826-89434848 ATGAAATGCCTGAAGAAGGAAGG - Intergenic
911008753 1:93255777-93255799 AAGAAGAGGAAGAAGAAGGAGGG + Intronic
911127471 1:94353833-94353855 AAGAACAGGCTGAGAGAGGATGG - Intergenic
911244415 1:95501030-95501052 ATGGAGAGGGTAAAGGAGAAAGG - Intergenic
911436457 1:97865531-97865553 AATCAGAGGGTGAAGGAGGATGG - Intronic
912063569 1:105705944-105705966 AAGAAGAGGAGGAAGAAGGAGGG + Intergenic
912167422 1:107057238-107057260 ACCAAGTGGCTGAAGGAGGGCGG + Exonic
912228636 1:107766238-107766260 AAGAAGAAGAAGAAGGAGGAGGG - Intronic
912467463 1:109883823-109883845 CCCCAGAGGCTGAAGGAGGAAGG + Intergenic
912935263 1:113998364-113998386 AGGAAGAGGAGGAAGGAGAAGGG + Intergenic
913023765 1:114813782-114813804 CTCAAGAAGCTGAAGTAGGAGGG - Intergenic
913209296 1:116570162-116570184 GTGTGGAGGGTGAAGGAGGATGG + Intronic
913409327 1:118533593-118533615 ATAAAGAGAGTGAAGAAGGAAGG - Intergenic
913939865 1:125091650-125091672 AGGAGGAGGGGGAAGGAGGAAGG + Intergenic
913996523 1:143655214-143655236 AGGAAGAGGAAGGAGGAGGAGGG - Intergenic
914262639 1:146011794-146011816 ATGAAAAAGCTGAAAGAGGCAGG - Intergenic
914505732 1:148287597-148287619 AGGAAGAGGGAGGAGGAGGAGGG + Intergenic
914668037 1:149848496-149848518 TTCAAGAGGCAGCAGGAGGATGG - Intronic
914693943 1:150058399-150058421 CTCAGGAGGCTGAGGGAGGAGGG + Intergenic
914744379 1:150490809-150490831 ATGAGGAAGCTGGAGGAGAAGGG + Intronic
915289595 1:154874311-154874333 ATGCTGGGGCTTAAGGAGGAAGG - Intergenic
915589673 1:156863383-156863405 ATGGAAAGGCTCAACGAGGAGGG - Intronic
915604317 1:156941204-156941226 AGGAAGAGTCTGGAAGAGGAAGG - Intronic
915605354 1:156946976-156946998 ATGAAGAAGCTCCGGGAGGAAGG - Exonic
915838821 1:159199383-159199405 AAGAAGAGGCGGAGGGAGGGAGG + Intronic
916059976 1:161091704-161091726 ATGGATAGGCTGAAGGAGATTGG - Intergenic
916890482 1:169107871-169107893 ATGATGATGTTGGAGGAGGAGGG - Intronic
916915028 1:169397189-169397211 ATGAACATGAGGAAGGAGGAGGG + Intronic
916943920 1:169704866-169704888 ATGAAGAAACTGAAGTTGGAGGG - Intronic
916959466 1:169874549-169874571 AAGAAGAGTGTGAAGGAAGAAGG + Intronic
917313592 1:173702588-173702610 AGGAAGAAGGAGAAGGAGGAAGG + Intergenic
917844797 1:179011565-179011587 ACTCAGAGGCTGAAGTAGGAGGG + Intergenic
918128690 1:181606369-181606391 AACAAGAGGGTGAAGGAGTAGGG - Intronic
918761847 1:188420536-188420558 AGGGAGAGACAGAAGGAGGAAGG - Intergenic
919534772 1:198773898-198773920 TTTGAGAGGCTGAAGCAGGAGGG - Intergenic
919595845 1:199561519-199561541 AAGAAGAAGGAGAAGGAGGAGGG - Intergenic
919830408 1:201536894-201536916 ATGGACAGGTTGAGGGAGGAAGG - Intergenic
919887368 1:201944681-201944703 AAGAAGAGGGAGAAGGAGGGAGG - Intronic
920044946 1:203127111-203127133 ATGAAGAGGAAGAAGGAGGAAGG + Exonic
920077856 1:203350178-203350200 AAGAAGAGGCTGAAGTGGGCAGG - Intronic
920578208 1:207078843-207078865 ATGGGGAGGTTGAGGGAGGAGGG + Intronic
920649539 1:207826418-207826440 ATGAGGAGGCTGGAGGAGGCAGG + Intergenic
921269890 1:213458146-213458168 TTGTAGAGGGGGAAGGAGGATGG - Intergenic
922323291 1:224506395-224506417 AAGCCAAGGCTGAAGGAGGAAGG - Intronic
922433207 1:225576729-225576751 ATGAAGAGGCAGCAAGAGGGCGG + Intronic
922584892 1:226726339-226726361 ATGATGATGATGAAGGAGAAAGG + Intronic
922741646 1:228017375-228017397 GTGGAGAGGCCGCAGGAGGAGGG + Intronic
923003029 1:230023241-230023263 AGGAAGAGGCCGGTGGAGGAAGG + Intergenic
923286911 1:232505081-232505103 ATGAAAAGACTGAAGAAGGAAGG + Intronic
923414276 1:233739610-233739632 AGGAAAAGGCTGAAGGAAGATGG + Intergenic
923904010 1:238362343-238362365 CTCAAGAGGCTGAGGCAGGAGGG + Intergenic
924499813 1:244626724-244626746 GTGAAGAAGCTGCAGAAGGAAGG - Intronic
924562668 1:245170096-245170118 AGGAAGAGGATGATAGAGGATGG + Intronic
924660034 1:246007511-246007533 AAGAAAAGGCAGAAGGAGGCCGG + Intronic
1062805310 10:415383-415405 AAGGAGAGGCAGCAGGAGGAGGG + Intronic
1063173793 10:3533759-3533781 ATGAAGAGGATCAGGGAGGGAGG - Intergenic
1063173812 10:3533829-3533851 ATGAAGAGGATCAGGGAGGGCGG - Intergenic
1063518159 10:6716748-6716770 GTAAAGATGCTGAAGGAGGTAGG + Intergenic
1063816002 10:9772620-9772642 CTGAGGAGGCTGAAGCAGCAGGG - Intergenic
1064102797 10:12477731-12477753 GGGAAGAAGCTGAAGGCGGAGGG + Intronic
1064245858 10:13667242-13667264 ATGAATAGGCAGATGGGGGAGGG - Intronic
1064317266 10:14269965-14269987 ACGAAAAGGCTGAAGAAGGATGG + Intronic
1065314636 10:24451345-24451367 ATGTTAAGGCTGAAGGTGGAGGG + Intronic
1065484815 10:26227530-26227552 TTAAAGAGGCTGGAGAAGGAAGG - Intronic
1065736560 10:28758296-28758318 AAGTAGAGACAGAAGGAGGAAGG - Intergenic
1065789609 10:29248759-29248781 CTCAGGAGGCTGAAGCAGGAGGG + Intergenic
1065983651 10:30928896-30928918 ATCAGGAGGTTGAAGGAGGAAGG - Intronic
1067193100 10:44089097-44089119 ATGAAGAGGTAGAAGTAGCAGGG + Intergenic
1068165016 10:53319086-53319108 ATGAAGAGGAAGAAGGAAAAAGG + Intergenic
1068483467 10:57625796-57625818 ATGAAGACACTGGAGGAAGACGG - Intergenic
1069265692 10:66454770-66454792 ATGAAGATGAAGGAGGAGGAAGG + Intronic
1070102091 10:73398105-73398127 ATGAAGAGGATAAAGGGAGAAGG + Intronic
1070379144 10:75864281-75864303 ATGAAAAGACTGAAGGAAGCCGG + Intronic
1070453035 10:76581099-76581121 TGGAAGAGGCAGAAAGAGGAAGG + Intergenic
1070522270 10:77264383-77264405 AGTGTGAGGCTGAAGGAGGAAGG - Intronic
1070797998 10:79228382-79228404 ATCAAGAGACTGGGGGAGGAGGG + Intronic
1071562490 10:86655085-86655107 ATAAACAGGCTGATAGAGGAGGG + Intronic
1071604352 10:86974502-86974524 ATGAAGAAGAAGAGGGAGGAAGG - Intronic
1072160557 10:92762290-92762312 TTGAAGAAGTTGAAGCAGGAAGG - Intergenic
1072349993 10:94547317-94547339 ATGAAGAAACTGAGGGAGAAGGG + Intronic
1072428401 10:95349933-95349955 CTGAGGAGGCTGAGGCAGGAGGG - Intronic
1072846419 10:98836353-98836375 TTGAAGGGTCTGAAGGAGGCAGG - Intronic
1072999013 10:100272029-100272051 CTCAGGAGGCTGAAGCAGGAGGG + Intergenic
1073759828 10:106617284-106617306 AGGAGGAGGCAGAAGGAGGGAGG - Intronic
1074722514 10:116274490-116274512 AAGAAGAGGAGGAAGGAGGAGGG + Intergenic
1075657777 10:124173460-124173482 GGGCAGAGGCTGAAGGAGGAGGG - Intergenic
1076210678 10:128642220-128642242 ATTCACAGGCTGGAGGAGGATGG + Intergenic
1076448886 10:130541508-130541530 AAGAAGAGAGGGAAGGAGGAAGG - Intergenic
1076736441 10:132461253-132461275 AGGAGGAGGATGAAGGAGGAGGG - Intergenic
1077010213 11:376270-376292 ATGAAGATGGACAAGGAGGAGGG + Exonic
1077093778 11:790894-790916 ATGCAGAGGCTGAAAAAGGAGGG + Exonic
1077159988 11:1108307-1108329 AAGGGCAGGCTGAAGGAGGAGGG - Intergenic
1077532877 11:3105523-3105545 GTGGAGAGGGTTAAGGAGGACGG - Intronic
1077590806 11:3489613-3489635 CTCAGGAGGCTGAAGCAGGAGGG - Intergenic
1077779600 11:5312022-5312044 GAGAAGAGGCTGAAGAGGGAAGG - Intronic
1078011707 11:7577425-7577447 AGGGAGAGGCTGAAGGACGCAGG + Intronic
1078500749 11:11872577-11872599 ATAAAGACCCTGAAGGATGATGG + Intronic
1078636272 11:13053350-13053372 ATGAAGACTTTGCAGGAGGAAGG + Intergenic
1078827292 11:14941336-14941358 AACAAGAGGGTGGAGGAGGATGG - Intronic
1079132501 11:17755667-17755689 ATGGAGAGGCTGCAGGGGGTGGG + Intronic
1079358799 11:19753315-19753337 ATAAAGAGGCTTGAGGGGGAAGG - Intronic
1079377703 11:19908374-19908396 AGGAAGAGGTTAACGGAGGAAGG - Intronic
1079410280 11:20181097-20181119 AGGAAGAGGGAGGAGGAGGAAGG - Intergenic
1079817689 11:25083061-25083083 ATTTAGAGGCTGAAGCAGCAAGG + Intergenic
1079910482 11:26303540-26303562 ATTAAGAGGGAGACGGAGGAAGG + Intergenic
1080288755 11:30646305-30646327 AGGAGGATGCTGAAGGAGAATGG + Intergenic
1080394313 11:31875902-31875924 AGGAAGCTGCAGAAGGAGGAGGG - Intronic
1080569361 11:33542292-33542314 ATGAAGAGGATGGAGGTAGAGGG - Exonic
1080738884 11:35045199-35045221 AAGAAGGTGCTGAAAGAGGATGG + Intergenic
1080806926 11:35662604-35662626 AGGAGGAGGGAGAAGGAGGATGG - Intergenic
1081194106 11:40140243-40140265 ATGAGGAGGCAGCAGGAGGCAGG - Intronic
1081206119 11:40277453-40277475 AAGAAGAGGGGGAAAGAGGAAGG + Intronic
1081420689 11:42872876-42872898 AATAAGAGGCTGAAAGAGGTTGG - Intergenic
1081594799 11:44451847-44451869 CTGCAGAGGCTGCAGGATGAAGG - Intergenic
1081670620 11:44940231-44940253 ATGGGGAGGCTGGAAGAGGAAGG - Intronic
1081874265 11:46397874-46397896 ATCCAGAGGCTGATGGCGGAGGG - Exonic
1082771197 11:57208897-57208919 CTCAAGAGGCTGAGGCAGGAGGG + Intergenic
1082788394 11:57330347-57330369 TTGGAGAGGATGAAGGAGGAAGG - Exonic
1082809178 11:57468197-57468219 ATGGAGATGCTGAGGCAGGAAGG - Intronic
1083829531 11:65222555-65222577 ATGAACGGGAGGAAGGAGGAAGG + Intergenic
1084124877 11:67092807-67092829 CTCAAGAGGCTGAAGCAGGCTGG - Intergenic
1084246528 11:67861400-67861422 CTCAGGAGGCTGAAGCAGGAGGG - Intergenic
1084330824 11:68429143-68429165 CTCAAGAGGCTGAGGCAGGAGGG + Intronic
1084470415 11:69356178-69356200 ATGAAGAGAAGGAAGGAGGGAGG + Intronic
1084658835 11:70535525-70535547 ATGAATAGACTGATGGATGATGG - Intronic
1084826153 11:71733101-71733123 CTCAGGAGGCTGAAGCAGGAGGG + Intergenic
1084921869 11:72477466-72477488 CTGAAGAGGCTGAAGGAGGGCGG + Intergenic
1084941491 11:72615601-72615623 ATGAAGCAGCTGAAGGTGGGAGG - Intronic
1084956325 11:72693549-72693571 ATGGAGAGGCTGGGGCAGGATGG - Intronic
1085050417 11:73377314-73377336 AGTAAGAGGCAGGAGGAGGAGGG + Intronic
1085372435 11:76021301-76021323 ATGAGGAGGGTGAAGCAAGATGG - Intronic
1085646291 11:78225194-78225216 AGGAAGAAGCTGACAGAGGAAGG + Exonic
1085983131 11:81748880-81748902 ATGAAGAAGGAGAAGGAGAAGGG - Intergenic
1086079574 11:82889397-82889419 AAGAAGAAGGAGAAGGAGGAGGG + Intronic
1086920041 11:92575804-92575826 GTTAATAGGCAGAAGGAGGAAGG + Intronic
1087732074 11:101790223-101790245 AAGAAGAGGAAGAAGGAGAAAGG + Intronic
1088257748 11:107916796-107916818 ATGTGGAGCCAGAAGGAGGATGG - Intronic
1088259910 11:107934324-107934346 CTCAGGAGGCTGAAGTAGGAGGG + Intronic
1088505753 11:110525415-110525437 ATCAGGAGGCTGAGGCAGGAGGG + Intergenic
1088615127 11:111618553-111618575 CTGGGGAGGCTGAAGCAGGAGGG + Intronic
1088996148 11:114999042-114999064 ATGCAGAGCCAGGAGGAGGAAGG + Intergenic
1089391476 11:118104853-118104875 AGGAAGAGGAGGAAGGAGGAAGG - Intronic
1090264894 11:125347561-125347583 TTGAGGAGGCTGAGGGAGGTGGG + Intronic
1090894009 11:130953089-130953111 AGGAAAAGACAGAAGGAGGAAGG - Intergenic
1090933333 11:131319412-131319434 ATGAAGAGGAAGGAGAAGGAGGG - Intergenic
1090941838 11:131393870-131393892 CTTAATAGGCTGAAGGAGGTAGG - Intronic
1091449035 12:561437-561459 ATGAAGACGCTGTAGCCGGAGGG + Exonic
1091673764 12:2472388-2472410 ATGAATAGGCTTAATGAAGATGG - Intronic
1091857668 12:3752713-3752735 ATGAAGAGGCTGGATGAGGCTGG + Intronic
1091919081 12:4289998-4290020 ATGGAGAGGCTGAAGAATGCTGG + Intronic
1092039013 12:5367076-5367098 ATGAAGAGGCTGATGCTGGGAGG + Intergenic
1092239128 12:6826840-6826862 AGGAAGAGGCTGAAGGTGGGGGG + Exonic
1092307259 12:7314140-7314162 ATGTAGAAGATGAAGGAAGAAGG + Intronic
1092314826 12:7399474-7399496 AGGAAGAGGAAGAAGAAGGAAGG - Intronic
1092417090 12:8298521-8298543 CTCAACAGGCTGAAGCAGGAGGG - Intergenic
1092752597 12:11732689-11732711 CTCTAGAGGCAGAAGGAGGACGG - Intronic
1093200237 12:16177758-16177780 CTCAGGAGGCTGAAGCAGGAGGG - Intergenic
1094196183 12:27752142-27752164 ATCAGGAGGCTGAGGCAGGAGGG + Intronic
1094465418 12:30749072-30749094 AATAAAAGGCTGAAGGAGGTTGG + Intronic
1094465812 12:30753601-30753623 CAGATGAGGCTGAAGGAGGTGGG + Exonic
1094715326 12:33008210-33008232 AAGAAGAGAAAGAAGGAGGAAGG - Intergenic
1095215386 12:39541489-39541511 AAGAAGAGGCTTGAGGAGAAAGG + Intergenic
1095550362 12:43430931-43430953 ATGATCAGGCTGGATGAGGATGG - Intronic
1095636356 12:44438498-44438520 ATTAAGAGGGCCAAGGAGGATGG - Intergenic
1095748097 12:45682162-45682184 ATGAGGAGGTGGAAGGGGGATGG - Intergenic
1095966976 12:47874724-47874746 ATGAAGAGAATGAAGGTGGATGG - Intronic
1095990031 12:48028191-48028213 ATAAAAAGGCTGAATGAGGCCGG + Intergenic
1096000307 12:48124199-48124221 ATGAAGAAACTGAGGAAGGAGGG + Intronic
1096111323 12:49030933-49030955 AAGAAGCTGCGGAAGGAGGACGG - Exonic
1096441599 12:51648308-51648330 CTGAGGAGGCTGAGGCAGGAGGG - Intronic
1096447460 12:51706471-51706493 AGGAAGAAGGTGAAGAAGGAGGG + Exonic
1096629693 12:52918113-52918135 AAGAAGAGGAAGAAGAAGGAGGG + Intronic
1096758748 12:53822222-53822244 AAGAAGAGGGAGGAGGAGGAGGG - Intergenic
1096806494 12:54144169-54144191 GTGAAGAGGCTGAAAAGGGAAGG + Intergenic
1096856394 12:54487398-54487420 ATAAAAAGGCTCAAGGAGGCCGG - Intergenic
1096863114 12:54544323-54544345 ATGCAGATGCAGATGGAGGAGGG - Exonic
1096972210 12:55676134-55676156 CTCAAGAGGCTGAAGCAGGAAGG + Intergenic
1097050427 12:56219907-56219929 CTGAGGAGGCTGAAGGGGGAAGG + Intronic
1097178214 12:57155841-57155863 CTCAGGAGGCTGAAGCAGGAGGG + Intronic
1097800928 12:63913051-63913073 AAGAAGAGGCAGATCGAGGAGGG - Intronic
1097998676 12:65917657-65917679 AGGAAGAGACAGAAGGGGGAAGG + Intronic
1098061969 12:66572583-66572605 AGGACAATGCTGAAGGAGGAGGG + Intronic
1098073546 12:66701233-66701255 ATGAAGAGGAGGAAGGGGTAAGG - Intronic
1098495878 12:71135279-71135301 AAGAAGAAGAAGAAGGAGGAGGG + Intronic
1098701310 12:73631187-73631209 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1098987903 12:77031939-77031961 ATGGAGAAGTTGAAGGTGGATGG - Intronic
1099147429 12:79064225-79064247 AAGAAAAGACTGAAGGAGAAAGG + Intronic
1099278567 12:80611260-80611282 ATCAGGAGTCTGAAGGAGGATGG - Intronic
1099389300 12:82059405-82059427 AGGAAGAGGCTGGAGGAGGAGGG + Intergenic
1100169942 12:91963057-91963079 AAGAAGAGGATGAAGGAAGAAGG - Intergenic
1100356060 12:93831112-93831134 ATCAGGAGGCTGAGGCAGGAGGG + Intronic
1100874680 12:98949535-98949557 AGGAAGGGGTTGGAGGAGGAAGG + Intronic
1101431164 12:104628621-104628643 AAGATGAGGCTGAAGAGGGAGGG - Intronic
1101620583 12:106383541-106383563 ATAAGGAGGCTCAAGGAGAAGGG + Intronic
1101800929 12:108021499-108021521 ATGAAGGAGCAGGAGGAGGAAGG - Intergenic
1101916286 12:108898646-108898668 ATGAGGAGGGTCAAGGATGAAGG - Intronic
1101946625 12:109142139-109142161 CTTGAGAGGCTGAAGCAGGAGGG + Intronic
1101950980 12:109174760-109174782 CTGAGGAGGCTGAGGCAGGAGGG + Intronic
1102243218 12:111338453-111338475 ATGAAGAAGCTGGAGAAGAAAGG + Exonic
1102318645 12:111911805-111911827 CACAAGAGGCTGAAGTAGGAGGG - Intergenic
1102513190 12:113429252-113429274 GTGCAGAGGCTGCAGGGGGAGGG + Exonic
1102899318 12:116624064-116624086 AAGAAGAAGGTGAAGGAAGAAGG + Intergenic
1102902329 12:116648011-116648033 AGGCAGAGGATGAAGGAGGAAGG - Intergenic
1103030245 12:117606760-117606782 ATGAAGGGAGGGAAGGAGGAAGG - Intronic
1103162185 12:118738709-118738731 ATGCAGAGCCTGATGGAGAAGGG - Intergenic
1103722389 12:122981762-122981784 AGGAAGAAGCTGAAGAAGAAGGG + Exonic
1103870515 12:124087866-124087888 ATGCACGGGCTGAAGGAGGCTGG - Intronic
1104195282 12:126531239-126531261 CTCAAGAGGCTGAGGCAGGAGGG - Intergenic
1104199801 12:126577442-126577464 ATGAAGGGGTTGAAAGAGAATGG + Intergenic
1104260071 12:127174102-127174124 AGGAAGAGAGTGAAGGGGGATGG + Intergenic
1104275659 12:127325035-127325057 ATGAAGATGGAGGAGGAGGAAGG - Intergenic
1104656241 12:130575710-130575732 ATGAAGGGGATGGAGGATGAAGG + Intronic
1104683231 12:130766916-130766938 AGGAAGAGAGGGAAGGAGGAAGG + Intergenic
1105967745 13:25399850-25399872 AAGAAGAAGATGAAAGAGGAGGG - Intronic
1106081819 13:26506634-26506656 ATGAAGAGTTTCAAGGGGGAGGG - Intergenic
1106473681 13:30079247-30079269 ATGAAAAGGCTGAAAGGGGGAGG - Intergenic
1107299319 13:38948517-38948539 ATGAATGGGCTAGAGGAGGAGGG - Intergenic
1107376466 13:39809984-39810006 TCGAAGAGGAAGAAGGAGGAGGG - Intergenic
1108021894 13:46136170-46136192 AGCAGGAGGCAGAAGGAGGATGG - Intronic
1108192750 13:47959409-47959431 AGGGAGAGGGAGAAGGAGGAGGG + Intronic
1108970361 13:56367974-56367996 CTGAAGAGGCTGACAGTGGAAGG - Intergenic
1109377922 13:61522833-61522855 ATGGAGAGCCAGAAGGTGGAGGG + Intergenic
1110816471 13:79865908-79865930 AGGAAGAGGATGAGAGAGGAAGG + Intergenic
1110849199 13:80224648-80224670 ATGAGGAAGTTGGAGGAGGAGGG + Intergenic
1111076792 13:83248023-83248045 AAGAAGAAGCTGAACAAGGAAGG - Intergenic
1112029066 13:95440431-95440453 TTGGGGAGGCTGAAGCAGGAGGG + Intronic
1112306031 13:98274404-98274426 CAGAAGAGACTGAGGGAGGAAGG + Intronic
1112626572 13:101111468-101111490 GGGAGGAGGCAGAAGGAGGAGGG - Intronic
1112641832 13:101283990-101284012 ATGAAGATGCTGCTGGAGGTTGG - Exonic
1113070037 13:106411428-106411450 ATGAAGAGGCTGCAAGAGGGTGG - Intergenic
1113223249 13:108129444-108129466 AAGAAGAGGCTGAGGGCGGTGGG + Intergenic
1114197695 14:20493626-20493648 ATGAAGAGGAGGCAGGAGAAGGG - Intergenic
1114492189 14:23109999-23110021 ATGAAGATGAGGAAGGAGGAAGG + Intergenic
1115094540 14:29618971-29618993 ATGAGGAGGAGGAAGGGGGAGGG + Intronic
1115095235 14:29627364-29627386 CTGGAGAGGCTGCAGAAGGATGG + Intronic
1115747177 14:36449688-36449710 ATAATGAGGCTGAAGGAGGACGG + Intergenic
1115852021 14:37596192-37596214 CTGAAGCGGCTGAAGGGGGGCGG - Intronic
1115947592 14:38679674-38679696 ATGGAGACTCAGAAGGAGGAGGG - Intergenic
1117350957 14:54881240-54881262 ATGGAGGGGCTATAGGAGGAGGG + Intronic
1117701646 14:58419806-58419828 CTCAAGAGGCTGAGGTAGGAAGG + Intronic
1117783363 14:59257713-59257735 AGGAAGAGGCTGAAGATGGCAGG - Intronic
1118027085 14:61780328-61780350 CTGAAGAGGCTAAACGAGAAAGG - Intronic
1118307831 14:64670159-64670181 GGCAAGAGGCTGAGGGAGGAAGG - Intergenic
1118629627 14:67690739-67690761 TTAAAGAGGCTGAGGCAGGAAGG + Intronic
1118695608 14:68382008-68382030 ATTAGGAGGCTCAAGGGGGATGG + Intronic
1119119815 14:72064225-72064247 CTGAAGGAGGTGAAGGAGGAGGG + Intronic
1119160331 14:72447035-72447057 AGGAAGAGGTGGGAGGAGGAAGG + Intronic
1119523018 14:75300136-75300158 CTCAGGAGGCTGAAGTAGGAGGG - Intergenic
1119661670 14:76456640-76456662 AGGAACAGGCTGGATGAGGATGG + Intronic
1119736309 14:76984942-76984964 AGGAGGAAGCTGATGGAGGAGGG - Intergenic
1119887694 14:78157171-78157193 ATGGAGAGGAGGAAGTAGGAGGG + Intergenic
1119996833 14:79262445-79262467 AAGAGGAGGAGGAAGGAGGAAGG + Intronic
1120058211 14:79950372-79950394 AGGAAGGGGCTTGAGGAGGAAGG - Intergenic
1120199953 14:81526644-81526666 ATAAAGAGGCTGAAGAAGACTGG - Intronic
1120470516 14:84918057-84918079 AGGAGGAGGAGGAAGGAGGAGGG - Intergenic
1120597849 14:86463382-86463404 ATGAAAAGGGTGAAAGGGGAGGG + Intergenic
1120631917 14:86902018-86902040 ATGAAGAGTCTTAACGAGCATGG + Intergenic
1120718789 14:87868401-87868423 ATAAAGAGGCTGAAGGAGGCAGG - Intronic
1120720177 14:87881962-87881984 AGGAAGAGTGTGAAGGAAGAGGG - Intronic
1120880482 14:89412109-89412131 ATGAGGCAGCTGAAGGAGTAGGG + Exonic
1121586923 14:95068924-95068946 AAGAGATGGCTGAAGGAGGAAGG + Intergenic
1121891014 14:97590550-97590572 AGGAAGAGTGGGAAGGAGGAAGG + Intergenic
1122420223 14:101571712-101571734 AAGCAGAGGGGGAAGGAGGAGGG + Intergenic
1122424307 14:101596808-101596830 AGGAAGAGGAGGAAGCAGGATGG - Intergenic
1122464040 14:101918438-101918460 ATGAAGGGGGTGAGGGGGGAAGG - Intronic
1122769559 14:104091954-104091976 ATGCAGAGGCTGCAGGAAGGTGG + Intronic
1123123262 14:105927824-105927846 ATGGAGAGACTGGAGGAGGCAGG - Intronic
1123396224 15:19939793-19939815 AGGAGGAGGGGGAAGGAGGAAGG - Intergenic
1123674063 15:22690641-22690663 CTGAAGCTTCTGAAGGAGGATGG - Intergenic
1123871730 15:24581700-24581722 ATGAGGAGGCAGGAGCAGGAAGG + Intergenic
1123895888 15:24829480-24829502 ATGAGGAGGCAGGAGAAGGAAGG + Intronic
1123899558 15:24862913-24862935 ATGAGGAGGCAGGAGCAGGAAGG + Intronic
1124326071 15:28763633-28763655 CTGAAGCTTCTGAAGGAGGATGG - Intergenic
1124887504 15:33700963-33700985 ACGGGGAGGCTGAGGGAGGAGGG - Exonic
1125277265 15:38006173-38006195 ATCAGGAGGCAGAAGCAGGAAGG + Intergenic
1125341622 15:38681420-38681442 AGGAAGAGGAAGAAGGAAGAAGG - Intergenic
1125456518 15:39865552-39865574 GTGAGGAGGTGGAAGGAGGATGG + Intronic
1125722977 15:41853944-41853966 GAGAAGAGGCTGAAGCAGGCTGG + Intronic
1125778573 15:42242361-42242383 ATGAAGAAGCTGAAGTAGGGTGG + Intronic
1125994131 15:44140773-44140795 CTCAAGAGGCTGAGGTAGGAGGG + Intronic
1126041754 15:44597886-44597908 AAGAAGAGGATGATGTAGGATGG - Intronic
1126475250 15:49058954-49058976 ATGGAGACTCAGAAGGAGGAAGG + Intergenic
1126856515 15:52844622-52844644 ATGAAGAGGTGGTAGAAGGATGG + Intergenic
1127052080 15:55094962-55094984 ATGAAGAAGATGAAGAGGGAGGG - Intergenic
1128154286 15:65383077-65383099 GTGAAGAGGAGGCAGGAGGATGG + Exonic
1128252239 15:66171526-66171548 ATGGAGAGGTGGGAGGAGGAGGG + Intronic
1128341256 15:66824011-66824033 ATGAAGAGAGAGAAGGAGAATGG + Intergenic
1128395978 15:67226238-67226260 TTGGGGAGGCTGAAGCAGGAAGG - Intronic
1128498105 15:68209730-68209752 ATGAAGAGGATGAGGAAGAAGGG + Exonic
1128676235 15:69610999-69611021 ATGAAGAGCCTGGGGGAGGCAGG + Intergenic
1128796468 15:70470120-70470142 ATGCAGGAGCTGAGGGAGGATGG - Intergenic
1128998181 15:72312177-72312199 AGGAAGAGGCTGCAGGAGGTGGG + Intronic
1129057835 15:72834516-72834538 TGGCAGAGGATGAAGGAGGAGGG + Intergenic
1129390922 15:75220594-75220616 CTGAGGTGCCTGAAGGAGGAAGG + Intergenic
1129425643 15:75460577-75460599 CTCAAGAGGCTGAGGCAGGAAGG + Intergenic
1129450501 15:75648554-75648576 AGCAAGAGGAGGAAGGAGGAAGG + Exonic
1129699644 15:77760246-77760268 ATGGAGAGGCTCAAGGAGGTGGG + Intronic
1129708301 15:77807096-77807118 ATGAACTGGGTCAAGGAGGAAGG - Intronic
1129839477 15:78734882-78734904 CAGAAGAGGCTGGGGGAGGAGGG + Intergenic
1130430439 15:83842031-83842053 ATGGGGAGGCAGAAGGGGGATGG - Intronic
1130430479 15:83842219-83842241 ATGAGGAGGCAGAAGGGGGATGG + Intronic
1130865929 15:87933350-87933372 ATGAAAATGCTGGAGAAGGAAGG - Intronic
1131014207 15:89043710-89043732 AAGAGGAGGGAGAAGGAGGAGGG + Intergenic
1131338386 15:91572241-91572263 AATAAGAGGCTGGAGGAGGCAGG + Intergenic
1131513809 15:93064497-93064519 ACGCAGAAGGTGAAGGAGGAAGG - Intronic
1131675787 15:94668807-94668829 AAGAAGAGCCTTGAGGAGGATGG - Intergenic
1132057819 15:98665467-98665489 AGGAAGAGACTGAAGGGCGAAGG - Intronic
1132820050 16:1861648-1861670 CTAAGGAGGCTGAAGCAGGAGGG - Intronic
1133356180 16:5138701-5138723 CTCAGGAGGCTGAAGCAGGAGGG - Intergenic
1133463538 16:6008095-6008117 CTCAGGAGGCTGAAGCAGGAGGG + Intergenic
1133582615 16:7160827-7160849 AGGAGGAGGAGGAAGGAGGAGGG - Intronic
1133802041 16:9092045-9092067 ATGGAGGAGCGGAAGGAGGAGGG + Exonic
1133937009 16:10277624-10277646 AAGAAGAGGGGGAAGTAGGAGGG - Intergenic
1134021184 16:10922619-10922641 ATGAAGAAGCTGAAGCCAGAGGG - Intronic
1134174331 16:11993599-11993621 ATGATGAGCCTGAAGGAGGGAGG + Intronic
1134401529 16:13914501-13914523 GGGGAGAGGCTGAAGGGGGAGGG - Intergenic
1134849397 16:17468680-17468702 ATGAAGAGAAGGAAGGAGGCAGG - Intronic
1134856040 16:17520112-17520134 ATGAAGATGGAGAAGGAGGCAGG + Intergenic
1135117493 16:19735956-19735978 CTCAAGAGGCTGAGGCAGGAAGG + Intronic
1135614940 16:23903071-23903093 TTGGGGAGGCTGAAGCAGGAGGG - Intronic
1135870945 16:26149839-26149861 GAGAAGAGGCTGGAGGGGGATGG - Intergenic
1135928691 16:26717985-26718007 ATGTTGAGGCTGAAGGGGAAGGG + Intergenic
1135939718 16:26810482-26810504 ATGAGGAGGCATAAGGGGGATGG + Intergenic
1135965804 16:27034064-27034086 ATGCACAGGCAGAAGGAGAAAGG + Intergenic
1136083639 16:27869010-27869032 ACTAAGAGGCAGAGGGAGGAGGG + Intronic
1136231076 16:28885786-28885808 TTGAGGAGGCTGAAGGAGACAGG - Intronic
1136360282 16:29775013-29775035 AAGAAGAGGCAGAAGGAAAAAGG + Intergenic
1136367417 16:29815142-29815164 ATGAGGAGGCAGGAAGAGGAAGG - Intronic
1136654759 16:31703207-31703229 AGAAGGAGCCTGAAGGAGGAAGG + Intergenic
1136698695 16:32111945-32111967 AGGAGGAGGGGGAAGGAGGAAGG - Intergenic
1136768909 16:32815884-32815906 AGGAGGAGGGGGAAGGAGGAAGG + Intergenic
1136799198 16:33055241-33055263 AGGAGGAGGGGGAAGGAGGAAGG - Intergenic
1137376836 16:47958990-47959012 CTTGAGAGGCTGAAGTAGGAGGG - Intergenic
1137532445 16:49287949-49287971 CTGAAGATGGAGAAGGAGGAAGG - Intergenic
1137811675 16:51358629-51358651 AGAAAGAGGATGAAGGAGAATGG + Intergenic
1138462001 16:57154663-57154685 ATGGGGAAACTGAAGGAGGAAGG + Intronic
1138588568 16:57986886-57986908 TTGAAGAGCATGAAGGAGGCCGG - Intronic
1138751765 16:59430905-59430927 ATGAACAGGCAGCAAGAGGATGG - Intergenic
1139015096 16:62680010-62680032 AAGAAAAGGCTGAGGGTGGATGG + Intergenic
1139459640 16:67111276-67111298 ATGGAGAGGGTGAAGGGAGAAGG - Intronic
1139589092 16:67923372-67923394 AAGCAGGGGCTGTAGGAGGAGGG - Intronic
1139946283 16:70644736-70644758 AGGAAGAGGAGGAGGGAGGAGGG + Intronic
1140760876 16:78107725-78107747 CTCAAGAGGCTGAAATAGGAGGG + Intronic
1141002372 16:80319904-80319926 ATCAAGAGGATGCAGGAGAATGG - Intergenic
1141845119 16:86603377-86603399 AGGAGGAGGAAGAAGGAGGAGGG - Intergenic
1141985632 16:87577864-87577886 CTCAAGAGGCTGAGGCAGGATGG + Intergenic
1141992446 16:87618296-87618318 AGGAAGAGGAGGCAGGAGGAGGG + Intronic
1142259322 16:89035231-89035253 ATGAAGAGGAGGGAGGGGGAGGG - Intergenic
1203071326 16_KI270728v1_random:1077995-1078017 AGGAGGAGGGGGAAGGAGGAAGG + Intergenic
1142604418 17:1073702-1073724 AGGAAGAGGATGATGGACGAGGG + Intronic
1142785761 17:2221339-2221361 AGGAAGAGAGTGAAGGGGGAGGG - Intronic
1142809442 17:2388355-2388377 GTGAAGAGGCTGCTGGAGGAGGG - Intronic
1143365165 17:6403274-6403296 CTCAAGAGGCTGAAGCTGGAGGG - Intronic
1143579998 17:7819885-7819907 ATGAGGACCCTGAAGGAAGAGGG - Intronic
1143902006 17:10181437-10181459 AAGAAGAGGATGGGGGAGGAGGG + Intronic
1144233317 17:13231115-13231137 ATGAAGAGGGTGCAGGAAGAAGG - Intergenic
1144943916 17:18960193-18960215 ATGATGAGGCTGGATGAGGGAGG - Intronic
1145101709 17:20082487-20082509 CTGAAGAGGCTGAGGTGGGAGGG + Intronic
1145102168 17:20086382-20086404 GTGAAGAGGCTGGCTGAGGAGGG - Intronic
1145692848 17:26762195-26762217 AGGAGGAGGGGGAAGGAGGAAGG - Intergenic
1146438054 17:32869823-32869845 CTCAGGAGGCTGAAGTAGGAGGG + Intronic
1146742429 17:35298354-35298376 GAGAAGAGGATGAGGGAGGAGGG - Intergenic
1147364337 17:39950651-39950673 ATGGAGATGCTGAAGAAGGGGGG + Intergenic
1147427345 17:40352196-40352218 GGGAAGAGGCAGCAGGAGGAGGG - Intronic
1147439441 17:40438629-40438651 TTCAGGAGGCTGAAGCAGGAGGG - Intergenic
1147632265 17:41939739-41939761 AAGAGGAGGCTGAAGGAAGTGGG + Intronic
1148144974 17:45358431-45358453 ATGAATAGTGTGAGGGAGGAGGG + Intergenic
1148153422 17:45409794-45409816 ATGAACAGGAGCAAGGAGGAGGG - Intronic
1148209370 17:45799005-45799027 AGAAAGAGGCTGTGGGAGGAGGG + Intronic
1148571909 17:48677163-48677185 AGGAAGACCCTGAAGAAGGAAGG - Intergenic
1148763443 17:50021727-50021749 ATGAAGAGGATGGGGGTGGAGGG - Intergenic
1148885399 17:50768518-50768540 ATGGAGAGGCGGAAGTAGCAGGG + Intergenic
1149466433 17:56883557-56883579 ATGAAGAGACTGAGGGAGTTGGG + Intergenic
1149595918 17:57864635-57864657 CTGCAGTGGATGAAGGAGGATGG + Intronic
1149797902 17:59538387-59538409 AGGAAGAGGAAGAAGGAAGAAGG - Intergenic
1150118560 17:62578232-62578254 ATGGAGAGGAGGGAGGAGGAGGG + Intronic
1150423612 17:65058952-65058974 AAGAAGAAGAAGAAGGAGGAAGG + Intergenic
1150461631 17:65358620-65358642 AGGAAGAGAATGAAGGAGGCTGG + Intergenic
1150800505 17:68278252-68278274 CTGAAGTGCCTGATGGAGGATGG - Exonic
1150961166 17:69913960-69913982 ATGATGATGATGCAGGAGGATGG + Intergenic
1150998314 17:70344894-70344916 TTGAAGAGGCAGAGGGAAGAGGG - Intergenic
1151398423 17:73840259-73840281 CTGAAGAGGTTGCATGAGGAAGG + Intergenic
1151403417 17:73871111-73871133 ATGAAAGAGCTGAGGGAGGAAGG + Intergenic
1151479859 17:74363591-74363613 ATGCAGAGGCTGAAGGAGGCTGG - Intergenic
1151893971 17:76967920-76967942 CTGAGGAGGCTGAAGTGGGAGGG - Intergenic
1151968775 17:77446312-77446334 AGGAGGAGGCTGTAGGAGGATGG - Intronic
1152000071 17:77639872-77639894 AGGAGGAGGAGGAAGGAGGAAGG - Intergenic
1152084062 17:78206652-78206674 AGAAAGAAGATGAAGGAGGAAGG - Intronic
1152089242 17:78237822-78237844 ATGGGGAGGCTGAGGGAGGGAGG - Intronic
1152148039 17:78581011-78581033 AGGCAGAAGCTGAAGAAGGATGG - Intergenic
1152200495 17:78943122-78943144 AAGAAGAGGCTGATGGTGCAGGG + Intergenic
1152328044 17:79653669-79653691 AAGAATAGGCAGAAGTAGGAAGG + Intergenic
1152598416 17:81249392-81249414 AAGAGGAGGATGAAGGAGGGAGG + Intronic
1153469754 18:5430669-5430691 CTCAGGAGGCTGAGGGAGGAGGG - Intronic
1153607624 18:6850440-6850462 AACAAGAGGCTTAAGGAGAAAGG + Intronic
1153812886 18:8767085-8767107 TGGCAGAGGCTGATGGAGGAGGG + Intronic
1153856100 18:9148894-9148916 AAAATGAGGCTGAAGCAGGAAGG - Intronic
1153885102 18:9457460-9457482 ATGAAGAGGTTGAGGGAAGTTGG - Intergenic
1154274994 18:12950927-12950949 CTCAAGAGGCTGAGGCAGGAGGG - Intronic
1155101613 18:22615988-22616010 ATGATTAAGCTGAATGAGGAAGG + Intergenic
1155172020 18:23274176-23274198 TTCAGGAGGCTGAAGCAGGAGGG - Intronic
1155396043 18:25387745-25387767 AGGAAGAGAGTGAAGGGGGAGGG + Intergenic
1155882829 18:31170949-31170971 ATGGAGAAGATGAAGGAGGATGG + Intergenic
1156247952 18:35321016-35321038 CTCAAGAGGCTAAAGTAGGAGGG + Intergenic
1156406854 18:36791098-36791120 AGGAAGAGAGTGAAGGGGGAGGG - Intronic
1156465735 18:37347010-37347032 ATGCCAAGGCTGAAGGGGGAGGG + Intronic
1156492551 18:37505007-37505029 CTGCAGTGGCTGGAGGAGGATGG - Intronic
1156876190 18:42015494-42015516 GTGAAGAGACTGAAGGAAGGGGG - Exonic
1157131539 18:45012249-45012271 ATCAAGAGGCAAAAGGATGAAGG + Intronic
1157139208 18:45088801-45088823 ATGAAGAGAGGGAAGGAGAAAGG - Intergenic
1157358372 18:46955657-46955679 CTCCAGAGGCTGAAGCAGGAGGG - Intronic
1157449225 18:47772895-47772917 GTGCAGAGGCTGAAGCAGGAAGG + Intergenic
1157514270 18:48299696-48299718 ATGAAGAGGCTGAAGGAGGATGG + Intronic
1157566304 18:48681159-48681181 AGGAAGAGGGTGTAGGAGGGAGG - Intronic
1157685556 18:49640069-49640091 ATGAGGAGGGTGAGGGAGGCTGG + Intergenic
1158114910 18:53984447-53984469 TTTAGGAGGCTGAGGGAGGAGGG + Intergenic
1158209056 18:55025798-55025820 GTGAAGAAGATGAAGGAGAAGGG - Intergenic
1158287026 18:55895116-55895138 GAGAAGACTCTGAAGGAGGAAGG + Intergenic
1158483369 18:57842773-57842795 ATGAAGATGCTCAGGGAAGAAGG - Intergenic
1158971753 18:62674631-62674653 ATGAAGGAGCTGAAGGAGATGGG - Intergenic
1159048614 18:63395324-63395346 ATGAAATGGCTGAAGAAGGGTGG + Intronic
1159173072 18:64797926-64797948 ATGAATAAGCTTAATGAGGAAGG + Intergenic
1159904060 18:74074871-74074893 AGGAAGAGGCGGGAGAAGGAAGG - Intronic
1160072872 18:75643583-75643605 GAGCAGAGACTGAAGGAGGAGGG - Intergenic
1160083400 18:75752761-75752783 GAGCAGAGGCTGGAGGAGGAGGG + Intergenic
1160275852 18:77434809-77434831 AGGAAGATGATGAAGGATGAAGG - Intergenic
1160448662 18:78947074-78947096 AGGAAGAGGAAGGAGGAGGAGGG + Intergenic
1160448696 18:78947193-78947215 AAGAAGAGGATGGAGGAGGGAGG + Intergenic
1160448714 18:78947263-78947285 AGGAAGAGGATGGAGGAGGGAGG + Intergenic
1160496591 18:79379645-79379667 AGGTAGAGACTGGAGGAGGAAGG + Intergenic
1160528953 18:79552548-79552570 GGGAAGAGGCTGGAGGAGAAAGG + Intergenic
1160555757 18:79723881-79723903 AGGAACTGGCTGAGGGAGGAGGG - Intronic
1160965802 19:1746376-1746398 AGGAGGAGGATGGAGGAGGAGGG + Intergenic
1161023970 19:2026529-2026551 ATAAAGAGAGTGAAGGAGGTTGG + Intronic
1161989036 19:7673500-7673522 ATGAGGAGGAGGAAGGAGGGAGG - Intergenic
1163053822 19:14704071-14704093 GTGAAGAGGCAGCAGGAGGGTGG - Intronic
1163061267 19:14763904-14763926 AGGAAGAGGAGGAAAGAGGATGG - Intronic
1163120077 19:15212146-15212168 AGGAAGGGGCTGAAGGAGCTGGG + Intergenic
1163211697 19:15845594-15845616 AAGAAGAGGGAGAAGGAAGAAGG + Intergenic
1164203124 19:23034880-23034902 ATTAAAAGGCTAAAGTAGGAGGG - Intergenic
1164441853 19:28284985-28285007 ATGAAGGAGAAGAAGGAGGATGG + Intergenic
1164451173 19:28366356-28366378 ATGTGGAGGCTGATGAAGGAGGG + Intergenic
1164535601 19:29084558-29084580 AAGAAGTAGCTGAAAGAGGAAGG + Intergenic
1164591928 19:29512133-29512155 ATGAAGAGGAAGAAGAGGGAGGG + Intergenic
1165047580 19:33117844-33117866 ACGCACAGGCTGAAGGAGAAGGG + Exonic
1165416031 19:35694085-35694107 AGGAGGAGGGAGAAGGAGGAGGG - Intergenic
1165451185 19:35884335-35884357 ATGAAGATGCAGTAAGAGGATGG - Intergenic
1165472803 19:36013305-36013327 GTGCAGAGGGTGAAGGAGGCAGG - Intronic
1165490403 19:36120089-36120111 GGGAAGAGGCTTAAGGAGCATGG - Intronic
1165603690 19:37080251-37080273 ATTAAGAGGATGGAGGAAGAGGG + Intronic
1165690890 19:37862389-37862411 AGGAGGAGGAGGAAGGAGGAGGG + Intergenic
1165695050 19:37894627-37894649 TTGAAGAGGCTGTAGAAGCAGGG + Exonic
1165728845 19:38131282-38131304 ATGAAGGGGCTGCAGCACGATGG + Intronic
1166060623 19:40323339-40323361 ATGAGGAGGCTGAAGTACAAAGG + Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166348431 19:42181447-42181469 ATGAACAGGCAGAATGAGGAGGG - Intronic
1166992969 19:46704340-46704362 AGGAAGAGGATGACGGGGGACGG + Exonic
1167145072 19:47676498-47676520 CAGAAGAGGGAGAAGGAGGAAGG - Intronic
1167258930 19:48446764-48446786 ATGAAGAGGATGAAGAAGAGCGG + Exonic
1167360688 19:49028786-49028808 AGGCAGTGGATGAAGGAGGATGG + Intronic
1167362966 19:49040020-49040042 AGGCAGTGGATGAAGGAGGATGG - Intergenic
1167396567 19:49233261-49233283 AGGGAGACGCTGAAGGAGAAGGG - Intergenic
1167459361 19:49616117-49616139 AAGAAATGGCTGAAGGAGGCAGG + Exonic
1167696081 19:51016240-51016262 AGGAAGAGTCTGAGGGAAGAGGG + Intronic
1168092790 19:54096637-54096659 AGAAAGAGGCAGAAGGAGAAAGG - Intronic
1168119403 19:54243148-54243170 ATGGACGGGCTGAAGGAGGGAGG - Intronic
1168125620 19:54280913-54280935 ATGGATGGGCTGAAGGAGGGAGG - Intronic
1168130224 19:54312969-54312991 ATGGACGGGCTGAAGGAGGGAGG - Intronic
1168159443 19:54499603-54499625 AAGAAGAGTCAGAAGCAGGAAGG + Intronic
1168168857 19:54573461-54573483 ATGGACGGGCTGAAGGAGGGAGG + Intronic
1168185182 19:54696017-54696039 ATGGATGGGCTGAAGGAGGGAGG + Intronic
1168290102 19:55353399-55353421 ATGGAGAGGGAGAAGGGGGACGG + Intronic
1202682845 1_KI270712v1_random:25116-25138 AAGAGGAGGGGGAAGGAGGAAGG - Intergenic
925439849 2:3876009-3876031 CTGAAGAGGCTGACCGAGGAAGG - Intergenic
925441034 2:3885466-3885488 ATGAAGAAGTGAAAGGAGGAAGG - Intergenic
925537988 2:4936848-4936870 ATGATGGGGCAGAAGGTGGAGGG + Intergenic
926366075 2:12134042-12134064 ATGGAGAGAGGGAAGGAGGATGG - Intergenic
926599455 2:14826072-14826094 TTCAAGAGGCTAAATGAGGAGGG + Intergenic
926838682 2:17053403-17053425 CTCAAGAGGCTGAGGCAGGAGGG - Intergenic
927458266 2:23276046-23276068 ATGGAGAGACTGAGGAAGGAAGG - Intergenic
927556381 2:24036397-24036419 CTCAGGAGGCTGAAGCAGGAGGG + Intronic
928031636 2:27784628-27784650 ATAAAGACACAGAAGGAGGAAGG + Intronic
928123685 2:28602004-28602026 ATGGTGAGGGTGAAGGTGGATGG + Intronic
928138675 2:28708677-28708699 CTAAAGAGGCTGAGGTAGGATGG + Intergenic
928269296 2:29841986-29842008 GTGAAGAGGAGGATGGAGGAAGG - Intronic
928979970 2:37127462-37127484 ATGAGGATGCTGAGGGAGGCAGG - Intronic
929055091 2:37869651-37869673 TTTAGGAGGCTGAAGCAGGAGGG + Intergenic
929670720 2:43875016-43875038 ATGATGAGGCTGTGGCAGGAGGG - Intronic
929679300 2:43973675-43973697 ATGAAGGCTGTGAAGGAGGAAGG - Exonic
929680890 2:43992598-43992620 ATGAAGGGGCTGGAGGAAAAGGG + Intronic
929893483 2:45938046-45938068 AAGAAGAGGCCGAAGGGGAAGGG - Intronic
929914765 2:46125510-46125532 AAGAAGAGGCTGGGGGAGGATGG + Intronic
930250937 2:49033499-49033521 ATGAAGAGGCCAACGCAGGAGGG + Intronic
930980423 2:57519118-57519140 ATTAGGAGGCTGAAGTGGGAGGG + Intergenic
931137687 2:59422467-59422489 AAGAAGAGAGGGAAGGAGGAAGG - Intergenic
931450626 2:62364961-62364983 AGGCTGAGGCTGAAGCAGGAGGG - Intergenic
931781129 2:65580134-65580156 ATGGAGGGGGAGAAGGAGGATGG - Intergenic
932132979 2:69204334-69204356 ATGGAGATGCTGAACGAAGATGG - Intronic
932279432 2:70477215-70477237 ATAAAAAGGAAGAAGGAGGAAGG + Intronic
932330094 2:70893921-70893943 AAGAAGAGGGAGATGGAGGAAGG + Intergenic
932381943 2:71292195-71292217 AGGAAGATGCTGAAGGAGTTTGG - Intronic
933141438 2:78795743-78795765 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
933523156 2:83400676-83400698 AAGAAGAGGATGAGGGAGTAGGG + Intergenic
933820608 2:86108016-86108038 CTCAGGAGGCTGAAGCAGGAGGG + Intronic
934248955 2:90330058-90330080 AAGAGGAGGGGGAAGGAGGAAGG + Intergenic
934260624 2:91473418-91473440 AAGAGGAGGGGGAAGGAGGAAGG - Intergenic
934876232 2:97923512-97923534 CTTGAGAGGCTGAGGGAGGAGGG + Intronic
935147837 2:100408321-100408343 ATGGAGTGGCGGAAGGAGGAGGG - Intronic
935444921 2:103146185-103146207 CTCAGGAGGCTGAAGTAGGAGGG - Intergenic
935531674 2:104240388-104240410 AGGAAGAGGGAGGAGGAGGAGGG + Intergenic
935686689 2:105689941-105689963 ATGAAGAGAATGAAGGTGTAAGG - Intergenic
935954420 2:108361641-108361663 AGGAATAGACTGAAGGAGTAGGG - Intergenic
936480826 2:112883529-112883551 AGGAAGAGGCTCTGGGAGGAAGG - Intergenic
936763330 2:115813356-115813378 ATGAAGAGGCGCAAAGAGGGCGG - Intronic
936984704 2:118297877-118297899 ACGAAGAGGTAGAAGGAAGAAGG - Intergenic
937217299 2:120321072-120321094 AGGAGGAGGGAGAAGGAGGAGGG - Intergenic
937217303 2:120321085-120321107 AGGAGGAGGGAGAAGGAGGAGGG - Intergenic
937217307 2:120321098-120321120 AGGAGGAGGGAGAAGGAGGAGGG - Intergenic
937217316 2:120321127-120321149 AGGAGGAGGGAGAAGGAGGAGGG - Intergenic
937332181 2:121038506-121038528 ATGAAGAAGCTGGACAAGGAAGG + Intergenic
937347868 2:121137982-121138004 ATGAAGAGACTGGAGGTGGGAGG + Intergenic
938239605 2:129733203-129733225 TTGGTGAGGCTGGAGGAGGAGGG - Intergenic
938945620 2:136209395-136209417 ATGAGGAAGCTGAAGGATTAGGG + Intergenic
939467551 2:142578404-142578426 ATGAAGAAGCCAAAGGAGGATGG - Intergenic
939953645 2:148505781-148505803 AGGAAAAGGCTGAAAAAGGAAGG + Intronic
939956189 2:148529453-148529475 AAGGAGAGGCTGAAGGTGCACGG - Intergenic
940502711 2:154514318-154514340 ATAAAGAGTTTAAAGGAGGAGGG + Intergenic
940545974 2:155085858-155085880 ATGCAGACTCAGAAGGAGGAGGG + Intergenic
940817583 2:158312814-158312836 GTGAAGAGGATGAAAGAGGATGG + Intronic
941431652 2:165421400-165421422 ATGAAGAAGCTGAAGCTGCAAGG - Intergenic
941908759 2:170742325-170742347 AAGAAGAGACTGAAGGGGGTGGG + Intergenic
942305382 2:174601954-174601976 AAGAAGAGGCAGAAGAAAGAGGG + Intronic
942413020 2:175731391-175731413 GTGAAGAGGCAGAAAGAGGGTGG + Intergenic
942535921 2:176963926-176963948 ATGAAGTGACTGAGGAAGGAAGG + Intergenic
944368511 2:198953859-198953881 ATGGAGAGGGTAAAGGAAGATGG - Intergenic
944819326 2:203414003-203414025 CTGAAGAGGATGAGGCAGGAAGG - Intronic
945431462 2:209770975-209770997 AGGAAGAAGGAGAAGGAGGAGGG + Intergenic
945690911 2:213034396-213034418 ATGATGAGGCTTAGTGAGGAAGG - Intronic
945772208 2:214058198-214058220 ATGATTAAGCTGGAGGAGGAAGG - Intronic
946098152 2:217293248-217293270 ATGAGGAGACTGAAGCAGAAAGG - Intronic
946202086 2:218076384-218076406 AGAAGGAGGCTGAAGGAGAAGGG - Intronic
946210469 2:218143535-218143557 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
946859013 2:223982306-223982328 ATGGAGACTCAGAAGGAGGAGGG + Intronic
947085906 2:226452600-226452622 AGAAAGAAACTGAAGGAGGAGGG + Intergenic
947343044 2:229159996-229160018 AGGAACAGGATGAAGGAAGAGGG + Intronic
947461997 2:230311503-230311525 AAGAAAAGGCTGAATGAGCACGG + Exonic
947471081 2:230401715-230401737 AAGAAAAGGCTGAATGAGCACGG + Exonic
947507193 2:230716892-230716914 CTCAAGAGGCTGAGGCAGGAGGG + Intronic
947561455 2:231157394-231157416 AAACAGAGGCTGAAAGAGGAAGG - Intronic
947760947 2:232603418-232603440 AGGAGGAGGTGGAAGGAGGAAGG + Intergenic
947817458 2:233047798-233047820 AGGAGGAGGCGGGAGGAGGATGG + Intergenic
948216143 2:236234312-236234334 CTGAAGGGGCTGAAGCAGGAAGG - Intronic
948526819 2:238575936-238575958 GCGCAGTGGCTGAAGGAGGAGGG - Intergenic
948656308 2:239478697-239478719 TTCAAGAGGCTGAGGCAGGAGGG + Intergenic
948670180 2:239563595-239563617 AGCAGGAGGCTGGAGGAGGAGGG + Intergenic
1169348578 20:4850010-4850032 ATGAAGATGCAGTAGGAGAAGGG + Intergenic
1170034311 20:11973852-11973874 AAGAGGAGGAAGAAGGAGGAAGG + Intergenic
1170362628 20:15563314-15563336 AAAAAGAGGCTTTAGGAGGAGGG - Intronic
1170779611 20:19412542-19412564 AGGAAGACGGAGAAGGAGGAGGG + Intronic
1171189378 20:23148172-23148194 ATGAAGAGGCCTGAGCAGGAAGG + Intergenic
1171198688 20:23223923-23223945 AAGACGAGGCTGAGGTAGGAAGG + Intergenic
1171209047 20:23302904-23302926 ATGGAGAGGTTGAAGGAGAAGGG + Intergenic
1171209150 20:23303613-23303635 AAGGAGAGGGTGAAGGATGAGGG - Intergenic
1171790541 20:29519102-29519124 TTGAAGATGCTGAAGAAGCAAGG - Intergenic
1171857168 20:30357733-30357755 TTGAAGATGCTGAAGAAGCAAGG + Intergenic
1172084605 20:32371027-32371049 CTCAGGAGGCTGAAGCAGGAGGG + Intronic
1172123385 20:32611359-32611381 ATGGCGAGGCTGGAGGAGGTGGG - Intergenic
1172228772 20:33323158-33323180 AAGAAGGGGCAGGAGGAGGAAGG + Intergenic
1172266280 20:33617409-33617431 ATAAACTAGCTGAAGGAGGAAGG + Intronic
1172511118 20:35501757-35501779 ATATAGAGGCAGATGGAGGATGG - Intronic
1172642375 20:36448240-36448262 CTCAGGAGGCTGAAGCAGGAGGG + Intronic
1172733566 20:37109074-37109096 CTCAAGAGGCTGAGGGAGGTAGG + Intronic
1173248321 20:41351143-41351165 CTGAGGAGGCTGAGGCAGGAGGG + Intronic
1173418045 20:42876049-42876071 AGGGAGAGAGTGAAGGAGGATGG - Intronic
1173707420 20:45122651-45122673 ATGAAGAAGAAGAAGGAGGGAGG - Intergenic
1173817477 20:45998987-45999009 GTCAGGAGGCAGAAGGAGGAAGG + Intergenic
1173823866 20:46035160-46035182 ATGGGGAGGCTCAAGGAAGAAGG - Intronic
1174012178 20:47458787-47458809 CTCAGGAGGCTGAAGCAGGATGG + Intergenic
1174171110 20:48618749-48618771 CTGAAGGAGCTGAAGGGGGAAGG - Intergenic
1174710299 20:52697437-52697459 CTCAAGAGGCTGAGGCAGGAGGG - Intergenic
1175185481 20:57177202-57177224 AAGAAGAGGGTTGAGGAGGAAGG + Intronic
1175363290 20:58432031-58432053 ATGAAGAAGCTGAGGGATGATGG + Intronic
1175547041 20:59785054-59785076 ATGAGGAGGCTCAGGCAGGAGGG + Intronic
1176093892 20:63330820-63330842 AGGAAGAGCCTGCAGGTGGAAGG + Exonic
1176349381 21:5779780-5779802 TTGCAGAGGATGATGGAGGAAGG - Intergenic
1176356195 21:5900364-5900386 TTGCAGAGGATGATGGAGGAAGG - Intergenic
1176361147 21:5997689-5997711 ATGAAGAGGCAGCAAGAGGGTGG + Intergenic
1176543702 21:8177850-8177872 TTGCAGAGGATGATGGAGGAAGG - Intergenic
1176562653 21:8360895-8360917 TTGCAGAGGATGATGGAGGAAGG - Intergenic
1177855560 21:26396865-26396887 ATGAAGATGCTGAAGAATGGAGG - Intergenic
1177963362 21:27696877-27696899 ATGAAGAAGATGAAGGAGTTAGG + Intergenic
1178011570 21:28292324-28292346 CTGAAGAGACTGAAGCAGCAGGG - Intergenic
1179422656 21:41248944-41248966 AAGAAGAGGCTCCACGAGGAGGG - Intronic
1179563445 21:42231750-42231772 ATGCTCAGGCTGAAGGGGGATGG + Intronic
1179762371 21:43540861-43540883 ATGAAGAGGCAGCAAGAGGGTGG - Intronic
1179812990 21:43884270-43884292 AGGAGGAGGGGGAAGGAGGAGGG - Intronic
1180149256 21:45939362-45939384 TTGAAGCAGCTGAGGGAGGAGGG - Intronic
1181276104 22:21688373-21688395 TTGGAGAGGCTGCAGGAGGGAGG - Intronic
1181422333 22:22810645-22810667 AAGGAGAGGCAGAGGGAGGAGGG - Intronic
1181654491 22:24284987-24285009 TTGAAGAGGAAGATGGAGGAAGG + Intronic
1181766303 22:25094591-25094613 CTGGAGAGGCTGCTGGAGGAAGG - Intronic
1181885311 22:26017379-26017401 AGGGAGAGGAGGAAGGAGGAGGG - Intronic
1181917374 22:26292067-26292089 AGGAAGAAAATGAAGGAGGAAGG + Intronic
1181931337 22:26403943-26403965 AGGAGGAGGAGGAAGGAGGAAGG + Intergenic
1182139276 22:27938831-27938853 CTGAAGAGGTTGAGGCAGGAGGG + Intergenic
1182329836 22:29543380-29543402 ATGGGGAGGAGGAAGGAGGAAGG + Intronic
1182681793 22:32085227-32085249 CTCAGGAGGCTGAAGCAGGAAGG - Intronic
1182890863 22:33817887-33817909 ATGGAGAAGCTGAAGGAGGGAGG + Intronic
1182931386 22:34177480-34177502 AGGGAGAGGTGGAAGGAGGAGGG - Intergenic
1183021713 22:35032804-35032826 ATGAAGAGGACAGAGGAGGAGGG + Intergenic
1183612534 22:38919871-38919893 ATGATTAGGCTTAATGAGGAAGG - Intergenic
1183681468 22:39332737-39332759 ATGATTAGGCTTAATGAGGAAGG - Intergenic
1183713248 22:39519298-39519320 TGGAAGGGGCTGAAGGATGATGG + Intergenic
1183766436 22:39880309-39880331 TTGCAGGGGCTGAAGGAGGGAGG + Intronic
1183973333 22:41495132-41495154 CTCAAGAGGCTGAGGCAGGAGGG - Intronic
1184041713 22:41947875-41947897 CTCAGGAGGCTGAAGCAGGAGGG - Intergenic
1184067427 22:42128630-42128652 AAGAAGGGCCTGGAGGAGGAGGG - Intronic
1184070157 22:42142325-42142347 AAGAAGGGCCTGGAGGAGGAGGG - Intergenic
1184372980 22:44094447-44094469 AGGCAGAGGCAGAAGGAGCAGGG + Intronic
1184376584 22:44117328-44117350 CTGTAGAGGGTGAAGGAGGAGGG + Intronic
1184390319 22:44199981-44200003 ATGAAGAGAGTGATGGAGGTGGG + Intronic
1184530440 22:45051945-45051967 CTGAGGAGGTTGAAGGAGGCTGG - Intergenic
1184585841 22:45447616-45447638 ATGGAGAAGCTGGAGGAGAAGGG - Intergenic
1203248570 22_KI270733v1_random:94072-94094 TTGCAGAGGATGATGGAGGAAGG - Intergenic
949142539 3:652316-652338 AGGATGAGGCAGTAGGAGGAAGG - Intergenic
949242711 3:1890933-1890955 AAGAAGATGGAGAAGGAGGAGGG - Intergenic
949817598 3:8076340-8076362 ATCAAGAGCCAAAAGGAGGAAGG - Intergenic
949988917 3:9561088-9561110 ATGAAGAGTCAGAAGGGCGAGGG - Intergenic
950028569 3:9836978-9837000 ATAAGGAGGCTGAAGCGGGAGGG + Intronic
950130052 3:10536459-10536481 AGGAGGAGGAGGAAGGAGGAAGG - Intronic
950429753 3:12944000-12944022 AGGAAGAGCCTGAATGAAGAGGG + Intronic
950662551 3:14475574-14475596 CTGAAGAGGCTGGTGGAGAAGGG + Intronic
950673747 3:14542040-14542062 CTGAAGAGGCTGTAGATGGAGGG - Exonic
950715699 3:14846268-14846290 AGGATGGGGCTGAGGGAGGAGGG + Intronic
951152551 3:19308827-19308849 AGAAAGAGGGAGAAGGAGGAGGG - Intronic
951171016 3:19541661-19541683 ATGATGAGTCTCCAGGAGGAAGG - Intergenic
951565866 3:24012070-24012092 CTGGAGAGGCTGAAGGCGGGAGG - Intergenic
951996732 3:28738055-28738077 AGGAAGAGGATGAGGGAGGAAGG + Intergenic
952311356 3:32193315-32193337 CTCAGGAGGCTGAAGTAGGAGGG - Intergenic
953062354 3:39437860-39437882 ATGAAGACCCTGCAGGAGCATGG - Intergenic
953811920 3:46120093-46120115 GAGAGAAGGCTGAAGGAGGAAGG + Intergenic
953862925 3:46560798-46560820 ATGATGAGACAGAAGGAGAACGG + Intronic
954000151 3:47550124-47550146 ATGAAGAAGAAGAAGGAGAAGGG - Intergenic
954211491 3:49100024-49100046 ATGAAGCTGGTGATGGAGGATGG - Exonic
954318906 3:49817563-49817585 CTGAGGAGGCTGAGGTAGGAGGG + Intergenic
954362624 3:50130286-50130308 TTCAAGAGGCTGAAGAAGGCCGG - Intergenic
954462179 3:50633636-50633658 ATGGCAAGGCTGGAGGAGGAAGG - Intronic
954485269 3:50844321-50844343 CTCAGGAGGCTGAGGGAGGACGG - Intronic
954619242 3:51986268-51986290 GTGAGGAGGCTGAAGGTGGAGGG + Exonic
954857870 3:53662293-53662315 ATTAAGAGACTGAGGGAGAATGG + Intronic
955114252 3:55981588-55981610 AGGAAGAAGAGGAAGGAGGAGGG + Intronic
955151919 3:56375909-56375931 ATGGAGAGGCTGAAGTGGCAAGG + Intronic
955499567 3:59570512-59570534 ATGAGGAGCGTGAGGGAGGAGGG - Intergenic
955539543 3:59959941-59959963 ATGTAGAGGTTCATGGAGGAAGG + Intronic
955602700 3:60664433-60664455 AGGAAGAGGAAGAAGGGGGAGGG - Intronic
955730488 3:61980486-61980508 AGAAAGAGGGAGAAGGAGGAGGG + Intronic
956098195 3:65739556-65739578 ATGATTAAGCTGAATGAGGAAGG - Intronic
956689282 3:71861105-71861127 ATGGGGAGCCTGAAGGGGGATGG - Intergenic
956788324 3:72661092-72661114 AGGATGGGGCAGAAGGAGGAGGG + Intergenic
956855482 3:73270762-73270784 TTGAAGAGGCAGAAGGAAGCAGG - Intergenic
957060839 3:75480148-75480170 CTCAGGAGGCTGAAGCAGGAGGG - Intergenic
957350045 3:79012887-79012909 AGGAAGGGGCTGAAAGTGGAGGG + Intronic
957526366 3:81383601-81383623 ATGCAGTTACTGAAGGAGGAGGG + Intergenic
958434029 3:94075931-94075953 ATGAAGACCCTGAAGGAATATGG - Intronic
958446155 3:94217544-94217566 ATGAAGAGGAGGAAGGAGAGTGG + Intergenic
958461124 3:94397254-94397276 ATGAAGACCCAGAAGGATGAGGG + Intergenic
958661631 3:97076137-97076159 ATGATTAGGCTTAATGAGGAAGG + Intronic
959317798 3:104831080-104831102 ATGAACAAGATGAAGAAGGAAGG + Intergenic
959989647 3:112616761-112616783 ATGGAGAAGCAGAAGAAGGAGGG - Exonic
960004971 3:112772504-112772526 AGGAAGAGGATGGAGGTGGATGG - Intronic
960574038 3:119211986-119212008 ATGAAGAGGTAGCAGGAGGGTGG - Exonic
960741627 3:120840299-120840321 AAGACATGGCTGAAGGAGGAAGG + Intergenic
961225822 3:125244891-125244913 TTGGAGAGGTTGAAGGAGTATGG - Intronic
961266772 3:125649318-125649340 CTTAGGAGGCTGAAGAAGGAGGG + Intergenic
961292544 3:125859257-125859279 CTCAGGAGGCTGAAGCAGGAGGG + Intergenic
961720962 3:128895731-128895753 ATGCTCAGGCTGAAGGACGAAGG - Intronic
961894639 3:130157120-130157142 CTCAGGAGGCTGAAGCAGGAGGG - Intergenic
962389928 3:134962792-134962814 ATGAAGAGGGGGCAGGAGGAGGG - Intronic
962390164 3:134965108-134965130 ATAATGAGACTGAAGAAGGAAGG - Intronic
963121465 3:141780431-141780453 AAGAAGCGGCTGAAGAAGAAAGG + Exonic
963602534 3:147390740-147390762 ATGAAGAGGGCGAGGGCGGAAGG - Intronic
963813821 3:149807930-149807952 ATTAAGAGGCTGTAAGAGGCCGG - Intronic
963833235 3:150031207-150031229 ATTAAGAGGGTGAGGGAAGATGG - Intronic
964138995 3:153376741-153376763 AAGAAAAGGCTGAAGTGGGAGGG - Intergenic
965017874 3:163182830-163182852 ATGAAGATGATGAAGGAAGAAGG - Intergenic
965099398 3:164277427-164277449 ATACAGAGACAGAAGGAGGAGGG + Intergenic
965550775 3:169962850-169962872 ATGAAGAAGAAGAAGGAGCAAGG - Intergenic
966002003 3:174960927-174960949 CTTAAGAGGCTGAAGCAGGAGGG + Intronic
966411135 3:179647079-179647101 CTGAGGAGGCTGAGGTAGGAAGG + Intergenic
966460660 3:180172767-180172789 ATAAAGAGTCTGAAGGAAGTGGG - Intergenic
966653180 3:182323876-182323898 ATGAAGAGGATGAGGGAGAATGG - Intergenic
966850084 3:184159258-184159280 AAGAAGAGTCTGCAGGTGGAAGG - Intronic
967217074 3:187219950-187219972 ATGGATAGGCCGAAGGAGGGGGG + Intronic
967221578 3:187252123-187252145 AGGTAGTGGCTGAGGGAGGAGGG - Intronic
967920448 3:194610267-194610289 ATGAAAGGGCTGGAGGAGGCAGG - Intronic
968136056 3:196220288-196220310 AGGAAGAGGCTTAAGAAGCAGGG + Intronic
968481144 4:833569-833591 AGGAAGAGGGGGAAGGTGGAAGG + Intergenic
968727302 4:2253724-2253746 AGGAGGAGCCTGAAGAAGGAGGG + Intronic
969099610 4:4759008-4759030 GTGAAGAAGCTGGAGGAGGTTGG + Intergenic
969125790 4:4946844-4946866 ATGGAGATTCTGAAGCAGGATGG + Intergenic
969241706 4:5902998-5903020 ATGCAGAGGCCCAGGGAGGAAGG - Intronic
969253105 4:5982866-5982888 ATGAAGAAGGTGAAGAATGAGGG + Intronic
969255075 4:5995959-5995981 AAGAAGAACCTGAAGGAGGTAGG - Intergenic
969748134 4:9089944-9089966 CTCAAGAGGCTGAAGCAGGAGGG + Intergenic
969809156 4:9634487-9634509 CTCAGGAGGCTGAAGCAGGAGGG + Intergenic
970118819 4:12730021-12730043 ACAATGAGGCTGAAGGAGCAAGG - Intergenic
970163250 4:13210255-13210277 AAGATGAGGGTGAAGAAGGAGGG - Intergenic
970216867 4:13767832-13767854 ATGAAGATGCTGAGAGAGTAAGG - Intergenic
970273164 4:14368493-14368515 ATGGAGAGCCAGAAGGGGGATGG + Intergenic
971201671 4:24514931-24514953 ATGAAAAGTGTGAAGCAGGAGGG + Intergenic
971240282 4:24882179-24882201 ATGCAAAGCCTGAAGGAAGATGG + Intronic
971260705 4:25054342-25054364 CTCAGGAGGCTGAAGCAGGAGGG - Intergenic
971267102 4:25105499-25105521 AGGGGGAGGCTGAAGGAGGCAGG - Intergenic
971305114 4:25473289-25473311 ATGAAGAAGGAGAAGGAGAAGGG + Intergenic
971609719 4:28707632-28707654 ATGATTAGGCTTAATGAGGAAGG + Intergenic
972129333 4:35810314-35810336 AGGAAGAGGGGAAAGGAGGAGGG + Intergenic
972267483 4:37476416-37476438 ATGAAGATGCTGAAGGGATATGG - Intronic
972506598 4:39725748-39725770 CTCAGGAGGCTGAAGCAGGAGGG - Intronic
972539136 4:40023944-40023966 GTGAAGAAGATGAAGTAGGAAGG + Intergenic
972591560 4:40492935-40492957 ATAATGAGGGTGATGGAGGAGGG - Intronic
972657509 4:41078995-41079017 ATAAAGAGGCAGGAGCAGGAGGG + Intronic
974899979 4:67984836-67984858 ATAAAGAGGCTGAGGGAAGTGGG + Intergenic
975448023 4:74490459-74490481 AAGATGAGGCTGAAGGTGGCTGG - Intergenic
975460767 4:74650976-74650998 CTCAGGAGGCTGAGGGAGGATGG + Intergenic
975504451 4:75122856-75122878 AAGAGGAGGAGGAAGGAGGAAGG + Intergenic
976172776 4:82321444-82321466 CTCAAGAGGCTGAGGCAGGAGGG + Intergenic
976231209 4:82845212-82845234 AGGGAGAGGCTGCAGGTGGATGG + Intronic
976639591 4:87323949-87323971 CTCAAGTGGCAGAAGGAGGAAGG + Intergenic
976858079 4:89628474-89628496 ATGAAGAGGGAGAGGTAGGAAGG - Intergenic
976933787 4:90603185-90603207 ATGCAGTGGCTGGAGGAGTAGGG + Intronic
977022921 4:91777805-91777827 ATGAAGAGGCAGGAGCTGGAGGG + Intergenic
977676058 4:99748464-99748486 ATGAAGACACTGAAGCTGGAAGG - Intergenic
977991471 4:103447535-103447557 CTGGAGAGGCTGGAGGAGGCAGG + Intergenic
978247288 4:106589247-106589269 ATGAACAGACAGAAAGAGGATGG - Intergenic
978558473 4:110006235-110006257 CTCAAGAGACTGAAGCAGGAGGG + Intronic
979559816 4:122089245-122089267 AAGAAGAGAATGAAGGGGGAGGG - Intergenic
980511215 4:133790136-133790158 ATGAAGATGGTGAAGGTGGGTGG + Intergenic
981041637 4:140228244-140228266 ATGAAGAAGGAGGAGGAGGAGGG - Intergenic
981732160 4:147910995-147911017 AGGAAGAGGAGGAGGGAGGAAGG - Intronic
981971999 4:150674765-150674787 CTTGGGAGGCTGAAGGAGGAGGG + Intronic
982172822 4:152678427-152678449 TAGAAGAGGTGGAAGGAGGATGG + Intronic
982660852 4:158205036-158205058 TTTGGGAGGCTGAAGGAGGAAGG + Intronic
983192757 4:164772221-164772243 AGGAAGAGGGAGAAGGGGGAGGG + Intergenic
983915964 4:173290978-173291000 ATCAAGGGGCTGAAGGAGGGAGG - Intronic
983966880 4:173823420-173823442 ATGCAGAGGCTCTGGGAGGACGG + Intergenic
984124364 4:175788087-175788109 AAAAAGAGGCTGGAGGAGCAGGG - Intronic
984716757 4:182933273-182933295 AGGAAGAGGCTGAAGCTAGAGGG - Intergenic
984792469 4:183627274-183627296 CTCAGGAGGCTGAAGCAGGAGGG - Intergenic
984797048 4:183671399-183671421 CTGAAAAGGCTGGAGGAGAAAGG + Intronic
984899122 4:184569044-184569066 ATGATTAGGCTTAATGAGGAAGG - Intergenic
984982325 4:185294446-185294468 ATGAAGATACTGAAGGAGTCAGG + Intronic
985311072 4:188600007-188600029 GTGAAGAAGCTGAAGAAGAAAGG - Intergenic
985913510 5:2900766-2900788 CTGGAGAGGATGAAGGTGGAGGG - Intergenic
985957449 5:3276108-3276130 AGGGAGAGGATGAAGGAGGGAGG + Intergenic
985957464 5:3276156-3276178 AGGGAGAGGATGAAGGAGGGAGG + Intergenic
985957482 5:3276203-3276225 AGGGAGAGGATGAAGGAGGGAGG + Intergenic
985957493 5:3276235-3276257 AGGGAGAGGATGAAGGAGGGAGG + Intergenic
985957504 5:3276267-3276289 AGGGAGAGGATGAAGGAGGGAGG + Intergenic
985957515 5:3276299-3276321 AGGGAGAGGATGAAGGAGGGAGG + Intergenic
985957546 5:3276379-3276401 AGGGAGAGGATGAAGGAGGGAGG + Intergenic
985957557 5:3276411-3276433 AGGGAGAGGATGAAGGAGGGAGG + Intergenic
986249925 5:6046151-6046173 ATGCAGAGCCTGGAGCAGGAAGG - Intergenic
986257943 5:6116626-6116648 GTGAAGATACTGAAGGATGATGG + Intergenic
986266633 5:6196703-6196725 ATGTAGAGGCAGCAAGAGGATGG + Intergenic
987163826 5:15173313-15173335 AGGAAGAGAATGAGGGAGGAAGG + Intergenic
987444636 5:18002460-18002482 CTGGATAGCCTGAAGGAGGAAGG + Intergenic
988205339 5:28126516-28126538 ATGGAGAGCCAGAAGGGGGATGG - Intergenic
988394261 5:30677614-30677636 CTGAGGAGGCTGAAGGGGGGAGG - Intergenic
988692900 5:33590527-33590549 CTCATAAGGCTGAAGGAGGAAGG - Intronic
989264532 5:39457832-39457854 ATGAAGAGGCAGCAGGTTGATGG - Intronic
990352599 5:54933819-54933841 ATGAGGAGGGAGAAGGAGAAGGG - Intergenic
990361940 5:55029649-55029671 TTTGAGAGGCTGAAGCAGGAGGG - Intronic
990466314 5:56074866-56074888 CTTAGGAGGCTGAGGGAGGAGGG + Intergenic
990629848 5:57656306-57656328 ATGAGGAAGCTGAAGAAGAAAGG + Intergenic
990803087 5:59627812-59627834 AGGCAGAGGCTGAACAAGGATGG + Intronic
991000840 5:61781282-61781304 ATGAAGAGGGAGCAAGAGGATGG + Intergenic
991055531 5:62315633-62315655 ATGAAGAAGATAAGGGAGGAGGG + Intronic
991527919 5:67583343-67583365 CTGGGGAGGCTGAAGCAGGAAGG - Intergenic
992058714 5:73020283-73020305 ATGAAAAGGATGAAGAAGCATGG + Intronic
992390684 5:76328053-76328075 ATGAACAGTCTCAAGGAGGCAGG - Exonic
992705462 5:79386999-79387021 AGGAAGAGGGGGAAGGGGGAGGG - Intronic
992837537 5:80655055-80655077 ATGATAGGGCTGGAGGAGGAAGG + Intronic
992904619 5:81334108-81334130 ATGGGGAGCCAGAAGGAGGATGG - Intronic
993318678 5:86444474-86444496 ATGAAGAGACTGAAGTTAGATGG - Intergenic
994116122 5:96062901-96062923 ATGAAGAGGGTCAAGAATGAGGG + Intergenic
994595050 5:101821531-101821553 CTCAAGAGGCTGAGGCAGGAGGG - Intergenic
995496397 5:112748887-112748909 CTCTAGAGGCTGAAGCAGGAGGG + Intronic
995907442 5:117142504-117142526 AGGAAGAGGAAGAAGAAGGAGGG - Intergenic
996088370 5:119326712-119326734 AGGATGAGCCTGAAGGAGGTTGG + Intronic
997024668 5:130044682-130044704 ATAAAGAAGATGAAGGAGGCGGG + Intronic
997430300 5:133833701-133833723 AGGAAGAGGCAGAAGCAGAAAGG + Intergenic
997476755 5:134146903-134146925 ATGAAGTGTCTGAATGGGGAGGG - Exonic
997584177 5:135034782-135034804 GAGAAGAGGCTGGAGAAGGAGGG - Intronic
997655079 5:135548585-135548607 ATAATGGGGCAGAAGGAGGATGG - Intergenic
997745758 5:136298778-136298800 TTGAAGGGGCAGAAGCAGGATGG - Intronic
997844185 5:137271082-137271104 ATGTCCAGGATGAAGGAGGAGGG + Intronic
998141379 5:139701453-139701475 AGGAAGGGGCGGAAGGGGGAGGG - Intergenic
998512606 5:142725771-142725793 ATGTAGAGTGTGAAGAAGGAGGG + Intergenic
998667807 5:144318114-144318136 TTGAGGAGACTGAAGGAGAAGGG + Intronic
998927288 5:147140676-147140698 TTGAACAGGCTGAAGGTGGCTGG + Intergenic
999115265 5:149157433-149157455 ATAAAGAATCAGAAGGAGGAAGG - Intronic
999353209 5:150897610-150897632 CTGATGAGGCTGAAGGAGGAGGG - Intronic
1000163687 5:158626444-158626466 ATGAAGTGCCTGAGGCAGGAGGG + Intergenic
1000894179 5:166835200-166835222 ATATAGAGGGTGAGGGAGGAGGG + Intergenic
1001542873 5:172551408-172551430 AAGAAGGGGCTGAAGAATGAGGG - Intergenic
1001775217 5:174323858-174323880 AGGAAGGGTGTGAAGGAGGAAGG - Intergenic
1001810092 5:174620976-174620998 ATGAAGAGGCAGAGATAGGAAGG - Intergenic
1002556362 5:180044925-180044947 CTTAAGAGACTGAAGGAGGGAGG + Intronic
1002622751 5:180500540-180500562 CTCAGGAGGCTGAAGGAGAATGG - Intronic
1002882564 6:1265854-1265876 ATGAAGGGGAAGAAGGAGCAAGG + Intergenic
1002969131 6:1996122-1996144 AGGAAGAAGAGGAAGGAGGAAGG - Intronic
1003169502 6:3709946-3709968 AGGAAGACCGTGAAGGAGGATGG + Intergenic
1003497347 6:6675901-6675923 CTGGAAAGGCTGAGGGAGGAGGG + Intergenic
1003509929 6:6771287-6771309 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509940 6:6771330-6771352 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509951 6:6771373-6771395 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003539789 6:7008433-7008455 ATGAAGAGACTTAACTAGGATGG + Intergenic
1003744895 6:8989725-8989747 AAGAAGAGAGTGAAGGAGGAGGG + Intergenic
1003959320 6:11194446-11194468 ATGAAGAGGCATACTGAGGAAGG - Intronic
1004002053 6:11604828-11604850 AGGAGGAGGGGGAAGGAGGAGGG + Intergenic
1004179103 6:13365503-13365525 ATGAAGCAGCTGATCGAGGAGGG - Exonic
1004431701 6:15550872-15550894 AGGAAGATGCTGCATGAGGAAGG + Intronic
1004511555 6:16287981-16288003 AGTAATAGGATGAAGGAGGAGGG - Intronic
1005741953 6:28800483-28800505 ATCAAAAGGATGAAGGAGGCTGG + Intergenic
1005844270 6:29765490-29765512 ATGGAGTGTCTGAGGGAGGAGGG - Intergenic
1005856375 6:29866282-29866304 ATGGAGTGTCTGAGGGAGGAGGG - Intergenic
1006079944 6:31559263-31559285 ATGAGGAGGCTGGGGGAGGATGG + Intergenic
1006387484 6:33739410-33739432 GGGAAGGGGCAGAAGGAGGAGGG + Intronic
1006430696 6:33993831-33993853 AGGAAGGTGCTGCAGGAGGAAGG - Intergenic
1006811260 6:36821927-36821949 ATGAACAGACTGAAGATGGAGGG - Intronic
1006870639 6:37247937-37247959 ATGAAGAGGATGAGGGATGTGGG + Intronic
1007063981 6:38970481-38970503 AATGAGAGCCTGAAGGAGGATGG - Intronic
1007289175 6:40772164-40772186 AGGAAGGGGGTGAAGGAGTAGGG + Intergenic
1007326176 6:41061692-41061714 CTGAAGAAGCTGAAGGAGGCTGG + Exonic
1007511203 6:42375629-42375651 ACGAAGAACATGAAGGAGGAAGG + Intronic
1007615808 6:43179371-43179393 AAGGGGAGGCTGAGGGAGGACGG - Exonic
1007783246 6:44265800-44265822 ATGAATGGAGTGAAGGAGGAAGG - Intergenic
1007958870 6:45940986-45941008 ATGAAGGGCCTGATGTAGGATGG + Intronic
1007972381 6:46066112-46066134 ATGAGGTGTCTGAAGGAGTATGG + Intronic
1009344833 6:62600562-62600584 ATGAAGAAGTTGGAGGAGGAAGG - Intergenic
1009815987 6:68736118-68736140 CAGGAGAGGCTGAAGCAGGAGGG - Intronic
1010028374 6:71245743-71245765 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
1010232216 6:73545106-73545128 AGGAGGAGGAGGAAGGAGGAAGG - Intergenic
1011159662 6:84374757-84374779 TTGAAGAAGCTGAAGGAGATGGG - Intergenic
1011245498 6:85317363-85317385 AGGAAGAGGCTGAAAGAGTTTGG + Intergenic
1012055068 6:94395752-94395774 AAGGAGAGGAGGAAGGAGGAGGG + Intergenic
1012965056 6:105665122-105665144 ATGAATAAGCTTAATGAGGAAGG - Intergenic
1013643331 6:112110017-112110039 ATGTAGAGGCTTAAGGGTGAAGG - Intronic
1014229422 6:118886709-118886731 TTCAAGAGGCTGAAGTGGGAGGG + Intronic
1014515630 6:122375037-122375059 AAGCAGAGGTTGAAGGAGGGAGG - Intergenic
1014886296 6:126785407-126785429 ATGAAGAGTAGGAAGGAAGAAGG - Intergenic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015411070 6:132894449-132894471 ATGAAGAGGCTGAGGGGGTGGGG + Intergenic
1016209431 6:141510394-141510416 CTGGAGAAGCTGAAGCAGGAGGG - Intergenic
1016402365 6:143694206-143694228 AGGAAGAAGTAGAAGGAGGAAGG + Intronic
1016699484 6:147038157-147038179 AGAAAGAGTCTGAAGGAAGATGG + Intergenic
1016807021 6:148221943-148221965 AGGAAGAGGCTGAAGAAAGGAGG - Intergenic
1016987062 6:149903595-149903617 AGGAAGAGGCAGACGGAAGAGGG + Intergenic
1017147364 6:151246867-151246889 CTCAGGAGGCTGAAGTAGGAGGG - Intronic
1017229154 6:152053401-152053423 AGGGAGAGACAGAAGGAGGAAGG - Intronic
1017546577 6:155457846-155457868 ATGAGGAGGCAGAAGGATCAAGG - Intergenic
1017572900 6:155766529-155766551 AGGGAGAGACCGAAGGAGGAAGG - Intergenic
1018038045 6:159898542-159898564 AGGAAGAGGCAGGAGGAGGGAGG - Intergenic
1018038064 6:159898613-159898635 AAGAAGAGGGAGGAGGAGGAAGG - Intergenic
1018066911 6:160131032-160131054 ATGAGGAGGCTGATAGGGGAGGG + Intronic
1018385619 6:163300344-163300366 CTGAAGAGTCTGGAAGAGGACGG + Intronic
1018650192 6:165986577-165986599 AGGAAAAGGAGGAAGGAGGAAGG - Intronic
1018683011 6:166280467-166280489 ATGAAGGGGCTGACGGTGAAGGG - Intergenic
1018803973 6:167244429-167244451 ATGAGGCTGCTGACGGAGGAGGG + Intergenic
1019065240 6:169290953-169290975 GGGAAGAGGCTCAAGGGGGAGGG - Intergenic
1019229209 6:170544007-170544029 ATGAAGTGGCCTAAGGAAGATGG + Intronic
1019320699 7:414186-414208 AGGGAGAGGATCAAGGAGGAGGG - Intergenic
1019320733 7:414264-414286 AGGGAGAGGATCAAGGAGGAGGG - Intergenic
1019332316 7:466533-466555 TGGAGGAGGGTGAAGGAGGAGGG - Intergenic
1019332326 7:466574-466596 GGGAGGAGGCTGATGGAGGAGGG - Intergenic
1019332377 7:466779-466801 GGGAGGAGGGTGAAGGAGGAGGG - Intergenic
1019439982 7:1041122-1041144 ATGGAGAGACTGCAGGAGGGAGG + Intronic
1019502892 7:1374012-1374034 AGGAAGAGGGTGAAGGGGGAGGG + Intergenic
1019705699 7:2496193-2496215 ATGCAGAGGCAGCAGGAGGGAGG + Intergenic
1019924760 7:4184906-4184928 ATGAAGAGCCTGACCAAGGAAGG - Intronic
1020324871 7:6966698-6966720 CTCAGGAGGCTGAAGCAGGAGGG - Intergenic
1020537504 7:9419520-9419542 CTCAAGAGGCTGAGGCAGGAGGG + Intergenic
1020794927 7:12667619-12667641 AGGAAGAGGACGAGGGAGGAGGG + Intergenic
1021616151 7:22505100-22505122 GAGAAGAGGAAGAAGGAGGAAGG + Intronic
1022096161 7:27142878-27142900 AAGAAGAGGAGGAAGGAGGAAGG + Intronic
1022167548 7:27784673-27784695 ATGAAAAGTCTGAAGGTGGGGGG + Intronic
1022304526 7:29134192-29134214 CTGCAGAGGCTGAAGAATGAAGG - Intronic
1022349251 7:29551555-29551577 GAGAAGAGGATGAAGGAGGAGGG + Intergenic
1022581296 7:31557596-31557618 ATGAAGAGGCTGAAGTGCCAAGG - Intronic
1022636596 7:32142172-32142194 AAGAAAAGGCAGAAGGAGAAGGG + Intronic
1022670299 7:32449357-32449379 AAGAAGAGGAAGAAGGAGAAGGG + Intergenic
1022925942 7:35056316-35056338 GAGAAGAGGAAGAAGGAGGAAGG + Intergenic
1023137772 7:37070248-37070270 ATGAAGAGACTTAAGCAGCATGG - Intronic
1023254719 7:38301735-38301757 CTCAAGAGGCTGAGGCAGGAGGG - Intergenic
1023507126 7:40911458-40911480 CTGGGGAGGCTGAAGTAGGAGGG + Intergenic
1023556585 7:41429874-41429896 AAGAGTAGGCTGGAGGAGGAGGG - Intergenic
1024053134 7:45642157-45642179 ATCAGCAGGCAGAAGGAGGAAGG + Intronic
1024217119 7:47256928-47256950 ATGGAGACGGTGAGGGAGGAGGG + Intergenic
1024229528 7:47353749-47353771 CTGAGGAGGGTGGAGGAGGAGGG - Intronic
1024270399 7:47637140-47637162 ATGCAGCGGCTGGAGGAGGGGGG - Intergenic
1024460611 7:49655917-49655939 ATGGTGAGGCTGAGGGAGAAGGG + Intergenic
1024865378 7:53899943-53899965 TTGCAGAGGCTGCAGGAGGCAGG - Intergenic
1024977518 7:55127428-55127450 AAGGAGAGGATGAAGGAGTAAGG - Intronic
1024991784 7:55240435-55240457 AAGAAGAGGCAGAAGGAGAAAGG - Intronic
1025198712 7:56949441-56949463 AGGAATAGGGAGAAGGAGGAGGG - Intergenic
1025673236 7:63627490-63627512 AGGAATAGGGAGAAGGAGGAGGG + Intergenic
1025790714 7:64684628-64684650 AGGAAGAGGGTGAAGAAGCAGGG - Intronic
1026069369 7:67104383-67104405 AGGAAGAGAATGAAGGGGGAAGG + Intronic
1026129922 7:67611932-67611954 AGGAAGAGGCAGAAGGGAGATGG - Intergenic
1026184537 7:68072190-68072212 TTCAAGAGGCTGGAGGGGGAAGG - Intergenic
1026205617 7:68255040-68255062 AAGAAGAGGAAGGAGGAGGAGGG - Intergenic
1026280225 7:68915694-68915716 TTTGAGAGGCTGAAGCAGGAGGG + Intergenic
1026305287 7:69134966-69134988 AGGTAGAGAGTGAAGGAGGAAGG - Intergenic
1026309103 7:69168297-69168319 ATTAAGAGCCAGAATGAGGACGG + Intergenic
1026603970 7:71800224-71800246 ATGAAAAGGCTGGATGATGATGG - Intronic
1026680224 7:72461027-72461049 ATGGAGAGAAGGAAGGAGGAAGG - Intergenic
1026707534 7:72707935-72707957 AGGAAGAGAATGAAGGGGGAAGG - Intronic
1026996809 7:74622378-74622400 TTTAGGAGGCTGAGGGAGGAGGG + Intergenic
1027712523 7:81623512-81623534 AGGAAGAAGGTGAAGGAGAAGGG + Intergenic
1028376320 7:90149235-90149257 GAGAAGAGGAAGAAGGAGGAAGG - Intergenic
1028379111 7:90178100-90178122 ATGAAGGGGCTGAGGAGGGAGGG + Intronic
1028402883 7:90443353-90443375 AGGAAGAGACTGAGGGAAGAGGG + Intronic
1028409970 7:90519835-90519857 ATGAAGGAGGTGAAGGAAGAAGG - Intronic
1028424372 7:90670131-90670153 ATGCAGAGGCTGTAGGAAGTAGG + Intronic
1028921376 7:96314108-96314130 AGGAGGAGGAAGAAGGAGGAAGG + Intronic
1029823948 7:103171006-103171028 GAGAAGAGGAAGAAGGAGGAAGG + Intergenic
1029853483 7:103489306-103489328 TGGAAGAGGCTGAGGAAGGAGGG + Intronic
1030014200 7:105201975-105201997 ATGAAGAGTAAGAGGGAGGATGG + Intronic
1030139393 7:106289451-106289473 AGGATGAAGCTGAAGGAGGTGGG + Intergenic
1030360253 7:108588037-108588059 ATGGAGAGTGTGAGGGAGGAGGG - Intergenic
1030462405 7:109855904-109855926 AAGAAGAGGAAGAAGGAAGAAGG + Intergenic
1030715846 7:112805949-112805971 CTAAAGAGGCAGAAGGTGGAGGG - Intergenic
1031102918 7:117504644-117504666 CTCAGGAGGCTGAAGCAGGAGGG + Intronic
1031589239 7:123569615-123569637 AGGAAGAGGCTGAAGAAAGGTGG + Intronic
1031838614 7:126709476-126709498 AGGAAGAAGAAGAAGGAGGAGGG + Intronic
1031878501 7:127169097-127169119 ATGAGGAAGCTTAATGAGGAAGG + Intronic
1032104054 7:129010273-129010295 CTCAAGAGGCTGAGGCAGGAAGG - Intronic
1032362082 7:131265410-131265432 AGAAAGAGGCCGAAGGAGCAAGG - Intronic
1032669396 7:134069408-134069430 GAGAAGAGGAGGAAGGAGGAAGG - Intergenic
1032669408 7:134069460-134069482 GAGAAGAGGATGGAGGAGGAAGG - Intergenic
1033017314 7:137684964-137684986 ATGAAAAGCCAGAAGGAGGCAGG - Intronic
1033430403 7:141283993-141284015 ATGATTCGGCTGAAGGAGGTCGG - Intronic
1034016943 7:147597702-147597724 ATGAAGGGGCTGAAGGATGGGGG - Intronic
1034074218 7:148216230-148216252 AGGAAAAGGCTGATGCAGGAAGG + Intronic
1035245903 7:157561817-157561839 AGGAAGATGCAGCAGGAGGATGG + Intronic
1035269863 7:157712882-157712904 TGGCAGAGGCTGGAGGAGGAGGG + Intronic
1035637416 8:1156877-1156899 ATGAGGAGGCTGACTCAGGAAGG + Intergenic
1035766704 8:2112314-2112336 TTGAAGAGGCTGAAGTAGTCAGG + Intronic
1036287928 8:7460968-7460990 ATGATGGGGCTGATGGAGAATGG + Intronic
1036333548 8:7850560-7850582 ATGATGGGGCTGATGGAGAATGG - Intronic
1036371194 8:8164247-8164269 CTCAGGAGGCTGAAGCAGGAGGG + Intergenic
1036879708 8:12501401-12501423 CTCAGGAGGCTGAAGCAGGAGGG - Intergenic
1038056533 8:23863642-23863664 ATGAAGCAGCTTAGGGAGGAGGG + Intergenic
1038115785 8:24553733-24553755 ATGTGCAGGCTGAAGGTGGAAGG - Intergenic
1038293966 8:26274039-26274061 AAGAAGAGGTGGCAGGAGGAAGG - Intergenic
1038824900 8:30989522-30989544 ATAAAGAGGCTGAGGGAAGTGGG + Intergenic
1038896888 8:31793882-31793904 ATGGAGAGATGGAAGGAGGAAGG - Intronic
1039789942 8:40867512-40867534 ACGAAGAGGCAGAGGGTGGAGGG - Intronic
1040468546 8:47717230-47717252 GTGAAGAGAATGAAGGTGGAAGG - Intronic
1041225429 8:55692726-55692748 ATCAGGAGGCAGAGGGAGGATGG - Intergenic
1041515999 8:58699669-58699691 AGGAAGAGCCTGAGGCAGGAAGG + Intergenic
1041795397 8:61742431-61742453 AGGAAGGGTCTGAAGCAGGATGG + Intergenic
1041930511 8:63281234-63281256 ATGATGGGGCTGAGGGAGGGAGG - Intergenic
1042190884 8:66186020-66186042 ATGAAGAGGCTGTAGGAGGCAGG - Intergenic
1042400379 8:68338464-68338486 CTGAAGATGCAGAAGGAGTAAGG - Intronic
1042870999 8:73399425-73399447 TTGAGGAGGCTGAAGGGGGTGGG - Intergenic
1043084454 8:75810918-75810940 ATGAAGAGGAAGAAGAAGGAAGG - Intergenic
1043380293 8:79695290-79695312 ATGAAGAGGCAGAAGGACTCAGG + Intergenic
1043493878 8:80779079-80779101 AGGAAGAGGGGGAGGGAGGAAGG - Intronic
1043548041 8:81337249-81337271 AAGAGGAGGCGGAAGAAGGAAGG + Intergenic
1044462275 8:92459253-92459275 ATGAAGAGGCCCAAGGATGAAGG - Intergenic
1045039868 8:98213201-98213223 CTGGGGAGGTTGAAGGAGGAGGG - Intronic
1045236996 8:100360785-100360807 GTGAGGAGGTTGAAGGAGGGGGG + Intronic
1045775475 8:105797569-105797591 GAGAAGAGGCTGTAGGAGGCAGG - Intronic
1046015600 8:108601126-108601148 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1046730736 8:117723273-117723295 GTGAATAGGATGAAGGAGGGAGG - Intergenic
1046779622 8:118201233-118201255 ATGCAGAGCCAGAAGGAGGCTGG - Intronic
1046824214 8:118669624-118669646 TTGGGGAGGCTGAAGCAGGAGGG + Intergenic
1046998219 8:120547793-120547815 ATGAAGAGGCAGAGGCAGAATGG - Intronic
1047744106 8:127831208-127831230 ATACAGAGGCTGAGGCAGGAGGG + Intergenic
1049047477 8:140164444-140164466 CTGAAGAGGAAGAAGGAAGAAGG - Intronic
1049241847 8:141541823-141541845 AGGAAGAGGCTGCAGGAGTGGGG - Intergenic
1049733292 8:144190144-144190166 ATGCAGAGGCAGGAGGAAGATGG - Intronic
1049915752 9:316794-316816 ACAAAGAGACTGAAGCAGGAAGG - Intronic
1050393134 9:5167620-5167642 GAGAAGAGGCTCTAGGAGGAGGG + Intronic
1050616126 9:7403423-7403445 ATGATGAAGATGAAGGAGGATGG - Intergenic
1050778426 9:9298632-9298654 ATAAAGAAGCTGAAGCAGGAGGG + Intronic
1051064420 9:13085183-13085205 ATGATTAGGCTGAGTGAGGAAGG + Intergenic
1051504078 9:17808834-17808856 AGGAGGAGGCTGGAGGTGGAGGG + Intergenic
1051898486 9:22013057-22013079 GTGAAGAGGCAGCAGTAGGATGG - Intronic
1052344626 9:27396865-27396887 ATGAAGAGGGTTAACGTGGATGG - Intronic
1053073821 9:35116226-35116248 GAGAAGGGGCGGAAGGAGGAGGG - Intronic
1053144505 9:35703379-35703401 CTGAGAAGGCTGGAGGAGGATGG + Intronic
1053278753 9:36802813-36802835 ATGAAAAGGATCAGGGAGGAGGG + Intergenic
1053336750 9:37281121-37281143 CTCAGGAGGCTGAAGCAGGAGGG - Intronic
1053504048 9:38625560-38625582 AAGAAGAGGCAGAAAGAGGATGG - Intergenic
1054352354 9:64028734-64028756 TTTAGGAGGCTGAAGCAGGATGG + Intergenic
1054720597 9:68599905-68599927 ATGAAGAGGAGAGAGGAGGATGG - Intergenic
1055033892 9:71797439-71797461 ATGAAGAGATGGAAAGAGGAAGG - Intronic
1055106990 9:72523254-72523276 AAGAAGAGGAGGAAGGAGGGAGG + Intronic
1055107019 9:72523611-72523633 TTGAATAGGCTGAAGGAGGAGGG + Intronic
1055248088 9:74271128-74271150 AGGAAGAGGCTGGAGGAGCAAGG + Intergenic
1055533622 9:77213606-77213628 CTCAAGAGGCTGAGGCAGGAAGG - Intronic
1055845913 9:80563457-80563479 AGGAAGAGAGGGAAGGAGGAAGG + Intergenic
1056327355 9:85490915-85490937 ATGGGGAGCCAGAAGGAGGATGG - Intergenic
1056479678 9:86988462-86988484 AGGCAGAGGCTGGATGAGGAGGG - Intergenic
1056554893 9:87679999-87680021 ATTAAGAGGCTGAAAGAAAATGG - Intronic
1056695566 9:88847555-88847577 ATGATTAAGCTGAATGAGGAAGG - Intergenic
1056901103 9:90600215-90600237 GTGAGGAGGCTGAGAGAGGAGGG - Intergenic
1057231547 9:93324535-93324557 ATGGGGAGGCTGGAGGGGGATGG - Intronic
1057236542 9:93366082-93366104 ATGGGGAGGCTGGAGGGGGATGG + Intergenic
1057259287 9:93575431-93575453 AGAAAGAGGGTGAGGGAGGAAGG + Intergenic
1057336184 9:94156938-94156960 ATGAAGAGGCTCATGCACGATGG + Intergenic
1057373072 9:94491483-94491505 ATGGGGAGGCTGAGGCAGGAGGG + Intergenic
1057387116 9:94614129-94614151 AAGAGGAGGGAGAAGGAGGAGGG + Intronic
1057453526 9:95187320-95187342 ATGAAGAGGGAGAAGGGAGAAGG - Intronic
1057474727 9:95388704-95388726 ATGAAGAGGGAGAAGGGAGAAGG + Intergenic
1057504515 9:95621708-95621730 ATGATTAAGCTGAATGAGGAAGG + Intergenic
1057840470 9:98481994-98482016 AAGAACAGGCTGAAAGAGAACGG + Intronic
1058736876 9:107901833-107901855 ATGATGAGGCTCACAGAGGAGGG - Intergenic
1058810369 9:108633270-108633292 CTTGAGAGGCTGAAGCAGGAAGG + Intergenic
1059305510 9:113350292-113350314 GGGAAGAGGCGAAAGGAGGAGGG - Intronic
1059672252 9:116502814-116502836 AAGAAGAGAATGAAGGAGGGAGG + Intronic
1059719469 9:116945575-116945597 ATAAAGAGAATGAAAGAGGAAGG - Intronic
1059761247 9:117339754-117339776 AGGAAGAAGGTGAAGGAAGAAGG + Intronic
1059880831 9:118687104-118687126 ATGGAGTGGCTGAAGCAGGATGG - Intergenic
1059985657 9:119818053-119818075 TTGCAGAGGCTGAAAGGGGATGG - Intergenic
1060316486 9:122516259-122516281 ATCAAGAGGCTGAATGTGGTGGG + Intergenic
1060419928 9:123461125-123461147 ATGAAGAAGGTGAGGAAGGAAGG - Intronic
1060525320 9:124317011-124317033 AAGAGGAGGGTGAAGGAGCAGGG + Intronic
1060871001 9:127040102-127040124 AAGAAAAGGCTGAAGTAGGCCGG + Intronic
1061099894 9:128484616-128484638 AAGCAGAGGGTGAAGGAGAAAGG - Intronic
1061244773 9:129395854-129395876 ATGAGAAGGTGGAAGGAGGATGG + Intergenic
1061246190 9:129402233-129402255 GGGAAGAGGGTGAAGGAGGGAGG - Intergenic
1061301787 9:129709764-129709786 AGGAAGAGGCTGGGGGAGGCCGG - Intronic
1061373468 9:130210944-130210966 TTTGGGAGGCTGAAGGAGGAGGG - Intronic
1061772029 9:132932657-132932679 ATGAAGAGGCAGAGGGGGGTTGG - Intronic
1061773789 9:132946940-132946962 AAGAAGAGGCTGAAGGTGACAGG + Intronic
1061779390 9:132986856-132986878 AAGAAGAGGCTGCTGCAGGAGGG - Intronic
1062526609 9:136980436-136980458 ATGAAGGGGCTGCGGGAGGGAGG - Intronic
1062638417 9:137503611-137503633 AGGAGGAGGGAGAAGGAGGAGGG + Intronic
1062679090 9:137767225-137767247 CTCAAGAGGCTGAGGCAGGAGGG - Intronic
1203464971 Un_GL000220v1:77320-77342 TTGCAGAGGATGATGGAGGAAGG - Intergenic
1185603541 X:1354808-1354830 AGGAAGAGGGTGAAGGAGAGAGG + Intronic
1185604548 X:1360503-1360525 ATGAAGAGAGGGAAGGAGAAAGG - Intronic
1185611740 X:1397350-1397372 CTGATGAGGCTGCAGGATGAGGG + Intergenic
1185887116 X:3792718-3792740 AAGAAGGAGCTGGAGGAGGAGGG + Intergenic
1185999230 X:4989375-4989397 AGGAAGAGACAGAAGGAGGGAGG - Intergenic
1186034469 X:5406131-5406153 AGGAGGAAGATGAAGGAGGAAGG + Intergenic
1186246680 X:7622683-7622705 AGGAAGAGAGGGAAGGAGGAAGG - Intergenic
1186463474 X:9766061-9766083 AGGAAGAGGGAGGAGGAGGAGGG + Intronic
1186468642 X:9804174-9804196 AGGTGGAGGCTGAAGGAGCATGG + Intronic
1186492868 X:9988185-9988207 CTCAAGAAGCTGAGGGAGGAGGG + Intergenic
1186726477 X:12364312-12364334 GTCAAGAGGCGGAAGGAGAAGGG + Intronic
1187395347 X:18914650-18914672 CAGAAGAGGGTAAAGGAGGAAGG + Intronic
1187467992 X:19543216-19543238 ATGCAGAGGGTGGAGGAGGAAGG + Intronic
1188039769 X:25358216-25358238 ATGAAGAGGCAGAGTGAGCAAGG - Intergenic
1188932235 X:36125870-36125892 ATGATGACACTGAGGGAGGAAGG - Intronic
1188994927 X:36872472-36872494 CTTAAGAGGCTGAAGCAGGAGGG + Intergenic
1189289154 X:39872997-39873019 GTGAAGAGGCTGGAGCATGAGGG - Intergenic
1189420464 X:40852735-40852757 AAGTAGAAGCTGAAAGAGGAAGG + Intergenic
1189703635 X:43737533-43737555 CAGAAAAGGCAGAAGGAGGAAGG + Intronic
1189765954 X:44372427-44372449 CTGAAGGGGATAAAGGAGGAAGG - Intergenic
1189921248 X:45905040-45905062 AATAAATGGCTGAAGGAGGAAGG - Intergenic
1189957276 X:46288548-46288570 ATGAAGATCCTCAAGGAGGGCGG - Intergenic
1190074876 X:47309657-47309679 CTCAAGAGGCTGAAGAAGGAGGG - Intergenic
1190146130 X:47893169-47893191 GTTAAGAGACTGAAGTAGGAAGG + Intronic
1190283088 X:48944213-48944235 ATCAAGCAGATGAAGGAGGATGG - Exonic
1190311857 X:49122564-49122586 AAGAAGAGGAAGAAGGTGGAAGG - Intronic
1190420986 X:50284204-50284226 ACGAAGATGGTGAAGGAGTAGGG - Intronic
1190449577 X:50565118-50565140 AGGAAGAGGCATAAGGAGTATGG - Intergenic
1190496646 X:51033412-51033434 CTGAGGAGTCTGAGGGAGGATGG - Intergenic
1190509326 X:51160525-51160547 CTGAGGAGTCTGAGGGAGGATGG + Intergenic
1190821824 X:53980411-53980433 ATGAAGAGGCAGCAAGACGAAGG + Intronic
1192098515 X:68239071-68239093 ATGGGGAGCCAGAAGGAGGATGG + Intronic
1192162186 X:68796747-68796769 GTGGAGAGGGTGAAGGAGTAAGG - Intergenic
1192448964 X:71230910-71230932 AGGAAGAGGGGGAAGGGGGAAGG + Intergenic
1192459496 X:71304777-71304799 ATGAAAAGGGAGAAGGAAGAGGG - Intronic
1192577906 X:72257646-72257668 TTGAAGATGATCAAGGAGGAAGG + Intronic
1193601538 X:83512572-83512594 ATGGAGAGGAAGAAGAAGGATGG - Intergenic
1193729512 X:85086194-85086216 GTGAAGAGATTGAAGGAGGAAGG - Intronic
1194767621 X:97860448-97860470 AGGAAGAAGCTGAGGGAGGCTGG + Intergenic
1195294589 X:103463492-103463514 AGGAAGAGGAAGAAGGAGGAGGG + Intergenic
1195376348 X:104231612-104231634 CTTAAGAGGCTGAGGTAGGAGGG - Intergenic
1195574200 X:106431534-106431556 CTGAAGGGGCTGGAGGAGGAAGG - Intergenic
1195703438 X:107721871-107721893 CTGAAGAGGCTGGAGGAATAAGG + Intronic
1196544672 X:116947770-116947792 CTGAAGATGGTGAAGGGGGAAGG + Intergenic
1197448946 X:126587395-126587417 CTCAGGAGGCTGAAGTAGGAGGG - Intergenic
1197618410 X:128719967-128719989 ATGGAGACTCAGAAGGAGGATGG - Intergenic
1197951714 X:131904711-131904733 TTGACGAGGCAGATGGAGGATGG - Intergenic
1198697653 X:139359736-139359758 ATGAAGAGCTGGAAGGGGGACGG + Intergenic
1198803597 X:140472104-140472126 CTTGAGAGGCTGAAGCAGGAGGG - Intergenic
1199045569 X:143167319-143167341 CTGAAGAAGCAGAAGGAGGGTGG + Intergenic
1199193840 X:145003745-145003767 CTGAAGATGGAGAAGGAGGAGGG + Intergenic
1199286010 X:146054905-146054927 AGGAAGAGGAAGGAGGAGGAGGG + Intergenic
1199369746 X:147033647-147033669 CTCAAGAGGCTGAAGGGGGGAGG + Intergenic
1199374665 X:147093467-147093489 ATGAAATGGCTGAAAGTGGATGG - Intergenic
1199761637 X:150908961-150908983 CTTAAGAGGCTGAGGCAGGAGGG + Intergenic
1200812357 Y:7499272-7499294 ATGATGAGGAAGAAGGAAGAAGG - Intergenic
1201154244 Y:11115291-11115313 TTTAGGAGGCTGAAGCAGGATGG + Intergenic
1201461675 Y:14232565-14232587 AAGAAGAAGCAGAAGAAGGAAGG - Intergenic
1201575379 Y:15456478-15456500 ATCAAGGGTGTGAAGGAGGATGG + Intergenic