ID: 1157536526

View in Genome Browser
Species Human (GRCh38)
Location 18:48462707-48462729
Sequence TGGTTCTCTCCAGTAGTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157536526_1157536529 1 Left 1157536526 18:48462707-48462729 CCATGCACTACTGGAGAGAACCA No data
Right 1157536529 18:48462731-48462753 CTTGTTTGGCAAGTAGCTCCTGG No data
1157536526_1157536530 12 Left 1157536526 18:48462707-48462729 CCATGCACTACTGGAGAGAACCA No data
Right 1157536530 18:48462742-48462764 AGTAGCTCCTGGCATACTACTGG No data
1157536526_1157536532 22 Left 1157536526 18:48462707-48462729 CCATGCACTACTGGAGAGAACCA No data
Right 1157536532 18:48462752-48462774 GGCATACTACTGGACCCTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157536526 Original CRISPR TGGTTCTCTCCAGTAGTGCA TGG (reversed) Intergenic
No off target data available for this crispr