ID: 1157536528

View in Genome Browser
Species Human (GRCh38)
Location 18:48462727-48462749
Sequence GAGCTACTTGCCAAACAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157536528_1157536530 -8 Left 1157536528 18:48462727-48462749 CCATCTTGTTTGGCAAGTAGCTC No data
Right 1157536530 18:48462742-48462764 AGTAGCTCCTGGCATACTACTGG No data
1157536528_1157536537 25 Left 1157536528 18:48462727-48462749 CCATCTTGTTTGGCAAGTAGCTC No data
Right 1157536537 18:48462775-48462797 AGACAGAGCAGCTGACCATGGGG No data
1157536528_1157536532 2 Left 1157536528 18:48462727-48462749 CCATCTTGTTTGGCAAGTAGCTC No data
Right 1157536532 18:48462752-48462774 GGCATACTACTGGACCCTAGTGG No data
1157536528_1157536536 24 Left 1157536528 18:48462727-48462749 CCATCTTGTTTGGCAAGTAGCTC No data
Right 1157536536 18:48462774-48462796 GAGACAGAGCAGCTGACCATGGG No data
1157536528_1157536535 23 Left 1157536528 18:48462727-48462749 CCATCTTGTTTGGCAAGTAGCTC No data
Right 1157536535 18:48462773-48462795 GGAGACAGAGCAGCTGACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157536528 Original CRISPR GAGCTACTTGCCAAACAAGA TGG (reversed) Intergenic