ID: 1157527622

View in Genome Browser
Species Human (GRCh38)
Location 18:48396809-48396831
Sequence ACAACCACCATTGTGGCTCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 52}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157527622_1157527624 -8 Left 1157527622 18:48396809-48396831 CCACGAGCCACAATGGTGGTTGT 0: 1
1: 0
2: 1
3: 2
4: 52
Right 1157527624 18:48396824-48396846 GTGGTTGTCAGCAAGTCACATGG 0: 1
1: 0
2: 1
3: 17
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157527622 Original CRISPR ACAACCACCATTGTGGCTCG TGG (reversed) Intronic
900124380 1:1062979-1063001 ACACCCACGATGGTGGCTTGAGG - Intergenic
903128917 1:21265823-21265845 ACACCCAACAGTGTGGCTCCTGG + Intronic
904754372 1:32760127-32760149 ACACCCAGCATTCTGGCTCATGG + Intronic
913132957 1:115859409-115859431 ACCACCACCACTGTTGCCCGAGG - Intergenic
916478006 1:165187865-165187887 AGGACCAGCATTGTGGCTAGAGG + Intergenic
917951609 1:180043603-180043625 ATAAAGACCATTGTGGCTGGAGG + Intronic
924193710 1:241583037-241583059 AGAAGCACCATTGTGCCTCTAGG - Intronic
1065360120 10:24881611-24881633 AAAACCACCATTTTAGCTTGTGG + Intronic
1070324895 10:75382153-75382175 ACTACCACCATTTTGGCTCATGG - Intergenic
1079845450 11:25461157-25461179 ACAGCCAGCATTCTGGCTTGCGG + Intergenic
1083927077 11:65814338-65814360 ACATCACCCATTGTGCCTCGTGG - Intergenic
1083929289 11:65831306-65831328 ACAATCACCATTATGGCACGTGG + Intronic
1092313465 12:7383586-7383608 ACCACCACCACTGAGGCTCAAGG + Intronic
1092633844 12:10417610-10417632 ACAACCACCCTGGTGTCTCCTGG - Intronic
1104665867 12:130646899-130646921 GCAAACACCAATGTGGCTCCTGG - Intronic
1129415418 15:75374655-75374677 ACAAACACCATTGTGGCTCAAGG - Intronic
1130726253 15:86442595-86442617 CAATCCACCATTGTGGCTCAAGG + Intronic
1142000432 16:87661220-87661242 ACAAGGACCCTTGTGGTTCGGGG + Intronic
1145782334 17:27571349-27571371 GCACCCACCATTGGGGCTCATGG - Intronic
1147139766 17:38454352-38454374 ACAACCCCCAGTCTGGGTCGAGG + Intronic
1150425164 17:65071599-65071621 ACAACAACCAGTGTGTCTGGAGG + Intergenic
1152412967 17:80139102-80139124 AGAACCACCTGTGTGGCTGGAGG + Exonic
1157527622 18:48396809-48396831 ACAACCACCATTGTGGCTCGTGG - Intronic
1159949722 18:74474212-74474234 ACAACCTCCATTGTTGGTCTTGG + Intergenic
1161668526 19:5591098-5591120 ACAACCACCATTTGGGTTCTTGG + Intronic
1162498836 19:11039485-11039507 ACAGCCAGCAGTGTGGCACGTGG + Intronic
1164814151 19:31181509-31181531 AGAACCACCGTAGTGGCTTGGGG + Intergenic
1166935208 19:46328119-46328141 AGAACCACCATTGTGATTAGAGG - Intronic
1167675998 19:50886156-50886178 ATAACCTCCAGTGTGGCTCTGGG - Intergenic
931535527 2:63271575-63271597 ACATGCACCATTGTGGTGCGGGG + Intronic
933006374 2:77000829-77000851 ACAGCCACCATGGAGGCTCAGGG - Intronic
933689135 2:85166105-85166127 ACAACCACCACTGTGACCTGAGG - Intronic
937885463 2:126896764-126896786 ACAAACACCAATGTGCCTAGAGG + Intergenic
938735695 2:134184623-134184645 CCAAGCACCATTGTGGATCCTGG - Intronic
940746783 2:157576169-157576191 GCAACCATTATTGTGGCTTGAGG + Intronic
946716411 2:222558527-222558549 ACCACCACCATTCTGGCTGCCGG + Exonic
949043584 2:241860220-241860242 ACACCCACCCTTGTGCCTCAGGG + Intergenic
1168790455 20:572604-572626 ACAATTACCATTGTGCCTCTCGG + Intergenic
1174927512 20:54776867-54776889 ACATCCACCAGTGTGGGTTGTGG + Intergenic
960472795 3:118088387-118088409 ACAGCCAGCATTCTGGCTTGTGG - Intergenic
960520140 3:118645326-118645348 TCAGCAACCACTGTGGCTCGTGG + Intergenic
964385613 3:156144673-156144695 ACTACCACCACTGAGGGTCGAGG - Intronic
976864067 4:89703165-89703187 AGAAACACCAATGTGGCTAGTGG + Intergenic
993233482 5:85270276-85270298 ACACACACCATTTTGACTCGAGG + Intergenic
998005873 5:138656708-138656730 ATAATCACCATTGTGGAGCGTGG + Intronic
1000621602 5:163492820-163492842 ACACCCAGCATTATGGCTTGTGG + Intergenic
1019485302 7:1286409-1286431 ACAGCCCCAAGTGTGGCTCGTGG - Intergenic
1035325974 7:158066301-158066323 ACAGCCACCCTTCTGGCTCCAGG + Intronic
1037957932 8:23073021-23073043 ACAGCCACCATTGAGGGTCATGG + Intergenic
1040447459 8:47509806-47509828 ACAAATACCATGGTGGCACGTGG + Intronic
1044777888 8:95712785-95712807 AACACTACCATTGTGGCTCCTGG + Intergenic
1049277327 8:141726331-141726353 TCATCCACCACTGTGGCTGGCGG - Intergenic
1049786495 8:144453362-144453384 ACAACGACAATTGGGGCACGTGG + Exonic
1053065897 9:35068991-35069013 ACAACCTCCCTTGAGGCTCAGGG + Intronic
1187602044 X:20842682-20842704 ACAACCAGCATTGTTGCTTTTGG + Intergenic
1196153478 X:112401336-112401358 TCATCCACCATTGTGGGTCCAGG + Intergenic