ID: 1157522857

View in Genome Browser
Species Human (GRCh38)
Location 18:48357210-48357232
Sequence GCCACCTGCAGAATAGGTCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 73}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157522848_1157522857 22 Left 1157522848 18:48357165-48357187 CCCAGAGGGGTGAGAGAACATAT 0: 1
1: 0
2: 0
3: 14
4: 195
Right 1157522857 18:48357210-48357232 GCCACCTGCAGAATAGGTCGGGG 0: 1
1: 0
2: 0
3: 3
4: 73
1157522849_1157522857 21 Left 1157522849 18:48357166-48357188 CCAGAGGGGTGAGAGAACATATA 0: 1
1: 0
2: 2
3: 4
4: 142
Right 1157522857 18:48357210-48357232 GCCACCTGCAGAATAGGTCGGGG 0: 1
1: 0
2: 0
3: 3
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157522857 Original CRISPR GCCACCTGCAGAATAGGTCG GGG Intronic
901378177 1:8854698-8854720 GCAACCTGCAGAAGAGGCCATGG + Intergenic
901781797 1:11599149-11599171 GCCTCCTGCAGAGAAGGTCCAGG + Intergenic
903050039 1:20593912-20593934 GCCAGGTGCAGAATAGGGGGTGG + Intronic
903653602 1:24935456-24935478 CCCACCTGCAGAACAGGGTGGGG - Intronic
916445275 1:164866321-164866343 GCAACCTGCAGAAGAGGCTGTGG + Intronic
922744588 1:228037030-228037052 GGCACCTGCCAGATAGGTCGGGG + Intronic
1065920990 10:30392662-30392684 GCCACCTGCAGGTTATGTGGGGG - Intergenic
1067067478 10:43112088-43112110 GCCACCTGCAGATGTGGCCGAGG + Exonic
1067286148 10:44908835-44908857 GCCTCCTGCGGAAAAGGACGTGG + Intergenic
1067290144 10:44934302-44934324 GACACTAGCAGAAAAGGTCGTGG - Intronic
1071565951 10:86671360-86671382 GCCACCTGCAGGCTGGGTGGTGG + Intronic
1075087564 10:119423634-119423656 GCCACCTGCAGACAAGGTGATGG - Intronic
1075399515 10:122150886-122150908 GCCACCTTCCGAATAGTCCGTGG - Intronic
1084243638 11:67840263-67840285 GCCACCTGCAAATAAGGTGGGGG - Intergenic
1085297449 11:75439105-75439127 CCCACCTGCAGAAACGGCCGTGG + Intronic
1091356774 11:134943694-134943716 GAGACCTGCAGAATGGGGCGGGG - Intergenic
1091813360 12:3418168-3418190 GCCAAGTGCAGAAGAGTTCGAGG + Intronic
1097084051 12:56454480-56454502 GCCACCTGCAGAACATGCAGGGG + Exonic
1106241701 13:27918314-27918336 GCCACCTGCAGTTTTGGTGGGGG - Intergenic
1109075090 13:57824064-57824086 GCCACCTGCAGCATGGCTGGGGG - Intergenic
1109932678 13:69235754-69235776 GCCACCTGGAGAACAAGTAGAGG - Intergenic
1113987342 13:114328789-114328811 GCCACCTGGAGCAAAGGTCTAGG - Intergenic
1121563136 14:94888843-94888865 CTCACTTGCAGAATAGGCCGGGG - Intergenic
1129747587 15:78035442-78035464 TCCACCTGCTGAAGAGGTTGTGG - Intronic
1130779073 15:87015903-87015925 GCCAACTGCAGAGTAGAGCGTGG + Intronic
1133355376 16:5132592-5132614 GCCACCTGCAGATAAGGTGGGGG - Intergenic
1137539117 16:49349915-49349937 TCCACCTGCAGACAAGGTCAGGG - Intergenic
1145925565 17:28644624-28644646 GGCACCTGCAGCATCGGTCTGGG - Intronic
1147912310 17:43862965-43862987 GCCCCCTGGAGAAGGGGTCGGGG + Exonic
1151489648 17:74425159-74425181 GCCACCAGCAGAATAGGGATGGG + Intronic
1152570543 17:81119576-81119598 ACCACCTGCAGCCCAGGTCGCGG + Exonic
1152938462 17:83153745-83153767 CACACCTGCAGCATAGGTTGGGG - Intergenic
1157522857 18:48357210-48357232 GCCACCTGCAGAATAGGTCGGGG + Intronic
1161579929 19:5075169-5075191 GCCACTTGCAGAGTGGGTGGTGG + Intronic
1163890419 19:20007744-20007766 GCCACCTGGAGAATAGGCAGAGG + Intronic
1164994143 19:32707315-32707337 GCCACCTGCAGAATGATTAGGGG + Intronic
940285526 2:152029590-152029612 ACCACCTGCAGATTAGGAAGAGG + Intronic
948382254 2:237558967-237558989 GCCACCTGCTGAACCGGCCGAGG - Intergenic
948875689 2:240826421-240826443 TCCAGCTGCAGAAGAGGTCATGG - Intergenic
1178168014 21:30004340-30004362 GCCACCTGCAGAATGTGCCAAGG + Intergenic
950261534 3:11545835-11545857 GCCTCCTGCAGAAGAAGTGGGGG + Intronic
954289581 3:49642588-49642610 GCCACCTGCAGGAGAGGCCCCGG + Exonic
957059221 3:75468248-75468270 GCCACCTGCAAATAAGGTGGGGG - Intergenic
957129046 3:76199653-76199675 GCCAACTGCTGAATAGCTTGTGG - Intronic
961294235 3:125871476-125871498 GCCACCTGCAAATAAGGTGGGGG + Intergenic
961891733 3:130135992-130136014 GCCACCTGCAAATAAGGTGGGGG - Intergenic
964828865 3:160860780-160860802 GCCACCTGCAAAGTAGGAAGAGG - Intronic
966876301 3:184323776-184323798 GCACCCTGCGGAATAGGTCCTGG - Exonic
969750900 4:9110097-9110119 GCCACCTGCAAATAAGGTGGGGG + Intergenic
972365774 4:38373079-38373101 GAGAGCTGCAGAATAGGTCAGGG - Intergenic
976266462 4:83190146-83190168 GGAACCTGCAGAATAGATCCTGG - Intergenic
989128207 5:38077559-38077581 GCCAATTGTAGAACAGGTCGTGG - Intergenic
999503081 5:152166165-152166187 GCCACTTCCAGATTAGGTTGGGG - Intergenic
1001844554 5:174910381-174910403 GCCACCTGCAGGTTATGTGGGGG - Intergenic
1018272558 6:162095958-162095980 TCCATCTGCAGAAGAGGTCTTGG + Intronic
1019580530 7:1759703-1759725 GCCACCTGCCGAGTGGGTGGGGG + Intergenic
1019667823 7:2261028-2261050 GCCACCTGCTGAAGAGGGAGTGG + Intronic
1019827744 7:3298717-3298739 GCTACCTGCAAAATAAGTCATGG + Intergenic
1020322073 7:6946542-6946564 GCCACCTGCAAATAAGGTGGGGG - Intergenic
1020800503 7:12726814-12726836 GCCACCTTCCCAATAGGTGGAGG - Intergenic
1026515236 7:71063873-71063895 CCCACCTGCAAAATAGGTAAAGG + Intergenic
1029680828 7:102107871-102107893 TCCACCTGCAGAGTTGGGCGTGG - Intronic
1030614772 7:111728331-111728353 GCCACCTGGAGAATGGGGCCCGG - Exonic
1035022379 7:155807224-155807246 GCCACTTGCAGCACAGGCCGGGG + Intronic
1035539053 8:417433-417455 TCCACCTGCAGAATACATCCAGG - Intronic
1036374104 8:8185493-8185515 GCCACCTGCAAATAAGGTGGAGG + Intergenic
1036876799 8:12480146-12480168 GCCACCTGCAAATAAGGTGGAGG - Intergenic
1042806781 8:72778956-72778978 GCTACCTGCAGAGCAGGTGGTGG + Intronic
1049704403 8:144034077-144034099 GCCAACTGCAGAAGAGGGAGGGG - Intronic
1049758316 8:144320601-144320623 GGCACCTGCAGGGCAGGTCGGGG - Intronic
1049812473 8:144581677-144581699 GCCACCTCCACACTGGGTCGGGG + Intronic
1051616630 9:19013028-19013050 GCCACCTTCAGCCTAGGTGGAGG - Intronic
1056482121 9:87016262-87016284 GCCACCTTCAGAATAGATCCAGG - Intergenic
1057863601 9:98661932-98661954 GCTCCCTGGAGAATTGGTCGAGG + Intronic
1061214487 9:129213200-129213222 GCCCCCTGGAGAAGAGGTCAAGG - Intergenic
1189364697 X:40379663-40379685 TCCACCTGCAGAAGCCGTCGTGG - Intergenic
1193775345 X:85634925-85634947 GGCACATGCAGATTAGGTCCAGG - Intergenic