ID: 1157523664

View in Genome Browser
Species Human (GRCh38)
Location 18:48362572-48362594
Sequence CAGCAGAAACTGATTGTTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 234}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157523664_1157523668 26 Left 1157523664 18:48362572-48362594 CCATGAACAATCAGTTTCTGCTG 0: 1
1: 0
2: 2
3: 18
4: 234
Right 1157523668 18:48362621-48362643 TTTATTATAGCAGCCTAAACTGG 0: 1
1: 4
2: 36
3: 153
4: 471
1157523664_1157523665 0 Left 1157523664 18:48362572-48362594 CCATGAACAATCAGTTTCTGCTG 0: 1
1: 0
2: 2
3: 18
4: 234
Right 1157523665 18:48362595-48362617 TTTATAAGCTCCCTAGTTTATGG 0: 1
1: 18
2: 209
3: 639
4: 1755

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157523664 Original CRISPR CAGCAGAAACTGATTGTTCA TGG (reversed) Intronic
904324687 1:29720724-29720746 GAACAGAAACTGGTTTTTCACGG + Intergenic
904925432 1:34043871-34043893 CAGCAGAGACTCATTGCCCAGGG - Intronic
905937127 1:41833622-41833644 CAGCAGAATCTGAGGGCTCAAGG + Intronic
906733333 1:48101801-48101823 CACCAGAAACTGACTCTTCCTGG - Intergenic
908007130 1:59738623-59738645 CAGAAGAAACTGGTTATTCTGGG + Intronic
908022635 1:59914427-59914449 CAGGGCAAAGTGATTGTTCAGGG - Intronic
911361517 1:96882962-96882984 AAGCAGAATGTGATTGTTTAGGG + Intergenic
913409472 1:118535356-118535378 CAACAGAAATTTATTTTTCATGG - Intergenic
916584020 1:166134117-166134139 CAGGAGAAACTGAATGTTGTAGG - Intronic
917005047 1:170405737-170405759 CAACAGAAATTTATTGCTCACGG - Intergenic
917365004 1:174221809-174221831 CAGCAGAAACTGGTAGGTAAGGG + Intronic
918027821 1:180770264-180770286 CAGCAGACAGTTATTTTTCATGG + Intronic
919754108 1:201056009-201056031 CAGCAAAAACTGAGTGTGGATGG + Intronic
919772246 1:201170002-201170024 CAACAGAAACTGACCGTTTAAGG + Intronic
920253737 1:204640104-204640126 CAACAGAAATTTATTGTTCACGG + Intronic
921458368 1:215398810-215398832 CAGTAGAAAGTGATCTTTCATGG - Intergenic
921966311 1:221094180-221094202 CAGCAGAAAGTCATTGCTCCAGG - Intergenic
923115925 1:230937869-230937891 AAGGAGAAACTGATTGCCCATGG + Intronic
924391839 1:243569196-243569218 CTGCAGAAACTGAATGACCATGG + Intronic
1063100074 10:2942595-2942617 AAGCAGAGGTTGATTGTTCAGGG - Intergenic
1064574704 10:16732569-16732591 CAGCAGAAATTTATTTCTCATGG - Intronic
1066323255 10:34327112-34327134 CAATAGAAACTGATTTATCATGG + Intronic
1066411597 10:35175663-35175685 CATCAGAAAATGACTGTTCCAGG + Intronic
1067479262 10:46584691-46584713 AAGCAGAAACTGGATGGTCAGGG - Intronic
1067615477 10:47757110-47757132 AAGCAGAAACTGGATGGTCAGGG + Intergenic
1068564772 10:58562362-58562384 CAGAAGAGACTGATTTTTCTAGG - Intronic
1069641224 10:69956699-69956721 CAGCAGAGACTGTTTCTTCGTGG + Intronic
1069946531 10:71990200-71990222 TAGCAGAAATTTATTGCTCATGG + Intronic
1073866542 10:107811011-107811033 AGGCAAAAACTGATTGTACAGGG + Intergenic
1075298746 10:121301235-121301257 CAGCAGAAAGTGATTGTGTTTGG - Intergenic
1075835890 10:125452438-125452460 CTGCAGAAGCTGACTGCTCAGGG - Intergenic
1077779008 11:5304562-5304584 CAGGGGACACTGATTGTACAGGG - Intronic
1078492948 11:11786122-11786144 CAACAGAAATTCATTGTCCATGG + Intergenic
1078526587 11:12106121-12106143 CAGAACAAACCGCTTGTTCACGG - Intronic
1080107857 11:28529893-28529915 CATCAGAAACTAATTTTTTATGG - Intergenic
1084007187 11:66329582-66329604 AAAAAGAAACTGATTGGTCAGGG - Intergenic
1085550318 11:77363971-77363993 CAGCACAAAGTGAATGTTCTTGG - Intronic
1085759108 11:79226542-79226564 GAGCAGAAGATCATTGTTCAAGG + Intronic
1085871921 11:80360351-80360373 CAGCAGAAATTTATTGTTTGGGG + Intergenic
1086738903 11:90342156-90342178 CAGCAGAAACAGAATTCTCAGGG - Intergenic
1086893919 11:92290409-92290431 CAGCACAATCTGCTTTTTCATGG + Intergenic
1086921115 11:92588124-92588146 CAGCATAAACTTATTGGTAAAGG - Intronic
1087287818 11:96284798-96284820 CTGAAGAGACTGATTCTTCATGG - Intronic
1087920789 11:103864003-103864025 CAGGAGAATCTGAGAGTTCAAGG - Intergenic
1088883558 11:113989945-113989967 CACCAAAAACTGGGTGTTCAAGG + Exonic
1090549377 11:127803046-127803068 CAGCAGAAAGTGAATTTTTAGGG + Intergenic
1092585105 12:9892153-9892175 TAGCAGAAATTGACGGTTCAAGG + Intronic
1092668645 12:10836619-10836641 CAGCAGAAACTGAGAGATAAGGG + Intronic
1093789677 12:23234045-23234067 CTCCAGAAAGTGAGTGTTCATGG + Intergenic
1094305650 12:29016429-29016451 CTGCAGAAGCTTTTTGTTCAGGG + Intergenic
1100734770 12:97514098-97514120 CAGCAGAAACTGGAAGTACAGGG + Intergenic
1101225639 12:102685645-102685667 CTGGGTAAACTGATTGTTCATGG + Intergenic
1104279689 12:127363897-127363919 TAGCAGAAACTCAATTTTCAAGG + Intergenic
1105410481 13:20167700-20167722 CAGCAGAGATTTATTTTTCAGGG + Intergenic
1105651091 13:22378877-22378899 CATCAGAAACTGTTTCTTCAAGG + Intergenic
1107876593 13:44796181-44796203 CAGCAGAAACTGGTTAGGCATGG - Intergenic
1108017365 13:46089840-46089862 CAACAGAAATTTATTGCTCACGG - Intronic
1110178871 13:72591349-72591371 CAACAGAAATTTATTGCTCATGG - Intergenic
1110395331 13:75023437-75023459 CAACAGAAATTTATTTTTCATGG - Intergenic
1111903081 13:94223781-94223803 CAGCAGATCCTCATTATTCATGG + Intronic
1112749553 13:102568042-102568064 CAGCAGAAAGTAAGTGCTCAGGG - Intergenic
1112947163 13:104943155-104943177 CAGAAGGAACTGATTGCCCAGGG + Intergenic
1112959433 13:105105541-105105563 CATCAGAAACTGAAGTTTCAGGG + Intergenic
1115435770 14:33371317-33371339 GAGAAGAATCTGAGTGTTCATGG + Intronic
1115765359 14:36617799-36617821 CAGCAGCCACTGTTTGTTCATGG + Intergenic
1117218330 14:53575429-53575451 CAATAGAAATTTATTGTTCATGG + Intergenic
1118582807 14:67320650-67320672 CAGCAGGAACTGATTCTCTATGG - Intronic
1118845478 14:69544830-69544852 CACCAGAAACTTACTGTTCCAGG + Intergenic
1118970202 14:70629841-70629863 CAGCAGAAATTTATTGTTCCAGG - Intergenic
1120824534 14:88943566-88943588 CAGCAGACATTTATTGCTCATGG + Intergenic
1121961030 14:98260008-98260030 CAGTAAAAAGTGATTGCTCATGG - Intergenic
1125060362 15:35413348-35413370 TATTAGAAACTGATGGTTCATGG - Intronic
1125292838 15:38168669-38168691 AAATAGAAACAGATTGTTCAGGG + Intergenic
1128909896 15:71503945-71503967 CAGTATAAACTGATTCTTCATGG - Intronic
1130209797 15:81912526-81912548 CAGCAGCACCTTATTTTTCAGGG - Intergenic
1130300901 15:82679577-82679599 CAGCTGGAGCTGTTTGTTCAGGG - Intronic
1130822232 15:87507856-87507878 CAGCAGAAACTGCAGGTGCAAGG - Intergenic
1132001232 15:98181979-98182001 CAGGAGAGAATGATTGTTCCTGG + Intergenic
1133708168 16:8375505-8375527 GAGGAGAAAATAATTGTTCAAGG + Intergenic
1134518817 16:14908365-14908387 CAGCAGAAGTTGATTTTGCAAGG + Intronic
1134706488 16:16307018-16307040 CAGCAGAAGTTGATTTTGCAAGG + Intergenic
1134773414 16:16830781-16830803 TAGCAGGAACTGAATGTTTAAGG - Intergenic
1134961052 16:18405092-18405114 CAGCAGAAGTTGATTTTGCAAGG - Intergenic
1134965354 16:18487695-18487717 CAGCAGAAGTTGATTTTGCAAGG - Intronic
1135806813 16:25549948-25549970 CAACAGAAACTTATTGCTGATGG - Intergenic
1138758119 16:59513562-59513584 CAGCAGGAATTTATTGTTTAAGG + Intergenic
1141201553 16:81902330-81902352 CAACAGGAACTGATTTCTCACGG + Intronic
1141368890 16:83469121-83469143 CAGCAGAAGCAGAAAGTTCAAGG + Intronic
1141682513 16:85553008-85553030 CAACAGAAACTGATAGTTTAGGG + Intergenic
1141861333 16:86718448-86718470 AACCTGAAACTGATTGTTCCTGG - Intergenic
1141938811 16:87260628-87260650 AAGCAGAAACAGATACTTCAAGG - Intronic
1143649764 17:8256273-8256295 CAGCCGACACTGGTTCTTCAAGG + Exonic
1143912711 17:10265160-10265182 CAGCAGAGGCTGAATGGTCAAGG + Intergenic
1150419225 17:65016039-65016061 CAGCAGCTTCTGTTTGTTCAGGG - Intronic
1153933383 18:9898957-9898979 CAGCAGAAACGTAATGTACAGGG - Intergenic
1153956697 18:10102456-10102478 CAGCAAAAATTGATTCTTGAGGG - Intergenic
1156921186 18:42524047-42524069 CAGCAGCAACTGATTGCTTCAGG + Intergenic
1157523664 18:48362572-48362594 CAGCAGAAACTGATTGTTCATGG - Intronic
1158015107 18:52774775-52774797 CCGCAGACACTCATGGTTCAGGG - Intronic
1158125480 18:54095670-54095692 CAACAGAAATTTATTTTTCATGG - Intergenic
1158679841 18:59557347-59557369 AAGCAGAAACTGAGTGATGAGGG - Intronic
1158845763 18:61441109-61441131 CTTCAAAAACTGATTGATCATGG + Intronic
1159502491 18:69291875-69291897 CAGTACAAAGTGATTGTTCGTGG - Intergenic
1159674462 18:71264813-71264835 GAGTAGGAACTGATTTTTCAAGG + Intergenic
1161057040 19:2195833-2195855 CAACAGAAACAAAGTGTTCAGGG + Intronic
1163339548 19:16696390-16696412 CAACAGAAATTTATTTTTCATGG + Intergenic
926428166 2:12758773-12758795 CAACAGAAATTGATTTCTCATGG - Intergenic
927130914 2:20059731-20059753 CAGCAGAAATTTATTTCTCATGG + Intergenic
928186067 2:29112275-29112297 CAGCAGAAACTAAATTTTTAGGG - Intronic
928190010 2:29155681-29155703 CAGCAGAAACTGAATGAAGAGGG - Intronic
928280726 2:29943980-29944002 CAACAGAAATTTATTTTTCATGG - Intergenic
928906307 2:36371634-36371656 CAGCTGAAACTAATTCATCATGG - Intronic
930163210 2:48178790-48178812 CAACAGAAATTTATTGTTCATGG + Intergenic
932254849 2:70275701-70275723 CTGCAGAAAATGATTGCTCAGGG + Intronic
932269113 2:70393456-70393478 CAACAGAAATTTATTGCTCATGG - Intergenic
932905938 2:75751269-75751291 CAGGTGATACTGATGGTTCAGGG - Intergenic
936783460 2:116062894-116062916 AAGCAGAAAATGCCTGTTCAGGG - Intergenic
937733201 2:125259463-125259485 AAGAAGAAAATGATTGCTCAGGG - Intergenic
938293990 2:130165799-130165821 CAGCAGGAAAGGATTGCTCAAGG - Intronic
938868304 2:135447508-135447530 CAGAAGAAGCAGATTATTCAGGG - Intronic
939678825 2:145105728-145105750 CAGCAGGTCCTGATTGGTCATGG + Intergenic
939813881 2:146870446-146870468 AAACAGAAATTTATTGTTCACGG + Intergenic
940263975 2:151817215-151817237 CAGGAGAAAGTGATTCTACATGG - Intronic
941412182 2:165172614-165172636 AAGCAGAAATTGCTTTTTCAGGG - Intronic
941688837 2:168477010-168477032 CAACAGAAATTTATTTTTCATGG + Intronic
943239797 2:185367909-185367931 CAGCAGAAATTCATTGTTTCAGG + Intergenic
943972686 2:194431282-194431304 CAACAGAAAATGATTGTTTCAGG + Intergenic
944836574 2:203586016-203586038 CACATGAAACTGATTATTCAGGG - Intergenic
945125371 2:206503705-206503727 CAGAAGAAACTGATTATTACTGG - Intronic
946134048 2:217631065-217631087 CAGCAGTTACTGAAAGTTCAAGG + Intronic
946140774 2:217688733-217688755 CAGCAAAAACAGCTTGTTCCAGG - Intronic
947121813 2:226823279-226823301 CAACAGAAATTGATTGCTCATGG - Intergenic
947767449 2:232646799-232646821 AAGCAGAGACAGAATGTTCATGG + Intronic
948180716 2:235977891-235977913 CAGCAGAAACTCATTTATCATGG + Intronic
1168789710 20:567992-568014 AAGCAGAAACTGATTTGGCAGGG - Intergenic
1169697242 20:8403827-8403849 CTGAAGATACTGAATGTTCATGG - Intronic
1170485740 20:16814338-16814360 CAGGATAATCTGATTGTCCAGGG + Intergenic
1170824038 20:19778184-19778206 CAGAAGAAACAGAGTGTTTAGGG + Intergenic
1173900529 20:46584253-46584275 GAGCAGAAACAACTTGTTCAAGG + Intronic
1174378152 20:50139771-50139793 CAGGAGAAATTGATTGAACACGG - Intronic
1175720273 20:61281483-61281505 CAACAGACACTGGTTGCTCATGG - Intronic
1176524884 21:7858443-7858465 CAGCATAATCTCATTCTTCATGG - Intergenic
1177407159 21:20684261-20684283 GAGGAAAAACTGACTGTTCAGGG - Intergenic
1178658904 21:34488456-34488478 CAGCATAATCTCATTCTTCATGG - Intergenic
1178709005 21:34897751-34897773 AAGCAGAAACTGGTTGTAGAAGG + Intronic
1178798730 21:35771321-35771343 CAGTACAAAGTTATTGTTCAAGG + Intronic
1181591262 22:23886402-23886424 CAACAGAAATTTATTTTTCATGG + Intronic
1181968644 22:26673536-26673558 CAGCAGAAACTAATGGTTTGTGG + Intergenic
1182483653 22:30626437-30626459 CTGCAGAAACAGATTGAGCAAGG - Intronic
1183565663 22:38612731-38612753 CAGGAGCAACTGGTTTTTCAAGG + Intronic
1183825693 22:40385115-40385137 CAGCAGAGTCTGATGCTTCAGGG + Intronic
1184971988 22:48029468-48029490 CAGCAGAAGCTGGAAGTTCAAGG - Intergenic
949638315 3:6008560-6008582 CAGCTGAAGCTGATTGTACTAGG + Intergenic
953549609 3:43891223-43891245 CAACAGAAACTTATTGCTGACGG - Intergenic
956223832 3:66933830-66933852 CAGCAGAAACATATAGTTAATGG + Intergenic
956361778 3:68455761-68455783 CAGCAGGAATTTATTGTTCCAGG + Intronic
956458795 3:69450854-69450876 CATCAGAAAATGACTTTTCATGG - Intronic
956793896 3:72701121-72701143 AATCAGTAACTGATTGTTAAGGG + Intergenic
956884171 3:73542392-73542414 CTTCAGTAACTGATTGTTCTAGG + Intronic
957131197 3:76223984-76224006 AAGCAGTGACTGATAGTTCATGG - Intronic
960650828 3:119947522-119947544 GAGCAGTAACAGATAGTTCATGG - Intronic
965358057 3:167701790-167701812 CAGCAGAAATTTATTGTTTTAGG - Intronic
967467314 3:189822880-189822902 CAGCAGAAAATGAATGGTCAGGG + Intronic
967633514 3:191774754-191774776 CAGCAGGAGCTTTTTGTTCAGGG + Intergenic
970860512 4:20697683-20697705 CAACAGAAATTGATTTCTCATGG + Intronic
970873403 4:20842427-20842449 CAGCAGAAGATGGTTGGTCAAGG + Intronic
971431314 4:26570906-26570928 CAACAGAAATTTATTTTTCACGG + Intergenic
971614564 4:28771324-28771346 CAACAGAAACTCATTTCTCAGGG + Intergenic
972138014 4:35917260-35917282 TGGCAGAAACTGATGGTCCAAGG + Intergenic
973534154 4:51864516-51864538 CAATAGAACTTGATTGTTCATGG + Intronic
974456765 4:62138753-62138775 CAGCATAAACTCATTCTTCTTGG - Intergenic
976083145 4:81378554-81378576 CAGTAAAAAATGATTTTTCAAGG - Intergenic
976517067 4:85981157-85981179 CAGCACTAACTGATTTTTCTTGG + Intronic
977381572 4:96280851-96280873 CAGCAGAAAATAATTTTTGAAGG + Intergenic
977475292 4:97499786-97499808 CAGCAGAAACAGCTAGTGCAAGG + Intronic
979302430 4:119102096-119102118 CAGCAGAAAATGATTTTTAGAGG + Intergenic
980546948 4:134276697-134276719 CAGCAGAAATTTATTGTTTCAGG + Intergenic
983039659 4:162910445-162910467 CAGCAGAAATTTATTGTTTGGGG - Intergenic
983380413 4:166984628-166984650 CAGCAGAAACTGAATAAACAGGG + Intronic
985891651 5:2720313-2720335 CAGCAGGAACTGACTGTGCCGGG + Intergenic
987255635 5:16147939-16147961 AAGGAGAGACTGCTTGTTCATGG + Intronic
987381488 5:17289773-17289795 CAGCATGAAATGTTTGTTCATGG + Intergenic
988321161 5:29698368-29698390 CAGCAGAAATCTTTTGTTCAAGG + Intergenic
992484084 5:77179324-77179346 CAGCAGGAACAGATTGTTGTTGG + Intergenic
992540829 5:77761977-77761999 CCACAGAAACTGATTCTGCATGG - Intronic
993638604 5:90375340-90375362 CAGCAGGAACTTATTGTTTCAGG + Intergenic
994703643 5:103171019-103171041 GAGTAGAAACTGATTTTTTAAGG - Intronic
996708367 5:126519806-126519828 CTGCAGAACCTGATAGTTAAGGG + Intergenic
997508681 5:134438097-134438119 CAGCACAAACTGCTGATTCATGG + Intergenic
997516230 5:134491813-134491835 CAGCTGAAACTGATTGGTAAGGG - Intergenic
997628973 5:135352095-135352117 CAGCAGAAGCTGAGAGCTCAAGG + Intronic
998099718 5:139422444-139422466 CAGCAGTAACTGGTTTTTGAAGG - Intronic
999961812 5:156763976-156763998 CACCTGATACTGATTTTTCAAGG + Intronic
1001902116 5:175441007-175441029 CAGCAGAAACTGATAGATAAGGG - Exonic
1004598115 6:17120681-17120703 CTGGAGGAACTAATTGTTCAAGG + Exonic
1004880634 6:20003904-20003926 CAGCAGTAACAGATGGTTCTCGG - Intergenic
1006856492 6:37137337-37137359 AAGCAGAAACTGATTGTGCCCGG + Intergenic
1007056417 6:38890187-38890209 CAGGTGAAGCCGATTGTTCAAGG - Intronic
1007945020 6:45818298-45818320 CATCAGAAATTGATTTTTCATGG - Intergenic
1008303636 6:49873213-49873235 CAGAAAAACCTAATTGTTCAAGG + Intronic
1009606445 6:65874879-65874901 CAGCTAAAACTGATTATTCTAGG - Intergenic
1012032731 6:94093219-94093241 CAGCAGGAATTTATTGTTTAGGG - Intergenic
1014061472 6:117076950-117076972 CAGCAGAAATTTATTGTTTCGGG - Intergenic
1014439488 6:121457680-121457702 AAGCAGAAACTGATTACTCAAGG + Intergenic
1015879068 6:137852594-137852616 CAGGGGAAACTGATTGCCCAGGG - Intergenic
1016676730 6:146778957-146778979 CAGCAAAAAAAGTTTGTTCAAGG + Intronic
1016944748 6:149519576-149519598 CAGGAGAAACTAATAGTACATGG + Intronic
1017556897 6:155581633-155581655 TAGAAGAAAATGCTTGTTCAAGG + Intergenic
1018652748 6:166005649-166005671 CAGCAAATACCCATTGTTCACGG - Intergenic
1019961888 7:4467394-4467416 CAACAGATACTGATGGTTTAGGG + Intergenic
1021525367 7:21580536-21580558 CAACAGAAATTTATTTTTCAGGG + Intronic
1022492074 7:30828675-30828697 CGGCAGCAACTGATTTTTCCTGG - Exonic
1023769801 7:43546333-43546355 CAGCAGAAATTTATTGTTTGGGG + Intronic
1027182655 7:75951788-75951810 CAGCAGAAGCTGCTGTTTCAGGG + Intronic
1027490289 7:78815379-78815401 GAGCAGAAACTGAGAGTTAATGG + Intronic
1027751552 7:82154075-82154097 AAGCAGAAGCTTATTGCTCATGG - Intronic
1033847016 7:145445683-145445705 CACTAGAAACATATTGTTCAGGG + Intergenic
1036703486 8:11029604-11029626 CAGCAGACACTGATTTCTCTTGG - Intronic
1038090312 8:24245929-24245951 CAAAAGAAACTTATTTTTCATGG + Intergenic
1039094468 8:33868645-33868667 AAACAGAAACTTATTGGTCAAGG + Intergenic
1042022065 8:64378684-64378706 CAGCAGAAAATGATTGGCAATGG + Intergenic
1042640847 8:70932613-70932635 CAGCAGAAGCTGGAAGTTCAAGG + Intergenic
1043356706 8:79422138-79422160 TTCCAGAAACTAATTGTTCAAGG + Intergenic
1043746973 8:83886679-83886701 CAGCAGAAATTTATTGTTTCAGG + Intergenic
1044542901 8:93427901-93427923 AAGCAGCAACTGATTGCTGAGGG + Intergenic
1044796713 8:95908396-95908418 CAGCAGAAACAAATTGGTCCTGG - Intergenic
1046178877 8:110616110-110616132 CAGAAAAATCTGATTTTTCAAGG + Intergenic
1047329056 8:123868557-123868579 CAGCAGAAAATCATTTTTCTGGG - Intronic
1047393240 8:124471335-124471357 CAACAGAAACTGATTCTTCTGGG - Intergenic
1047633702 8:126736006-126736028 CCTCAGAAAATGATTGGTCAGGG + Intergenic
1048309002 8:133303813-133303835 CAGCAGAAATTTATTTCTCATGG - Intergenic
1048476689 8:134749337-134749359 CAACAGAAATTTATTGCTCATGG + Intergenic
1048684921 8:136893774-136893796 CAACAGAAATTTATTGCTCATGG - Intergenic
1050212695 9:3280613-3280635 CAGTAGCAACTGATTCTTCTTGG + Intronic
1051516416 9:17935087-17935109 CCTCAGAAACTGTTTTTTCAAGG + Intergenic
1055239920 9:74171340-74171362 CTTGAGAAAATGATTGTTCAGGG - Intergenic
1057134359 9:92676732-92676754 GACCAGAAACTAATTGCTCACGG + Intergenic
1058978406 9:110146324-110146346 CAGCAGAACCTGCTTGTACCAGG - Intronic
1059614425 9:115933176-115933198 CAGCAGAAACTTATTGTGAGTGG - Intergenic
1061362496 9:130152521-130152543 CAACAGAAACTTATTACTCACGG + Intergenic
1062304572 9:135897013-135897035 TGACAGAAATTGATTGTTCATGG - Intronic
1185967945 X:4628738-4628760 CAGCAGACACTGATTGATCATGG - Intergenic
1187551090 X:20306707-20306729 CACCAGAACCTGATGGTACAGGG + Intergenic
1189373952 X:40451792-40451814 CAGCAGAATCTCATTCTCCATGG + Intergenic
1194258349 X:91662920-91662942 CAGCAGAAATTTATTGTTTTGGG + Intergenic
1194641918 X:96412945-96412967 CAGCAGAAATTTATTTCTCACGG + Intergenic
1194945269 X:100059324-100059346 TAGCAGAAAATGATAATTCAGGG + Intergenic
1195356668 X:104045920-104045942 CAGCAGAAATTTATTGTTCACGG + Intergenic
1196358453 X:114823408-114823430 CAGCAGAAACTGGAACTTCATGG + Intronic
1196779891 X:119374461-119374483 CAGAAGAAACTGCATGTGCAAGG + Intergenic
1198035347 X:132796218-132796240 CAGCAGAGACTGATTGCCTATGG + Intronic
1198734805 X:139773482-139773504 CAGTAGAAATTTATTTTTCACGG - Intronic
1198835314 X:140798669-140798691 CAACAGAAACTTATTTCTCATGG + Intergenic
1199275418 X:145936555-145936577 CAGCAGAAACTTATGTTTCAGGG + Intergenic
1200577117 Y:4902416-4902438 CAGCAGAAATTTATTGTTTTGGG + Intergenic