ID: 1157516608

View in Genome Browser
Species Human (GRCh38)
Location 18:48315862-48315884
Sequence GTATAATCAAGGCCATGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 123}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157516605_1157516608 4 Left 1157516605 18:48315835-48315857 CCTAAAGCATAACTCAACTGGAA 0: 1
1: 0
2: 2
3: 13
4: 192
Right 1157516608 18:48315862-48315884 GTATAATCAAGGCCATGGAGAGG 0: 1
1: 0
2: 1
3: 6
4: 123
1157516599_1157516608 12 Left 1157516599 18:48315827-48315849 CCCCTACCCCTAAAGCATAACTC 0: 1
1: 0
2: 2
3: 12
4: 120
Right 1157516608 18:48315862-48315884 GTATAATCAAGGCCATGGAGAGG 0: 1
1: 0
2: 1
3: 6
4: 123
1157516598_1157516608 13 Left 1157516598 18:48315826-48315848 CCCCCTACCCCTAAAGCATAACT 0: 1
1: 0
2: 0
3: 8
4: 106
Right 1157516608 18:48315862-48315884 GTATAATCAAGGCCATGGAGAGG 0: 1
1: 0
2: 1
3: 6
4: 123
1157516604_1157516608 5 Left 1157516604 18:48315834-48315856 CCCTAAAGCATAACTCAACTGGA 0: 1
1: 0
2: 0
3: 8
4: 115
Right 1157516608 18:48315862-48315884 GTATAATCAAGGCCATGGAGAGG 0: 1
1: 0
2: 1
3: 6
4: 123
1157516602_1157516608 6 Left 1157516602 18:48315833-48315855 CCCCTAAAGCATAACTCAACTGG 0: 1
1: 0
2: 0
3: 5
4: 96
Right 1157516608 18:48315862-48315884 GTATAATCAAGGCCATGGAGAGG 0: 1
1: 0
2: 1
3: 6
4: 123
1157516600_1157516608 11 Left 1157516600 18:48315828-48315850 CCCTACCCCTAAAGCATAACTCA 0: 1
1: 0
2: 0
3: 5
4: 111
Right 1157516608 18:48315862-48315884 GTATAATCAAGGCCATGGAGAGG 0: 1
1: 0
2: 1
3: 6
4: 123
1157516601_1157516608 10 Left 1157516601 18:48315829-48315851 CCTACCCCTAAAGCATAACTCAA 0: 1
1: 0
2: 0
3: 15
4: 117
Right 1157516608 18:48315862-48315884 GTATAATCAAGGCCATGGAGAGG 0: 1
1: 0
2: 1
3: 6
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157516608 Original CRISPR GTATAATCAAGGCCATGGAG AGG Intronic
901072790 1:6530949-6530971 GTAAAAGCAAGGCCAGGGACTGG - Intronic
901866681 1:12111134-12111156 GAATAAGCAAAGCCATGGAGCGG - Intronic
905117116 1:35651767-35651789 GTATAATCAATCCTAGGGAGAGG + Intergenic
906113411 1:43339289-43339311 GTATCATCAAGGCCATGGGTGGG + Exonic
906159015 1:43633854-43633876 GTAGAATCTAGGCCAGGGTGTGG + Intergenic
908329039 1:63052284-63052306 GGAAAATGATGGCCATGGAGGGG + Intergenic
910697506 1:90036117-90036139 GTATATTCCAGCCAATGGAGAGG + Intergenic
912161001 1:106985147-106985169 TTAGAATCAAGACAATGGAGTGG + Intergenic
912382741 1:109256002-109256024 GGGCAACCAAGGCCATGGAGCGG - Intronic
913998506 1:143672297-143672319 GTAAAATCCTGGCCATGGAATGG + Intergenic
914923710 1:151865299-151865321 GTAGAGTCAGGGCCATGAAGTGG - Intergenic
915559612 1:156678942-156678964 GTAGAATAGAGGCCAGGGAGGGG + Intergenic
916766014 1:167861516-167861538 GCATAAGCAAAGGCATGGAGAGG - Intronic
917169780 1:172158304-172158326 GTACAATGATGGGCATGGAGAGG + Intronic
918608891 1:186463907-186463929 GTAGAGTCAAGGCCATGAGGGGG - Intergenic
921195684 1:212755120-212755142 GTATAACCAATGTCAGGGAGAGG + Intronic
1063006707 10:1978708-1978730 GCATCATCAAGGCCATGCAGAGG - Intergenic
1063232637 10:4080795-4080817 GTAAAATCAGGGCGATGGGGTGG - Intergenic
1070677859 10:78424910-78424932 GTATAATTGAGGTCCTGGAGAGG + Intergenic
1071402110 10:85283569-85283591 GTATATTCAAGGAGATAGAGAGG + Intergenic
1073758341 10:106604735-106604757 GTATAGTCAAGGGCATGTATTGG - Intronic
1074572991 10:114641755-114641777 GTATGTTCAAGGCAGTGGAGAGG + Intronic
1078000071 11:7486689-7486711 GAATAATCAATGCCAGGGTGTGG - Intronic
1083991357 11:66247653-66247675 GAATAATTAATGCCAAGGAGTGG - Intergenic
1084765859 11:71307968-71307990 GTATAACCCAGACCCTGGAGAGG - Intergenic
1087796232 11:102456988-102457010 GTGTAATCAATGCTATGAAGTGG + Intronic
1090598450 11:128344479-128344501 GTATATGAAAGCCCATGGAGGGG + Intergenic
1090752720 11:129761512-129761534 GTACAGTCTAGGCCTTGGAGTGG + Intergenic
1092048697 12:5452394-5452416 GAATAATTAAAGACATGGAGAGG - Intronic
1092852858 12:12646724-12646746 GTGTAATCAAGTCCATGGGCTGG + Intergenic
1094535668 12:31320598-31320620 GTATATTTAAGGGCATGGAATGG + Intronic
1101712952 12:107285762-107285784 GCATAATCAAGGAGATGGATGGG + Intergenic
1101719334 12:107337603-107337625 AGATACTCAAGGCCATGCAGTGG + Intronic
1106196884 13:27501716-27501738 CAATAATCAATGTCATGGAGTGG - Intergenic
1107813557 13:44223041-44223063 GTGAAAACAAGGCCATGGATTGG - Intergenic
1110763283 13:79253685-79253707 GGGTAATGAAGGCTATGGAGGGG - Intergenic
1112471934 13:99697198-99697220 GTATAATCAAAGTCTTGGAAGGG + Intronic
1113520744 13:110938791-110938813 GTATGAGCAAAGCCATGGTGGGG + Intergenic
1116249620 14:42464269-42464291 TAAGATTCAAGGCCATGGAGGGG + Intergenic
1118912183 14:70070733-70070755 GCATAAAAAAGGCCATGGAGAGG + Intronic
1121163533 14:91769320-91769342 GTATAATCCAGGCCACGGTGCGG - Intronic
1122025676 14:98874030-98874052 GTATAAGCAGGTCCAAGGAGTGG - Intergenic
1124524203 15:30433714-30433736 GTATAATAAAGGCCTTGGCCGGG + Intergenic
1124534463 15:30532502-30532524 GTATAATAAAGGCCTTGGCCGGG - Intergenic
1124764185 15:32475097-32475119 GTATAATAAAGGCCTTGGCCGGG + Intergenic
1125454794 15:39846020-39846042 GTATAATCAAAGCCACTGAAGGG + Intronic
1125964375 15:43861777-43861799 GTATAATCAAAGAAATGAAGTGG - Intronic
1126797062 15:52267928-52267950 GTATAATGTACTCCATGGAGAGG - Intronic
1127206217 15:56722072-56722094 GAATAAGGAAGCCCATGGAGAGG + Intronic
1127634103 15:60852746-60852768 GTATCATCAAGGACAAGGACTGG + Intronic
1128111599 15:65079659-65079681 GTCTTCCCAAGGCCATGGAGAGG - Intergenic
1128608367 15:69055183-69055205 GTGTAACCAGTGCCATGGAGAGG - Intronic
1129324652 15:74793732-74793754 TTATAATCAAGGCAGTGGGGAGG + Intronic
1131238360 15:90716928-90716950 GTATTATTAAGGGGATGGAGAGG + Intergenic
1132057057 15:98660315-98660337 GCAGAATCAAGGCCAGAGAGAGG - Intronic
1132162200 15:99552829-99552851 GTATAATCGGGGCCAGGGAATGG - Intergenic
1132422172 15:101679906-101679928 GTGCAGTAAAGGCCATGGAGGGG - Intronic
1138215450 16:55200984-55201006 GTATATTCATTGACATGGAGAGG + Intergenic
1138358825 16:56408802-56408824 GGAAAAACAAGGCCCTGGAGCGG + Intronic
1144466132 17:15499167-15499189 GTTTAATCAAGGACAGGGACCGG - Intronic
1147749905 17:42724430-42724452 ATATAAGCAATGACATGGAGAGG + Intronic
1148347103 17:46910652-46910674 GAACAATCAAGGCAAGGGAGTGG + Intergenic
1153944818 18:10009343-10009365 CCATAAGCAAGGCCAAGGAGGGG + Intergenic
1156522300 18:37732007-37732029 GTGTGAGCAAGGCCTTGGAGTGG - Intergenic
1157516608 18:48315862-48315884 GTATAATCAAGGCCATGGAGAGG + Intronic
1158121300 18:54051163-54051185 AAATAATAAATGCCATGGAGGGG - Intergenic
1158150381 18:54361229-54361251 GTATAATCCATGCCATTGAAGGG + Intronic
1161226446 19:3148720-3148742 CCATGATCGAGGCCATGGAGCGG + Exonic
1162394477 19:10408920-10408942 GAATATTCAGGGCCATGGTGTGG + Intronic
1163685460 19:18709576-18709598 GTCTGAGCAAGGCCATGGATGGG + Intronic
927875609 2:26653396-26653418 GGAGAATCAGGGCCATGCAGGGG - Intergenic
933387500 2:81629894-81629916 TTTTAAGAAAGGCCATGGAGAGG + Intergenic
937478927 2:122239519-122239541 GTTTAATCAGGGTCATGGCGTGG + Intergenic
937561300 2:123227526-123227548 GTATAATGTAGGCTATGGATTGG + Intergenic
939057991 2:137385602-137385624 GTATATCTTAGGCCATGGAGTGG + Intronic
939852158 2:147315806-147315828 CTCTAATCAAGGAGATGGAGAGG + Intergenic
942173664 2:173310643-173310665 GTGTAATCAAGGCCAGGGAGAGG + Intergenic
945020195 2:205563247-205563269 GAACAATCAAGGCAAGGGAGAGG + Intronic
948896642 2:240930795-240930817 GAACAATCAATGCCATGCAGTGG + Intronic
1170871054 20:20206945-20206967 GTCAAATCAAGGCCATTGAAGGG + Intronic
1172925600 20:38531728-38531750 GTATAGGCAAGACAATGGAGGGG + Intronic
1176884141 21:14233986-14234008 ATATTCTCAAGGCGATGGAGTGG - Intergenic
1181331831 22:22098754-22098776 GCATCATCCAGGCCATGGTGGGG - Intergenic
1185045844 22:48528383-48528405 GTATAGCCAAGGCCATAGTGAGG + Intronic
950074537 3:10177871-10177893 GGAAGATCAAGTCCATGGAGCGG + Exonic
952176680 3:30871341-30871363 CAATAATCCAGGCCAGGGAGAGG + Intronic
953939244 3:47076749-47076771 GTATGTTCAAGGACATGAAGAGG + Intronic
954670229 3:52287164-52287186 GTGGAATAAAAGCCATGGAGAGG + Intronic
956901740 3:73723589-73723611 GTAGAATCAAGCCAATGGTGTGG - Intergenic
967811249 3:193762769-193762791 CTTTCATCAAGGCCATTGAGGGG + Intergenic
971214610 4:24651521-24651543 ATATAATCATGGACTTGGAGGGG + Intergenic
976896861 4:90123394-90123416 GGATAATAGAGGACATGGAGAGG - Intergenic
978027777 4:103898790-103898812 ATATAATCAAGGTAAAGGAGTGG + Intergenic
979094986 4:116536611-116536633 GAATAATCAAGGATATGGTGAGG - Intergenic
979220421 4:118217185-118217207 GTATAAACGAAGCCGTGGAGAGG + Intronic
981722703 4:147817461-147817483 GTAGAATCAAGGACAAGCAGTGG + Intronic
988980925 5:36568422-36568444 GTTTTATTCAGGCCATGGAGTGG - Intergenic
989305260 5:39947849-39947871 GTAGAAACAAGGCCATGGGCAGG - Intergenic
989471204 5:41820846-41820868 GCATAAACAAGGCCAAGAAGTGG + Intronic
990815885 5:59784440-59784462 ATATAATGAAGGGCATGGTGTGG + Intronic
991728239 5:69558696-69558718 ATAAAATAAAGGCAATGGAGGGG + Intergenic
991866716 5:71069179-71069201 ATAAAATAAAGGCAATGGAGGGG - Intergenic
992389305 5:76315599-76315621 GTATAAACCAGCCCTTGGAGGGG + Intronic
992747994 5:79837751-79837773 GAAGAATCAAAGCCCTGGAGAGG + Intergenic
997403182 5:133618363-133618385 GTGTAAGGAAAGCCATGGAGGGG + Intergenic
1000574715 5:162964039-162964061 GTATAATGAAGGCATTAGAGTGG + Intergenic
1003527323 6:6909207-6909229 GGAAAATCAAGGCCATGAATGGG + Intergenic
1011309711 6:85968467-85968489 GTAGAAAGAAGGGCATGGAGAGG - Intergenic
1012985789 6:105875105-105875127 AGAGAATCAAGGGCATGGAGGGG + Intergenic
1013616940 6:111852015-111852037 GTATGATCCAGCCCATAGAGTGG + Intronic
1017221034 6:151966183-151966205 GTATCTTCAAAGCCATGAAGGGG - Intronic
1019904664 7:4052799-4052821 GAATAATTAGGGCCATGCAGTGG + Intronic
1021561353 7:21971796-21971818 GCAGAAACAAGGCCCTGGAGAGG + Intergenic
1022568664 7:31429442-31429464 GTAGAAACAAGGTTATGGAGTGG - Intergenic
1033436308 7:141336448-141336470 GAATGACCAAGGCCATGCAGTGG - Intronic
1033454066 7:141486633-141486655 GTAGCTTAAAGGCCATGGAGGGG - Intergenic
1042581023 8:70279359-70279381 GTACAATCAATGGCATAGAGTGG + Intronic
1046348534 8:112971189-112971211 ATACAATCAATGCCATAGAGCGG - Intronic
1053537140 9:38937370-38937392 TTATAACCAAGGGCATGGTGGGG + Intergenic
1054628995 9:67426560-67426582 TTATAACCAAGGGCATGGTGGGG - Intergenic
1054692687 9:68330621-68330643 AAATAATCACGGACATGGAGTGG + Intronic
1054760452 9:68999904-68999926 CTACAATCAAGTACATGGAGTGG - Intronic
1054976797 9:71156176-71156198 GTTTAAGAAAGGCCATTGAGTGG + Intronic
1057546566 9:96023174-96023196 GTCTTATCTAGGCCATGGAGTGG - Intergenic
1058621858 9:106891689-106891711 CTATAATCAAGGGTGTGGAGAGG - Intronic
1058950748 9:109901663-109901685 GTATAATAAAGGCCGTTGTGAGG + Intronic
1061516726 9:131094420-131094442 GTAAAATCAAGGCTACGGTGGGG + Intronic
1062489531 9:136798620-136798642 GGACAATCCAGGACATGGAGGGG + Intronic
1185531581 X:823427-823449 CTAAACTCAAGGACATGGAGAGG - Intergenic
1186541918 X:10409702-10409724 GTATATTCACAGCCATAGAGTGG + Intergenic
1196007178 X:110849396-110849418 GTAAAATGAAGGCCCTGGAAAGG + Intergenic