ID: 1157521722

View in Genome Browser
Species Human (GRCh38)
Location 18:48349933-48349955
Sequence CCCTGTTTATGAAGGGCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 156}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157521722_1157521729 16 Left 1157521722 18:48349933-48349955 CCACCTGCCCTTCATAAACAGGG 0: 1
1: 0
2: 3
3: 17
4: 156
Right 1157521729 18:48349972-48349994 TGACAGTCTGCTGCACTGCACGG 0: 1
1: 0
2: 0
3: 14
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157521722 Original CRISPR CCCTGTTTATGAAGGGCAGG TGG (reversed) Intronic
900437078 1:2635839-2635861 CCCTGGGTATCCAGGGCAGGAGG + Intergenic
901098770 1:6703058-6703080 ACCTGCTTATGAAGGGCAACGGG - Intergenic
903275987 1:22222230-22222252 CCCTGGTTATGACGGGGTGGGGG - Intergenic
904808763 1:33149956-33149978 CCATGTTTGTGTTGGGCAGGTGG + Intronic
905912827 1:41665313-41665335 CCATGTATCTGAAAGGCAGGTGG + Intronic
907633442 1:56107523-56107545 ACCTGGTCATGAAGGGAAGGAGG + Intergenic
912703908 1:111897954-111897976 CCGTGTTTATGGAAGGAAGGTGG - Intronic
913717148 1:121547760-121547782 GCCTGTTGAGGGAGGGCAGGGGG - Intergenic
915230062 1:154438845-154438867 CCTTGTTCATCAAGGACAGGAGG + Intronic
918088990 1:181271525-181271547 TCCTGTTTTTCAAGGGCGGGAGG - Intergenic
922701951 1:227766341-227766363 CTCTGTAAATAAAGGGCAGGTGG + Intronic
1064504239 10:16011756-16011778 CCACATTTATGAAGGGCAGGAGG + Intergenic
1066389690 10:34968898-34968920 TCCTGTCTCTGAAGAGCAGGAGG + Intergenic
1069743635 10:70701035-70701057 GCCTGTTTATGAAGCACAGAAGG + Intronic
1069780356 10:70951552-70951574 CCTTATTTATGGAGGGCAGAGGG - Intergenic
1070949154 10:80417074-80417096 CCTGGTTTAGGAAGGGGAGGGGG + Intronic
1072307321 10:94120179-94120201 CCAAGTTTAGGCAGGGCAGGAGG - Intronic
1074731189 10:116377433-116377455 CCCTCTTAATGAAGGAAAGGGGG - Intronic
1076629663 10:131844664-131844686 CCCTGGCTAAGATGGGCAGGTGG + Intergenic
1077037696 11:503250-503272 CCGTCTTTCTGAAGGGCAGCTGG - Exonic
1078095050 11:8291689-8291711 CCCTGTTTCCGGAGGGCAGGTGG + Intergenic
1080299839 11:30771766-30771788 CACTGTTTCAGAAGGGGAGGCGG - Intergenic
1082976812 11:59080821-59080843 CCGTGTTTATGGTGTGCAGGGGG - Intergenic
1083630440 11:64092412-64092434 CCCTGCCTATGGAGGGCTGGTGG + Intronic
1084361488 11:68670844-68670866 ACCTGGTTCTGAGGGGCAGGGGG - Intergenic
1084457611 11:69277599-69277621 GCCGGTTGATGCAGGGCAGGTGG + Intergenic
1084502275 11:69541829-69541851 TCCTGCTTATGATGGGCAGTGGG + Intergenic
1085526209 11:77165819-77165841 GCCTGTTCAAGAAGGGCAGGGGG - Intronic
1085715820 11:78872333-78872355 GCCTGACTATGAAGGGCAGATGG - Intronic
1088298430 11:108327571-108327593 CCCCGTACATGAAGGGCAGTTGG + Intronic
1088976126 11:114817922-114817944 CCCTGTTCATGCAGGACAGCAGG - Intergenic
1089125778 11:116175540-116175562 CCCAGTTTATGGAGGACATGAGG + Intergenic
1092984451 12:13831994-13832016 CCCTGGTGGTGAAGGGCAGTGGG + Intronic
1093289692 12:17304568-17304590 TCCTGTTTCTGAAGAGAAGGAGG + Intergenic
1094320435 12:29176982-29177004 CCCAGTTGATGATGGACAGGAGG - Intronic
1098782655 12:74706450-74706472 CCCCATTTATGAAGGGCGAGAGG - Intergenic
1099936234 12:89129102-89129124 TCCTATGTATGAATGGCAGGTGG - Intergenic
1100724798 12:97397096-97397118 CCCTGCATAGGAAGGGGAGGGGG - Intergenic
1101026207 12:100609208-100609230 TCCTGTTTGAGAAAGGCAGGGGG - Intronic
1102819735 12:115897475-115897497 CCCTGATTCTGGAGGCCAGGTGG + Intergenic
1103898365 12:124289578-124289600 CCCTGTCTTAGTAGGGCAGGTGG + Intronic
1104525333 12:129515681-129515703 CCCTATATCTGAAGGCCAGGGGG + Intronic
1105822586 13:24093119-24093141 GCCTGTTTATTAGGGTCAGGTGG - Intronic
1106087008 13:26551692-26551714 CCCAGGTGAGGAAGGGCAGGAGG + Intergenic
1107896649 13:44971424-44971446 CTCTTTTTATGTAGGACAGGTGG - Intronic
1118617499 14:67584517-67584539 ACCTCTGTATGAAGGCCAGGTGG + Intronic
1122354867 14:101116845-101116867 CCCTGCTCCTGGAGGGCAGGTGG - Intergenic
1123071406 14:105644255-105644277 CCCTGTGTGTGAAGGGCCTGGGG + Intergenic
1123096836 14:105770871-105770893 CCCTGTGTGTGAAGGGCCTGGGG + Intergenic
1124655476 15:31503484-31503506 CCCTGCCTATCAACGGCAGGTGG - Intronic
1125809430 15:42524961-42524983 GCGTGTTTATGAAGGGGTGGTGG - Intronic
1126670402 15:51110695-51110717 CACTGCTTGTGCAGGGCAGGTGG - Intergenic
1127319025 15:57824720-57824742 CCCTGCTTCAGAAGGGCAGCTGG - Intergenic
1128175716 15:65553986-65554008 CGCAGCTTATGAAGGACAGGTGG - Intronic
1132612324 16:823483-823505 CCCTGTGTATCACGGGCAGAAGG + Intergenic
1133054490 16:3138750-3138772 CCCTCTTTAAGAAGAGCAGGAGG - Exonic
1135094721 16:19555623-19555645 CCATGTTTGTGAAGGGCAGCTGG - Exonic
1140106340 16:71963964-71963986 CCCTGATGATGAAAGGCAGATGG - Intronic
1142945815 17:3426118-3426140 CCCTTTGAATGAAGGGGAGGTGG - Intergenic
1143353590 17:6307746-6307768 CCTAGTTGATGAAGTGCAGGTGG - Intergenic
1144172118 17:12667950-12667972 CCCTGTTTATCAATGACGGGAGG - Intronic
1144698764 17:17323099-17323121 CCCTGTGAAGGCAGGGCAGGTGG + Intronic
1148111497 17:45147127-45147149 CCCTGTTTATGGAGGGCTGGGGG + Intergenic
1149309785 17:55382771-55382793 CCTTGGTTATGAAGGGAAAGAGG - Intergenic
1152060996 17:78075017-78075039 CCCTGTGTTTGAAGGGGTGGAGG + Intronic
1152152250 17:78609439-78609461 CCCCGTTCACAAAGGGCAGGGGG - Intergenic
1157521722 18:48349933-48349955 CCCTGTTTATGAAGGGCAGGTGG - Intronic
1157858538 18:51121757-51121779 CCCTGTTACTGAAAGGCTGGGGG + Intergenic
1161513800 19:4685469-4685491 CCCTGTGTAGTCAGGGCAGGCGG + Intronic
1162393584 19:10403910-10403932 CCCCGTTTACGAAGGGCAGGGGG - Intronic
1167231442 19:48286867-48286889 CCCTGTGAATGAAAGGAAGGTGG + Exonic
1167649648 19:50722385-50722407 TCCTGCTTATGATGGGAAGGTGG + Intergenic
1168133922 19:54338020-54338042 CCCTGTTGCTGAAGGTCAGGGGG + Exonic
1168561363 19:57386504-57386526 TCCTGTTTATGAAAGCCAGTTGG - Intronic
925314278 2:2909277-2909299 GCCTTTTCATGAAGTGCAGGAGG - Intergenic
932712607 2:74079040-74079062 CCAAGTTTCTGAAGGGCTGGCGG - Intronic
934040499 2:88124236-88124258 CCCTGGGCATGCAGGGCAGGTGG + Intronic
936386275 2:112032418-112032440 CCCTGTGTAAGAAGGGGAGGAGG + Intergenic
936779210 2:116011887-116011909 GCCTGTTGGGGAAGGGCAGGTGG + Intergenic
938550942 2:132381963-132381985 CCTTCTTTATGAAAGGCAGGAGG - Intergenic
938670226 2:133579515-133579537 CCCTTCTTTTGCAGGGCAGGAGG + Intergenic
942076363 2:172360190-172360212 CAGGGTGTATGAAGGGCAGGGGG - Intergenic
944637607 2:201689924-201689946 CCCTGTTTATGAAGGGCAAATGG + Intronic
946434761 2:219644175-219644197 CGTAGTTTAGGAAGGGCAGGAGG + Intergenic
947971286 2:234327548-234327570 CCATGAGCATGAAGGGCAGGGGG + Intergenic
948000001 2:234559986-234560008 CCGTGTGTGTGAAGGCCAGGGGG + Intergenic
948091125 2:235296657-235296679 CCCTGTTCACGAAGGCCATGGGG - Intergenic
948692232 2:239713521-239713543 CCCTGTCTACACAGGGCAGGAGG + Intergenic
1169310976 20:4539679-4539701 CCCAGTTGAGGAAGGGCGGGAGG - Intergenic
1170666710 20:18392992-18393014 CCCCATGTAAGAAGGGCAGGAGG + Intronic
1173666943 20:44769751-44769773 CCCAGTTTAGGAGGGGCTGGGGG + Intronic
1175494225 20:59403064-59403086 CCCTTTTTCTAAAGAGCAGGAGG - Intergenic
1176653006 21:9566874-9566896 CCCTGATTATTAGGGGCTGGAGG + Intergenic
1178336485 21:31748345-31748367 CTCTGTTTAAGAAGGCAAGGCGG + Intergenic
1181472364 22:23148567-23148589 CCCTGACTATTATGGGCAGGAGG - Intronic
1184786019 22:46672383-46672405 CCCAGTTGAAGAAGGGCAGGTGG + Intronic
949153490 3:799406-799428 CCCTGGTTCTGAATGGGAGGGGG + Intergenic
950437863 3:12991538-12991560 GCCTAATTATGAGGGGCAGGGGG + Intronic
952441231 3:33331469-33331491 CTCTGTTTAAGAAGAACAGGGGG - Intronic
953203352 3:40797835-40797857 CCCTGTTTCTGAGTAGCAGGAGG + Intergenic
955494580 3:59518485-59518507 CTCTGTTTATCAAGGGCCAGAGG - Intergenic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
963042436 3:141079580-141079602 CAGTGTTTATGAAGGGCCTGTGG + Intronic
965103687 3:164334117-164334139 CCTGGTTTAGGAAGGGGAGGGGG + Intergenic
965162523 3:165152588-165152610 GCCTGTTGAGGGAGGGCAGGGGG - Intergenic
965427673 3:168547233-168547255 CCATGTTTGTGAAGGGAAAGTGG + Intergenic
966977546 3:185098777-185098799 CCCACATTATGAAGGGCAGTTGG - Intronic
967830918 3:193919587-193919609 TGCTGTTTATGAAGGGGATGTGG - Intergenic
969399951 4:6947938-6947960 CCCTGCATTTGTAGGGCAGGCGG - Intronic
972618081 4:40719391-40719413 CTCTGTTTTTGAGGGGCAGGGGG + Intergenic
976316751 4:83666860-83666882 CTCTGTTTATGAATGGAAGTGGG + Intergenic
979559749 4:122088760-122088782 ACCAGTTTTTGGAGGGCAGGGGG - Intergenic
985989097 5:3540274-3540296 CCAAGTTTATGAATGGAAGGAGG - Intergenic
986423416 5:7606983-7607005 CCCTGCATGTGCAGGGCAGGTGG - Intronic
988681448 5:33488245-33488267 CCCTGCTTGGGAAGTGCAGGAGG + Intergenic
989603958 5:43226298-43226320 CCCTGTTAAAGGTGGGCAGGAGG + Intronic
993275399 5:85850501-85850523 CTGTGGTTATGCAGGGCAGGGGG + Intergenic
995525440 5:113047043-113047065 GCCTGTTGAAGAGGGGCAGGTGG - Intronic
996347788 5:122506073-122506095 CCCTGTTTATGGAGGGAAGATGG - Intergenic
998227742 5:140339936-140339958 CCCTGAGTAGCAAGGGCAGGAGG + Intronic
999707493 5:154286872-154286894 CACTATTTATGAATGGAAGGAGG - Intronic
1000925416 5:167187804-167187826 CCCTCTTTATAATGGGAAGGAGG - Intergenic
1002182949 5:177441003-177441025 CCCTTTTTAGGAGGTGCAGGTGG - Exonic
1003623273 6:7721024-7721046 CCCTGGTTTTGAAGGGGAAGAGG - Intergenic
1005681669 6:28215135-28215157 CCATGTTTTAGAAGGGGAGGGGG - Intergenic
1005827327 6:29641882-29641904 CACTGTTAGTGAAGGGCAGAAGG - Intergenic
1006116219 6:31777409-31777431 CCCTGGTTCTGGAGGGCAGAGGG - Intergenic
1007658714 6:43469120-43469142 CCCTGTTTATTGGGGGCATGTGG - Intergenic
1008876381 6:56334201-56334223 CCATGTTTCTGGAGGGCAGATGG - Intronic
1010126172 6:72434491-72434513 CACTGTTTATGACCAGCAGGTGG + Intergenic
1014334315 6:120113422-120113444 CCCTGGTTACGAAGGGCCAGGGG + Intergenic
1015149762 6:130023741-130023763 CCAGCTTTATGAAGGGCTGGAGG + Intronic
1015294128 6:131571001-131571023 CCCTATTTAGGAAAGGCAGAGGG + Intergenic
1016841919 6:148533509-148533531 CCCTGGTTCTGCAGGGCAGGAGG + Intronic
1019612820 7:1945580-1945602 CCCTGGAGATGAAGGGAAGGAGG + Intronic
1023008908 7:35907711-35907733 CCCTGATTAAGAGGGGCAGCTGG + Intergenic
1023016964 7:35978232-35978254 CCCTGATTAAGAGGGGCAGCTGG + Intergenic
1023279154 7:38552262-38552284 CTCTGTTTCTGAAGTGCAGGGGG - Intronic
1023656922 7:42432644-42432666 CCTTGTGTATGTATGGCAGGGGG - Intergenic
1023960461 7:44922068-44922090 CCCTGGTGAGGAAGGGGAGGAGG - Intergenic
1024811084 7:53213143-53213165 CCCTGTTTCTGAAAGCCAGTGGG + Intergenic
1028684747 7:93578842-93578864 TCCTGTTTCTGAAAGACAGGTGG - Intergenic
1029431429 7:100533464-100533486 CCCTGATTATGAAGGGAAAATGG + Intergenic
1030997791 7:116379392-116379414 CACTGATTATTATGGGCAGGAGG - Intronic
1031033608 7:116762819-116762841 CACAGTTTATGCTGGGCAGGTGG + Intronic
1031495330 7:122440213-122440235 ACCTGTCAATGGAGGGCAGGAGG + Intronic
1032419727 7:131768495-131768517 TCCTGTTTATGAAGCTCAGCTGG + Intergenic
1035472775 7:159120747-159120769 CCCTATTTATGACGGGTAAGAGG + Intronic
1037586736 8:20281985-20282007 GCCTGTTTCTGAAGGTCAGGGGG - Intronic
1041513395 8:58675249-58675271 TTCTGTTTCTGAAGGGCAGGAGG + Intergenic
1042239897 8:66653021-66653043 CCCTGTTTATGAATGTGAGGTGG - Intronic
1042913604 8:73852096-73852118 GTCTGTTTATGAAGGGTTGGAGG + Intronic
1046970987 8:120223168-120223190 CCCAGATTATGAAGGCCAAGAGG + Intronic
1047480612 8:125278515-125278537 CCCTGAGTGTGAAGGGCAAGTGG - Intronic
1048923654 8:139252190-139252212 CCCTATACATGAAGGGCCGGGGG - Intergenic
1049064310 8:140300976-140300998 CCTTGTGTATAAAGTGCAGGTGG + Intronic
1049360101 8:142208398-142208420 CCCTGATTATCAAGGATAGGAGG + Intergenic
1054856615 9:69907105-69907127 CCCTGTTCTTGCATGGCAGGAGG + Intergenic
1056104441 9:83332999-83333021 ACCTGTGTATGAAGGGGTGGTGG + Intronic
1056779560 9:89539071-89539093 ACCTGGTAATGAAAGGCAGGTGG + Intergenic
1058447057 9:105063920-105063942 CTTTGTTTATGAAGGGAATGGGG - Intergenic
1058704591 9:107627927-107627949 CCCTGCTGAGGGAGGGCAGGAGG + Intergenic
1059528888 9:115017809-115017831 CCCTGGCTATCAAGGGGAGGAGG + Intergenic
1061405500 9:130391244-130391266 CCATGTCTTGGAAGGGCAGGAGG + Intronic
1062298677 9:135850844-135850866 CCGTGTTTGTAAAGGGCAGGGGG + Intronic
1203630735 Un_KI270750v1:70415-70437 CCCTGATTATTAGGGGCTGGAGG + Intergenic
1185616698 X:1426371-1426393 TCCTGATGATGAATGGCAGGAGG + Intronic
1187519650 X:20002215-20002237 CCATGTTTATGAAGTGAATGTGG + Intergenic
1192420252 X:71023018-71023040 CCCTGTCTCAGAAGGACAGGAGG + Intergenic
1193504962 X:82330685-82330707 TCCTGTTTATGAAAAGCAGAGGG - Intergenic
1196944942 X:120814517-120814539 CCAGGTTTAGGAAGGGGAGGGGG - Intergenic
1197879100 X:131146158-131146180 GACAGTTTATAAAGGGCAGGAGG + Intergenic
1198053796 X:132974548-132974570 CCCTAGCAATGAAGGGCAGGGGG - Intergenic
1198092568 X:133346164-133346186 CCCTTTTTCTGCATGGCAGGAGG - Intronic
1198130010 X:133684332-133684354 CTCTGCTTATGAAAGGCTGGTGG - Intronic
1199814868 X:151388334-151388356 CCTTGTTCCTGGAGGGCAGGGGG + Intergenic
1200932816 Y:8712413-8712435 TCCTGTTTCTGAAGAGAAGGAGG + Intergenic