ID: 1157525660

View in Genome Browser
Species Human (GRCh38)
Location 18:48378519-48378541
Sequence GGTTTTATTGGAGAACCATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 88}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157525660_1157525665 6 Left 1157525660 18:48378519-48378541 CCAGATGGTTCTCCAATAAAACC 0: 1
1: 0
2: 0
3: 9
4: 88
Right 1157525665 18:48378548-48378570 CATCACATCCTACCTGCACTCGG 0: 1
1: 0
2: 0
3: 15
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157525660 Original CRISPR GGTTTTATTGGAGAACCATC TGG (reversed) Intronic
900906187 1:5560905-5560927 GTTTCTCTTGGAAAACCATCAGG - Intergenic
901028669 1:6293206-6293228 AGTGTCCTTGGAGAACCATCAGG - Intronic
901991532 1:13118362-13118384 GATTTTATTACAGGACCATCAGG - Intergenic
905075869 1:35269499-35269521 GGTGTTACTGAAGAACCCTCCGG - Intronic
909046759 1:70720156-70720178 GGTTTTATTTAAGAAACATCAGG - Intergenic
909153040 1:72033267-72033289 TGTTTTATTGAAGAACCTTTGGG + Intronic
910017235 1:82540878-82540900 GATTTTATTGGAGAGCTATGTGG - Intergenic
916335737 1:163669215-163669237 GGTTTGATTGGAGAATGATGAGG - Intergenic
916565284 1:165970526-165970548 AGTTTTATTGGAGATTCATAGGG + Intergenic
918830704 1:189394112-189394134 ACTTTTATTAGAGAACAATCTGG + Intergenic
924216809 1:241830977-241830999 GATATTATTGAGGAACCATCTGG + Intergenic
1064257902 10:13760112-13760134 AGTTTTATTGGAACACAATCAGG + Intronic
1071389476 10:85157046-85157068 GGTGTTATTGGAGAAGAATTGGG - Intergenic
1071992772 10:91116093-91116115 GCTTTTATTGGATAAGCATCAGG - Intergenic
1072410199 10:95194838-95194860 GATTTCAATGTAGAACCATCTGG - Intronic
1072614339 10:97039448-97039470 GATTTTCTTGGAAGACCATCAGG + Intronic
1076735910 10:132458828-132458850 GGTCTTTTTGGAGAAGCATTTGG - Intergenic
1078113084 11:8415725-8415747 GACTTTATTGTAAAACCATCAGG + Intronic
1086821767 11:91444323-91444345 AGTTATATTGGAAAACCATGAGG - Intergenic
1088584693 11:111352487-111352509 TGTTTTGCTGGAGAAACATCAGG - Exonic
1089415680 11:118288175-118288197 TGTTATATTGGAGGCCCATCTGG + Intergenic
1092024431 12:5228943-5228965 GGTTTAATTGGAGTTCCATGTGG + Intergenic
1094348695 12:29499168-29499190 GCTTTTATTGGAGAACGGTGTGG - Intergenic
1095204771 12:39427018-39427040 TGTTTCATGGGAGAGCCATCAGG + Intronic
1098425044 12:70353819-70353841 GTTTTTATAGGAGTTCCATCTGG + Exonic
1100787189 12:98090711-98090733 GGTTTCAATGGAAAACCATTAGG - Intergenic
1101071626 12:101081748-101081770 GGTTCTTTCTGAGAACCATCAGG + Intronic
1105048074 12:133023326-133023348 AATTTTATTGGACATCCATCTGG - Exonic
1120974114 14:90234068-90234090 GGGTTTATAGGAGAACAAACGGG + Intergenic
1124188342 15:27549660-27549682 TGTTTTATTTGTGAACCATCAGG + Intergenic
1128978197 15:72168273-72168295 GGTTTTCTTGGGGAAACGTCAGG - Intronic
1130988105 15:88857875-88857897 GGTATTAGTGGAGAAGCATCTGG + Exonic
1136699455 16:32117533-32117555 GGGATTCTTGGAGAGCCATCTGG + Intergenic
1136768195 16:32810401-32810423 GGGATTCTTGGAGAGCCATCTGG - Intergenic
1136799947 16:33060704-33060726 GGGATTCTTGGAGAGCCATCTGG + Intergenic
1141323739 16:83036473-83036495 GGTTCTATTGGCTCACCATCTGG + Intronic
1203070587 16_KI270728v1_random:1072417-1072439 GGGATTCTTGGAGAGCCATCTGG - Intergenic
1157525660 18:48378519-48378541 GGTTTTATTGGAGAACCATCTGG - Intronic
1162055633 19:8062263-8062285 GGTTTTATCGGAGAAAGATCCGG - Exonic
1164870554 19:31639982-31640004 GGTTTTATTGAACATCCATTGGG + Intergenic
1166324013 19:42038134-42038156 GGTTCTATTGGAGGACAAGCTGG + Intronic
925160275 2:1678576-1678598 CGGTTTCTTGGAAAACCATCTGG + Intronic
925808163 2:7672946-7672968 GGTTTTATGGGAGAACCGACAGG + Intergenic
926860242 2:17301412-17301434 GGTTTTATGGGAAGAGCATCAGG - Intergenic
927045677 2:19275862-19275884 GGTTCTATTGTAGGACCTTCTGG + Intergenic
932103080 2:68918647-68918669 TGTCTTATTGGAGTACCTTCTGG - Intergenic
939470486 2:142614107-142614129 GTTTTGATTAGAGAACCATGGGG + Intergenic
942072945 2:172331929-172331951 CTTTTTATTGGAGAACCAGAGGG + Intergenic
943525346 2:189009149-189009171 GGGTTTTTACGAGAACCATCAGG - Exonic
944557628 2:200903672-200903694 GGTATAATTGCAGAAACATCAGG + Exonic
948337160 2:237218382-237218404 GGTTTTAGTGGAGATACAACAGG + Intergenic
1169559014 20:6779035-6779057 GGTTGTATTAAAGAACTATCAGG + Exonic
1175413708 20:58787709-58787731 AGGTTTTTTGGAGAATCATCCGG + Intergenic
1176273787 20:64251821-64251843 AGTTTTATTGGAGATTCTTCAGG + Intergenic
1177657147 21:24032750-24032772 AAATTGATTGGAGAACCATCAGG + Intergenic
1182564427 22:31186775-31186797 GGTTCCTGTGGAGAACCATCTGG + Intronic
951454919 3:22880128-22880150 GAATTTAGTGGTGAACCATCTGG - Intergenic
953795958 3:45986190-45986212 GGACTTATTGGAAAACCACCAGG - Intronic
956971638 3:74533040-74533062 GCATTTTCTGGAGAACCATCAGG + Intergenic
958029077 3:88085347-88085369 GGTTTTATTGGAACACAACCAGG - Intronic
960435962 3:117626941-117626963 GTTTTTATTTGAGAGTCATCAGG + Intergenic
960884263 3:122378285-122378307 TGTTTTATTGGAGATGAATCGGG - Intronic
962529471 3:136265720-136265742 AGTTGTTTTGGAAAACCATCTGG - Intronic
964773573 3:160251393-160251415 GGATTTCTTTTAGAACCATCTGG - Intronic
965875632 3:173315523-173315545 AGTTTTAATGGAGCACCTTCTGG + Intergenic
966279971 3:178214737-178214759 GGCTGTACTTGAGAACCATCTGG + Intergenic
970709506 4:18845377-18845399 GCTTCTATTTGAGAACCACCAGG - Intergenic
970722995 4:19009710-19009732 GGCTTAATGGGAGAACCAACGGG + Intergenic
979391559 4:120134617-120134639 TCTTTTATTGGAGAGTCATCAGG + Intergenic
979521992 4:121678019-121678041 AGTGTTATTGAATAACCATCAGG - Intronic
980708673 4:136535041-136535063 GATTTTACTGGAGAACAATTAGG + Intergenic
980867984 4:138576276-138576298 GGTCTTTTTGGGGAACAATCTGG + Intergenic
981898538 4:149834381-149834403 GGATTTAATAGAGAACCATTTGG + Intergenic
983970813 4:173871233-173871255 GGTATTCTTGGAGAATTATCAGG + Intergenic
986558914 5:9040952-9040974 GGAACAATTGGAGAACCATCCGG + Exonic
997997932 5:138601441-138601463 GGGGGTATTGGAGAACCATGAGG + Intergenic
1000164580 5:158635631-158635653 GGTTATTTTGGAGAAACATCAGG + Intergenic
1003956986 6:11173343-11173365 GTTTTTTTTTCAGAACCATCTGG - Intergenic
1004077847 6:12361533-12361555 AGTTTTATTGGAATACAATCAGG - Intergenic
1004431760 6:15551475-15551497 GGCTTCTTTGGAGAACCATCAGG - Intronic
1005087107 6:22018462-22018484 GATTTTAGTGGCAAACCATCAGG - Intergenic
1008741585 6:54615215-54615237 GGAGTTATTGGAGATCCTTCAGG - Intergenic
1017005627 6:150026347-150026369 GGTTTTATTACAGAAACAGCAGG + Intergenic
1017661131 6:156674752-156674774 GTTTTTATTGCAGTACCATGTGG - Intergenic
1018285084 6:162229193-162229215 GGTTTTGTTGAAGAACAATCAGG - Intronic
1022971089 7:35518088-35518110 GGCTTTATTCCAGAAGCATCTGG - Intergenic
1030613482 7:111713778-111713800 GTTTTGATTGCAGAAGCATCAGG - Intergenic
1037734920 8:21558062-21558084 AGTTTCATTGTAAAACCATCTGG - Intergenic
1045476966 8:102561357-102561379 GGTTTTACTGGACAATGATCAGG + Intergenic
1045726243 8:105176744-105176766 TGTTTTATTTGAGAACAATTAGG - Intronic
1046319439 8:112552684-112552706 CGTTTTAAAGGAGAATCATCAGG - Exonic
1046337324 8:112807155-112807177 GCTTTTTTTGGAGAGCCAGCTGG + Intronic
1050452485 9:5797888-5797910 GGATTTCTTGGAGAAACTTCTGG + Exonic
1185871034 X:3665012-3665034 TGTTTTCTTGGAGATCCCTCTGG - Intronic
1187585498 X:20657071-20657093 CGTTGTTTTGGAGAACCTTCAGG + Intergenic
1192837318 X:74814759-74814781 GGTTTCATTTGTGAACCAACAGG - Intronic
1193996398 X:88370146-88370168 GGTTTTATAGCAGTACTATCAGG + Intergenic
1200793054 Y:7316500-7316522 TGTTTTCTTGGAGATCCCTCTGG + Intergenic