ID: 1157537916

View in Genome Browser
Species Human (GRCh38)
Location 18:48474159-48474181
Sequence TGCTAGGTATTGAACTTGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157537909_1157537916 23 Left 1157537909 18:48474113-48474135 CCAAAGAGGATTATTCTCAACCC No data
Right 1157537916 18:48474159-48474181 TGCTAGGTATTGAACTTGCTTGG No data
1157537911_1157537916 3 Left 1157537911 18:48474133-48474155 CCCCTAAGATCTAATGGAATTTG No data
Right 1157537916 18:48474159-48474181 TGCTAGGTATTGAACTTGCTTGG No data
1157537913_1157537916 1 Left 1157537913 18:48474135-48474157 CCTAAGATCTAATGGAATTTGCC No data
Right 1157537916 18:48474159-48474181 TGCTAGGTATTGAACTTGCTTGG No data
1157537912_1157537916 2 Left 1157537912 18:48474134-48474156 CCCTAAGATCTAATGGAATTTGC No data
Right 1157537916 18:48474159-48474181 TGCTAGGTATTGAACTTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157537916 Original CRISPR TGCTAGGTATTGAACTTGCT TGG Intergenic
No off target data available for this crispr