ID: 1157538496

View in Genome Browser
Species Human (GRCh38)
Location 18:48480465-48480487
Sequence ATTAATGTATTTACAGCTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157538492_1157538496 13 Left 1157538492 18:48480429-48480451 CCTTGAGCCTGGAAAAAAAAAAG No data
Right 1157538496 18:48480465-48480487 ATTAATGTATTTACAGCTAATGG No data
1157538493_1157538496 6 Left 1157538493 18:48480436-48480458 CCTGGAAAAAAAAAAGAACCCAG No data
Right 1157538496 18:48480465-48480487 ATTAATGTATTTACAGCTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157538496 Original CRISPR ATTAATGTATTTACAGCTAA TGG Intergenic
No off target data available for this crispr