ID: 1157536532

View in Genome Browser
Species Human (GRCh38)
Location 18:48462752-48462774
Sequence GGCATACTACTGGACCCTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157536528_1157536532 2 Left 1157536528 18:48462727-48462749 CCATCTTGTTTGGCAAGTAGCTC No data
Right 1157536532 18:48462752-48462774 GGCATACTACTGGACCCTAGTGG No data
1157536526_1157536532 22 Left 1157536526 18:48462707-48462729 CCATGCACTACTGGAGAGAACCA No data
Right 1157536532 18:48462752-48462774 GGCATACTACTGGACCCTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157536532 Original CRISPR GGCATACTACTGGACCCTAG TGG Intergenic
No off target data available for this crispr