ID: 1157541003

View in Genome Browser
Species Human (GRCh38)
Location 18:48506571-48506593
Sequence TTGGTGTTCCTGAGGAAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157540999_1157541003 -7 Left 1157540999 18:48506555-48506577 CCAAACCTAAGAATAATTGGTGT 0: 265
1: 423
2: 482
3: 512
4: 1196
Right 1157541003 18:48506571-48506593 TTGGTGTTCCTGAGGAAGAAGGG No data
1157540997_1157541003 24 Left 1157540997 18:48506524-48506546 CCTTCAAGAAGTCTGGTATTATC No data
Right 1157541003 18:48506571-48506593 TTGGTGTTCCTGAGGAAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157541003 Original CRISPR TTGGTGTTCCTGAGGAAGAA GGG Intergenic
No off target data available for this crispr