ID: 1157515546

View in Genome Browser
Species Human (GRCh38)
Location 18:48308473-48308495
Sequence CGAGTCTCCTGCCAGCCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 193}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157515534_1157515546 23 Left 1157515534 18:48308427-48308449 CCAGGCTGGCCAGAGTCCTTCTG 0: 1
1: 0
2: 1
3: 21
4: 237
Right 1157515546 18:48308473-48308495 CGAGTCTCCTGCCAGCCTGGGGG 0: 1
1: 0
2: 2
3: 19
4: 193
1157515532_1157515546 29 Left 1157515532 18:48308421-48308443 CCATGCCCAGGCTGGCCAGAGTC 0: 1
1: 0
2: 5
3: 42
4: 324
Right 1157515546 18:48308473-48308495 CGAGTCTCCTGCCAGCCTGGGGG 0: 1
1: 0
2: 2
3: 19
4: 193
1157515536_1157515546 14 Left 1157515536 18:48308436-48308458 CCAGAGTCCTTCTGCCTTGGTTT 0: 1
1: 0
2: 3
3: 33
4: 342
Right 1157515546 18:48308473-48308495 CGAGTCTCCTGCCAGCCTGGGGG 0: 1
1: 0
2: 2
3: 19
4: 193
1157515537_1157515546 7 Left 1157515537 18:48308443-48308465 CCTTCTGCCTTGGTTTCTCAGTG 0: 1
1: 0
2: 6
3: 96
4: 1261
Right 1157515546 18:48308473-48308495 CGAGTCTCCTGCCAGCCTGGGGG 0: 1
1: 0
2: 2
3: 19
4: 193
1157515540_1157515546 0 Left 1157515540 18:48308450-48308472 CCTTGGTTTCTCAGTGGGCATCC 0: 1
1: 0
2: 1
3: 4
4: 170
Right 1157515546 18:48308473-48308495 CGAGTCTCCTGCCAGCCTGGGGG 0: 1
1: 0
2: 2
3: 19
4: 193
1157515531_1157515546 30 Left 1157515531 18:48308420-48308442 CCCATGCCCAGGCTGGCCAGAGT 0: 1
1: 0
2: 2
3: 24
4: 258
Right 1157515546 18:48308473-48308495 CGAGTCTCCTGCCAGCCTGGGGG 0: 1
1: 0
2: 2
3: 19
4: 193
1157515533_1157515546 24 Left 1157515533 18:48308426-48308448 CCCAGGCTGGCCAGAGTCCTTCT 0: 1
1: 0
2: 3
3: 22
4: 332
Right 1157515546 18:48308473-48308495 CGAGTCTCCTGCCAGCCTGGGGG 0: 1
1: 0
2: 2
3: 19
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157515546 Original CRISPR CGAGTCTCCTGCCAGCCTGG GGG Intronic
900570704 1:3356912-3356934 CGAGTCTCCTGAGAGCCGGGTGG + Intronic
900666601 1:3819831-3819853 AGAGTCTCCTGCTGGCCTCGAGG + Intronic
901217390 1:7562468-7562490 AGAGCCGTCTGCCAGCCTGGGGG - Intronic
901236351 1:7669605-7669627 CCAGGCTCCAGCCTGCCTGGCGG + Intronic
901423590 1:9166852-9166874 AGCGGCTCCTGCCTGCCTGGTGG - Intergenic
901836274 1:11926036-11926058 CGAGCCGTCTGCCTGCCTGGAGG - Exonic
901878597 1:12181085-12181107 CGGGCCTGGTGCCAGCCTGGGGG + Intronic
902589106 1:17460716-17460738 CCTGTCACCTGCCACCCTGGAGG - Intergenic
903064318 1:20690263-20690285 GGAGTCTCGGGCCAGGCTGGAGG - Exonic
905297467 1:36963201-36963223 AGAGAGTCCTGCCAGCCTGATGG - Intronic
907237752 1:53063165-53063187 CGAGGCTCCTGGCAGCCTCGGGG + Intronic
908331617 1:63076403-63076425 TGTGTTTCCTGCCAACCTGGAGG + Intergenic
912725188 1:112052932-112052954 AGAGTCTCCTGCTGGCCTGAGGG - Intergenic
915506305 1:156358655-156358677 CAAGTCTCCTGCCCACCTTGGGG - Intronic
916629213 1:166593711-166593733 AGGGTCTCCTCCCAGACTGGAGG - Intergenic
917150612 1:171940233-171940255 ACAGTCTCCTGCAAGCCTGGTGG + Intronic
919660920 1:200245583-200245605 TGCGTCTCCTCCCAGCCTGATGG - Intergenic
920004977 1:202826455-202826477 CAAGTCTCCTGACATCTTGGCGG - Exonic
922533351 1:226361607-226361629 TGAGCGTCCTGCCAGCCTGGGGG - Intronic
922870441 1:228898146-228898168 CGTGTCTTTTGCCGGCCTGGTGG - Intergenic
924772130 1:247087872-247087894 CCAGGCTCCTGTCAGCCAGGAGG + Intergenic
1072609860 10:97010923-97010945 GGAGGCTCCTGCCAGCCCAGGGG + Intronic
1073328710 10:102657237-102657259 CCAGTCCCTTCCCAGCCTGGCGG + Exonic
1074079169 10:110153743-110153765 CGTGTCTCCTTCCTCCCTGGAGG - Intergenic
1075322558 10:121503837-121503859 GGAGACCCCTGCCAGCATGGGGG + Exonic
1076220413 10:128729224-128729246 CCAGCCTCCTGCTAGCTTGGTGG + Intergenic
1076496662 10:130901860-130901882 CGGTTCCCCTGCAAGCCTGGGGG + Intergenic
1077010052 11:375679-375701 CCAGTCTCCAGCCAGCCACGTGG + Exonic
1077195530 11:1278118-1278140 AGACTCGCCTCCCAGCCTGGTGG + Intronic
1077282384 11:1751512-1751534 CGAGAATCCTGCCGGGCTGGAGG + Intronic
1077764096 11:5138431-5138453 CAAATCTCTGGCCAGCCTGGAGG + Intergenic
1080133154 11:28819926-28819948 CAAGTCACCTGGCAGCCAGGAGG - Intergenic
1080664862 11:34326968-34326990 CGATTCTCCTGTCAGCCTCCTGG - Intronic
1080688657 11:34537008-34537030 CAAGTCTCTTCACAGCCTGGTGG - Intergenic
1081877600 11:46420351-46420373 TGAGACTCCTGCCAGCCAGGAGG - Intronic
1085323670 11:75590389-75590411 GGAGTCTCCTGCTGGCCTGGAGG + Intronic
1085332756 11:75667532-75667554 CGCGCCCCCTGCCAGCCTCGGGG + Exonic
1088681833 11:112250029-112250051 GGAGTCTTCTTCCCGCCTGGAGG + Intronic
1098680848 12:73352038-73352060 AGACTCTCCTGCCTGCCTGAAGG - Intergenic
1100643019 12:96500869-96500891 ATAGTCTGCTGGCAGCCTGGGGG - Exonic
1101436522 12:104669140-104669162 TGTGTCTCCTGCCAGCCAGCTGG + Intronic
1101721591 12:107355165-107355187 GGAGTCTCCTGTGAGGCTGGCGG - Intronic
1101969114 12:109300385-109300407 CCAGTCTCCTGAGAGCCTGTGGG + Intronic
1103916972 12:124380724-124380746 GGGGTCTCCTGTCGGCCTGGTGG + Intronic
1105725443 13:23159045-23159067 GGAGACTCCAGCCAGCATGGGGG - Intergenic
1108552420 13:51559711-51559733 AGAGTCTGTTGCCAGGCTGGAGG - Intergenic
1113876365 13:113597318-113597340 CGAGTATACCGCCAGCCTGTGGG - Intronic
1115910882 14:38255541-38255563 CGCATCTCCTTCCAGCCTGCGGG + Exonic
1117545162 14:56787899-56787921 CAATTCTTCTGCCTGCCTGGTGG + Intergenic
1119186857 14:72649265-72649287 TGAGTACCCTGCCAGCCAGGAGG + Intronic
1121509411 14:94501312-94501334 CAAGGCTCCTGCCAGGCTGCTGG - Intronic
1121779878 14:96615544-96615566 CGACTCTCCTGCCAGCCACGGGG + Intergenic
1122895850 14:104756560-104756582 CCAGTCTCCTTGCAGCCTGACGG + Intronic
1122937601 14:104967225-104967247 CCAGGCTCCTGCCAGCTGGGTGG - Intronic
1124620339 15:31270403-31270425 ACAGACTCCTGCCATCCTGGGGG - Intergenic
1125216368 15:37280203-37280225 CTTGTCTCCTGCTAGCCTTGGGG + Intergenic
1125895452 15:43298182-43298204 ACAATCTCCTGCCATCCTGGTGG + Intronic
1128133242 15:65244820-65244842 TGAGTCTCCTGTGAGCCTGTTGG + Intronic
1128497867 15:68208497-68208519 GGACTCTTCTGCCTGCCTGGAGG - Intronic
1128656696 15:69467800-69467822 GGAGTCACCTTCCAGCCCGGCGG + Intergenic
1129695718 15:77739655-77739677 AGAGTTACCAGCCAGCCTGGGGG + Intronic
1129820863 15:78601001-78601023 CCAGCCTGCTGGCAGCCTGGTGG + Intronic
1130317571 15:82809735-82809757 CGAGCAGCCTGACAGCCTGGAGG + Exonic
1130956201 15:88629163-88629185 CGTGTCTCCTGCCAACCTGATGG + Intronic
1132497610 16:271152-271174 CGGGTGTGCTCCCAGCCTGGGGG - Intronic
1132838282 16:1965534-1965556 CGACTCGCCTATCAGCCTGGCGG + Intergenic
1132980862 16:2738106-2738128 GGCTTGTCCTGCCAGCCTGGGGG - Intergenic
1134531909 16:14989959-14989981 CGAGCCGTCTGCCTGCCTGGAGG - Intronic
1135060456 16:19267046-19267068 CGTGTCTCCTGCCTCCCTGGAGG + Exonic
1135150916 16:20004904-20004926 AGAGTCTCCTGTCAGCATGGTGG - Intergenic
1135325146 16:21520967-21520989 GCAGCCTCCTTCCAGCCTGGGGG + Intergenic
1136336630 16:29614235-29614257 GCAGCCTCCTTCCAGCCTGGGGG + Intergenic
1137531716 16:49282281-49282303 CGAGTCGCCTGCCCGCCTGTGGG + Intergenic
1138104046 16:54277550-54277572 CCAGTCCACTGCCAGCCTGTGGG + Intergenic
1142037354 16:87870019-87870041 GCAGCCTCCTTCCAGCCTGGGGG + Intergenic
1142147850 16:88499947-88499969 TGGGTCTCCAGCCATCCTGGTGG + Intronic
1142182378 16:88677545-88677567 AGAGTCTCCTGCCTACTTGGTGG + Intergenic
1142271214 16:89090408-89090430 CGAGTCTCCTGAAAGGCAGGAGG + Intronic
1142768918 17:2082614-2082636 GGAGCCTCCTGCCAGGCTGGTGG + Intronic
1143118372 17:4593095-4593117 CATGTCTGCTGCCACCCTGGGGG + Exonic
1143620363 17:8076882-8076904 AGAGACTCCAGTCAGCCTGGGGG - Intronic
1145193584 17:20868029-20868051 AGCTTCTCCTGCCAGGCTGGAGG - Intronic
1148115622 17:45172934-45172956 GGAGTCTCCTGGCCGCCTGGAGG + Intergenic
1151946376 17:77322065-77322087 CGAGGCCCCTGCCAGCCAGGCGG - Intronic
1154353256 18:13604896-13604918 CATGTGTCCTGCCTGCCTGGTGG - Intronic
1157515546 18:48308473-48308495 CGAGTCTCCTGCCAGCCTGGGGG + Intronic
1160024682 18:75208345-75208367 CGAGGCGGCTGCCAACCTGGAGG + Intronic
1160982390 19:1822371-1822393 AGAGGCGCGTGCCAGCCTGGCGG - Intronic
1160982717 19:1823645-1823667 CGACTTCTCTGCCAGCCTGGCGG + Exonic
1161064059 19:2228926-2228948 CAAGTGCCCTGCCTGCCTGGGGG + Intronic
1161238478 19:3209228-3209250 AGGGTCCCCTGCCAACCTGGAGG - Exonic
1162578058 19:11510851-11510873 CGTGTCTCCTGGCAGCCGTGTGG - Intronic
1162825046 19:13246089-13246111 CGAGTATGCTGCCAACCTAGTGG - Intronic
1163102221 19:15105102-15105124 CGGGTTTCCTTCCAGCATGGTGG - Intergenic
1167324200 19:48813791-48813813 ATTGTCTCCTGCCAGCCAGGGGG + Intronic
1168243464 19:55098565-55098587 AGAGCTTCCTGCCTGCCTGGTGG - Intronic
1168300240 19:55400918-55400940 CGAGCCTCATGCCAGACTGCTGG + Exonic
926858294 2:17281097-17281119 CAAGTGTTCTGGCAGCCTGGAGG + Intergenic
927111900 2:19869457-19869479 ATGGTCACCTGCCAGCCTGGAGG - Intergenic
927149365 2:20186875-20186897 GGAGTCTCTTGCCAGCCGTGGGG - Intergenic
927981630 2:27378301-27378323 CCAGTTTCCTGCCAGACTGTGGG - Exonic
929776931 2:44935769-44935791 CGCCTCTCCTGCCAGCCGTGTGG + Intergenic
930604780 2:53482538-53482560 CGCCTCTCCTACCAGCCTGTTGG + Intergenic
933635554 2:84704897-84704919 CCTGTCTCCTGGAAGCCTGGTGG - Intronic
933884880 2:86709709-86709731 CCTGTATCCTGCCAGCCTGTGGG + Intronic
936088806 2:109488055-109488077 CAGGTCTCCTGCCTGCCAGGAGG + Intronic
937283244 2:120734996-120735018 CAATTCTCCTCCAAGCCTGGCGG + Intergenic
938406033 2:131033683-131033705 CAATTCTCCTGACAGCTTGGGGG + Intronic
941752876 2:169151854-169151876 TGAGTCTCCTGTTAGCCTGCAGG + Intronic
944271757 2:197791565-197791587 GGAAGCTTCTGCCAGCCTGGTGG + Intergenic
945993056 2:216412690-216412712 CGAGACCAATGCCAGCCTGGAGG + Intronic
948722657 2:239911298-239911320 AGAGTCGCCTGCCGCCCTGGGGG - Intronic
1169084070 20:2816200-2816222 AGGCTCCCCTGCCAGCCTGGAGG + Intergenic
1169388177 20:5168676-5168698 TGGGTTTCCTGCCAGCCTGGTGG - Intronic
1170705268 20:18738731-18738753 GGAGACTCCTGCCAGCAGGGAGG + Intronic
1170891929 20:20383266-20383288 TGAGTGTCCTGACAGCATGGTGG + Intergenic
1172630510 20:36375189-36375211 CTTGTCTCCTGCCACCCTGCAGG + Intronic
1173018456 20:39247739-39247761 CTCGTCTCCTGCCAGCCATGTGG + Intergenic
1174148288 20:48467879-48467901 CCTGTCTCCTGCCAGCCAGCAGG - Intergenic
1175889835 20:62311216-62311238 CGAGACTCCTACCAGTTTGGGGG - Exonic
1178586568 21:33875562-33875584 AGCCTCGCCTGCCAGCCTGGAGG + Intronic
1180141505 21:45896099-45896121 CCATTCTCCTGCCACCCGGGAGG + Intronic
1180830382 22:18902858-18902880 GGTGTCACCAGCCAGCCTGGAGG + Intergenic
1180958983 22:19754209-19754231 CCAGCCTCCTCCCAGCCGGGAGG - Intergenic
1181069328 22:20322673-20322695 GGTGTCACCAGCCAGCCTGGTGG - Intergenic
1185048053 22:48538830-48538852 CTTGTCTCCTTCCACCCTGGAGG + Intronic
1203280471 22_KI270734v1_random:128129-128151 GGTGTCACCAGCCAGCCTGGAGG + Intergenic
949233137 3:1774888-1774910 GGAGAAACCTGCCAGCCTGGAGG - Intergenic
949581581 3:5393803-5393825 CCAGTCTGTTGCCAGGCTGGAGG + Intergenic
950364933 3:12476206-12476228 CGAGCTTCCCTCCAGCCTGGCGG + Intergenic
950464321 3:13144350-13144372 TGAGTCTCCTGACAGCCACGTGG - Intergenic
959365161 3:105448756-105448778 CGAGTTCCCTGCCAGACTGGAGG - Intronic
960949276 3:122988582-122988604 GGAGCCTCCTGCCAGCCCTGGGG + Intronic
960996841 3:123345827-123345849 TGAGTCTCCTGTTAGCCTGAGGG + Intronic
962592651 3:136906747-136906769 CGTGCCACCTGCAAGCCTGGGGG - Intronic
962793867 3:138834531-138834553 CGCGCTTCCTGCCAGCTTGGAGG - Intronic
963777005 3:149449912-149449934 GCAGTCTCCTGCCAGCTTGGAGG + Intergenic
967841353 3:194007415-194007437 CTAGAATCCTGCCAGCCTCGTGG - Intergenic
967846947 3:194051766-194051788 AGAGTCACCTCCCAGGCTGGGGG + Intergenic
967919592 3:194604410-194604432 CCCGTCACCTGGCAGCCTGGTGG + Exonic
968108351 3:196020344-196020366 GGAGTGTCCTGCCATTCTGGAGG - Intergenic
968649189 4:1753695-1753717 CGAGTCTCCAGCCCGCGAGGGGG + Intergenic
971156747 4:24091501-24091523 CCAGTCTTCTTCCAGCCTTGGGG + Intergenic
971628993 4:28964166-28964188 CAAGTCTTCTGCAAGCCTGCAGG - Intergenic
974047096 4:56907735-56907757 CCAGTCTCCAGCTCGCCTGGGGG - Intergenic
975392579 4:73836614-73836636 TGAGTTTCCTGCCAGTCGGGAGG + Exonic
975911534 4:79272958-79272980 TGGGTTTCCTGACAGCCTGGAGG + Intronic
979277196 4:118827645-118827667 GGAGACTCTGGCCAGCCTGGTGG + Intronic
985781191 5:1872670-1872692 TGGTGCTCCTGCCAGCCTGGAGG + Intergenic
986256569 5:6105826-6105848 GGAATCTCCTGCCAGCCATGTGG - Intergenic
988043576 5:25918614-25918636 CTTGTCTTCTGCTAGCCTGGGGG - Intergenic
992996856 5:82342977-82342999 TGTGTCTCCAGCCAGCCTCGTGG + Intronic
996849513 5:127936788-127936810 CGGGTCTCCCGGAAGCCTGGAGG - Intergenic
997356404 5:133265705-133265727 AGCATCTCCTGCCAGCCTGTGGG - Intronic
997613950 5:135233560-135233582 CCAATCTCCTGCCAGCCAGCAGG - Intronic
999151654 5:149430383-149430405 CCAGTCTCCTGCCAGAGGGGTGG - Intergenic
1000853303 5:166367502-166367524 TGCCTCTCCTGCCAGCCTGCAGG - Intergenic
1001293705 5:170484409-170484431 GGAGTCACCTGCCAGCCTCCTGG - Intronic
1002278906 5:178119692-178119714 CGGGGCTCCCGCCAGCCTGATGG + Exonic
1003547681 6:7074317-7074339 TGAGTCTCCTGACTCCCTGGTGG + Intergenic
1006072350 6:31506847-31506869 CCATCCTCCTGCTAGCCTGGAGG + Intronic
1012873496 6:104698583-104698605 TGAGTCTTTTGCCAGCTTGGGGG - Intergenic
1017159264 6:151350047-151350069 CGATTCTCCGGACAGCCAGGAGG + Exonic
1018256275 6:161923018-161923040 CAAGATGCCTGCCAGCCTGGAGG - Intronic
1018457529 6:163965053-163965075 AGAGTTTCCTGCCAGCCTGGCGG - Intergenic
1019592854 7:1844379-1844401 CAGGTCTCCCCCCAGCCTGGAGG - Intronic
1019685831 7:2381562-2381584 CCGGGCTCCTGCCACCCTGGAGG + Intergenic
1020061258 7:5154257-5154279 GGAGGCTCCTGACTGCCTGGTGG + Intergenic
1020166845 7:5814016-5814038 GGAGGCTCCTGACTGCCTGGTGG - Intergenic
1027148018 7:75711861-75711883 CCAGTCCCCTGCCAGTCTTGGGG + Intronic
1029051686 7:97696126-97696148 GGAGTCTCCACCCAGGCTGGAGG + Intergenic
1032125443 7:129189417-129189439 CGAGTCTCCGGCCAGCAGTGTGG - Exonic
1033613350 7:142987058-142987080 GGCTTCTCCTGACAGCCTGGAGG - Intergenic
1034400585 7:150859008-150859030 TGCTCCTCCTGCCAGCCTGGGGG - Exonic
1034418011 7:150975229-150975251 CGAGGCTGAGGCCAGCCTGGCGG + Intronic
1035205176 7:157290220-157290242 CGAGTCTCCATGCAGCCTTGAGG - Intergenic
1035268157 7:157703671-157703693 CAAGTTCCCGGCCAGCCTGGTGG + Intronic
1035446631 7:158947690-158947712 TGAGCCTCCTGCCTGGCTGGGGG + Intronic
1036798133 8:11770351-11770373 CACGTCTCCTTCCAGCCTGGCGG + Intronic
1037498968 8:19467578-19467600 CAAGTGGCCTGCCAGCCTCGCGG + Intronic
1038468271 8:27786981-27787003 CTAGTCTCCACCCAGCCTGCTGG - Intronic
1040386511 8:46918148-46918170 CGCCTCTCCCGCCAGCCTGCTGG - Intergenic
1045409939 8:101906770-101906792 GGACTTTCCTCCCAGCCTGGTGG + Intronic
1049092440 8:140526333-140526355 GCAGGCTCCTGCCAGCCTGAAGG + Intergenic
1050593592 9:7184081-7184103 GCAGTCTCCTGCCATCCTGATGG + Intergenic
1052857663 9:33417180-33417202 TGAGTCACCTGCCAACCTGTGGG + Intergenic
1053605273 9:39652060-39652082 CTATCCTCCTGCAAGCCTGGAGG + Intergenic
1053784862 9:41646485-41646507 CGAGGCTCCTGCTAGCCCCGCGG + Intergenic
1053863192 9:42408687-42408709 CTATCCTCCTGCAAGCCTGGAGG + Intergenic
1053900908 9:42794696-42794718 CTCCTCTCCTCCCAGCCTGGTGG - Intergenic
1054173586 9:61860430-61860452 CGAGGCTCCTGCTAGCCCCGCGG + Intergenic
1054248268 9:62690356-62690378 CTATCCTCCTGCAAGCCTGGAGG - Intergenic
1054260738 9:62862847-62862869 CTCCTCTCCTCCCAGCCTGGTGG + Intergenic
1054562383 9:66724881-66724903 CTATCCTCCTGCAAGCCTGGAGG - Intergenic
1054663954 9:67720351-67720373 CGAGGCTCCTGCTAGCCCCGCGG - Intergenic
1054798135 9:69321563-69321585 CCAGGCTCCTGGGAGCCTGGAGG + Intergenic
1056967884 9:91179561-91179583 CCTGGCTCCTGCCAACCTGGTGG + Intergenic
1057181459 9:93033016-93033038 CGAGTGTGTTCCCAGCCTGGGGG - Intronic
1059423652 9:114207531-114207553 CGACTTGCCTGCCAGGCTGGTGG + Intronic
1059608899 9:115870093-115870115 TGAGTCTCCTGCCAGCCTGCAGG + Intergenic
1059846398 9:118281965-118281987 GGAGACTTCTGCCAGCATGGTGG - Intergenic
1060198219 9:121636716-121636738 CCAGTCCCATGTCAGCCTGGAGG + Intronic
1060750124 9:126163299-126163321 CTGGTCTCCTGTCACCCTGGGGG - Intergenic
1061726708 9:132586032-132586054 AGAGCCTGGTGCCAGCCTGGAGG + Intronic
1061853346 9:133428800-133428822 CGAGCCTCCAGCCAGCCCGCTGG + Intronic
1061853394 9:133428956-133428978 CGAGCCTCCAGCCAGCCCGCTGG + Intronic
1062485656 9:136773989-136774011 CCTGTCTCCTGCCAGCCAGCAGG - Intergenic
1203773838 EBV:62126-62148 CGAGTCACTTTCCAGCGTGGTGG - Intergenic
1186600275 X:11029315-11029337 CAAGTCTCCTGCCAGAATGGGGG + Intergenic
1189387671 X:40550679-40550701 CGAGTCTCCTGCCTCCAGGGAGG - Intergenic
1190596875 X:52060203-52060225 AGAGTGTCCAGCAAGCCTGGAGG + Intergenic
1190611949 X:52193870-52193892 AGAGTGTCCAGCAAGCCTGGAGG - Intergenic
1193788139 X:85785387-85785409 CAAGTCTGCTGCTAGCCTGATGG - Intergenic
1198933156 X:141880775-141880797 CGGGTCACCTGCCATCCTAGGGG - Intronic
1200218993 X:154381364-154381386 TGAGTCTGCTGCCTCCCTGGTGG - Exonic