ID: 1157546323

View in Genome Browser
Species Human (GRCh38)
Location 18:48549146-48549168
Sequence CAGGGTGCACATAGGGGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 196}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157546317_1157546323 19 Left 1157546317 18:48549104-48549126 CCTGACACTATTATCAGACACTG 0: 1
1: 0
2: 2
3: 8
4: 109
Right 1157546323 18:48549146-48549168 CAGGGTGCACATAGGGGTGATGG 0: 1
1: 0
2: 0
3: 14
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157546323 Original CRISPR CAGGGTGCACATAGGGGTGA TGG Intronic
900133627 1:1103561-1103583 CAGGGTGCACGCAGGGGTCAGGG + Intronic
901017295 1:6239171-6239193 CAGGGTTCACAGAGCAGTGATGG + Intergenic
901037279 1:6343900-6343922 CTGGGTGTACAGAGGGGTGTGGG + Intronic
905937864 1:41839172-41839194 CAGGGTCCACAGAGGAGGGAAGG + Intronic
906247824 1:44289586-44289608 CTGTGTGCTTATAGGGGTGAGGG - Intronic
906617511 1:47244009-47244031 CTGGGGCCACAAAGGGGTGAGGG - Intergenic
906776708 1:48536313-48536335 CAGGGTGCTCACAGGGGTGGAGG + Intronic
908565434 1:65351017-65351039 CAGTGTGGACATAGGGATTAGGG - Intronic
909343634 1:74559775-74559797 CAGGGTTCATATATGGGTCAAGG - Intergenic
915297471 1:154931295-154931317 AAGGGTGCACCTAGAGGTCAAGG + Intronic
915515543 1:156410365-156410387 CAGGGTGCTCATTGTGCTGAGGG + Intronic
915736974 1:158091248-158091270 CACATGGCACATAGGGGTGAGGG + Intronic
915869611 1:159544088-159544110 TGGGGTGCAGGTAGGGGTGAGGG + Intergenic
920720149 1:208379739-208379761 CAGGGTGCGTATAGGGGAGGGGG - Intergenic
920916848 1:210264624-210264646 CAGTGTGGGGATAGGGGTGAGGG - Intergenic
923486897 1:234441705-234441727 CAGGGAGAAAATAGGGGTTAAGG - Intronic
1062803310 10:395963-395985 CAGGGTCCACATGGGGATGAGGG - Intronic
1063915118 10:10873819-10873841 AAGGCTGGACAAAGGGGTGAAGG - Intergenic
1063963286 10:11325007-11325029 CATGGTGCTCATATGGGTGGGGG + Intronic
1065815266 10:29477530-29477552 CAGGGTGCACTTCTGGGAGAGGG - Intronic
1065957601 10:30706815-30706837 CAGGGTGCACTTCTGGGAGAGGG + Intergenic
1068739483 10:60452298-60452320 GAGGGTGCACATAGCTGTGGTGG - Intronic
1069832809 10:71291445-71291467 CAGGAGGCACAGAGGGGTGTAGG - Exonic
1070917693 10:80165354-80165376 CAGGGTGCACACAGAGCTGTGGG + Intronic
1072434245 10:95400974-95400996 CAGATTGCACAGAGGGTTGAAGG + Intronic
1072799948 10:98385793-98385815 CAGTGTGCACATAGGAGTCAGGG - Intronic
1075335291 10:121604509-121604531 CAGGGCACACAGAGGGATGATGG + Intergenic
1076570957 10:131432538-131432560 GAGAGTGCACAGAGGGGAGAGGG + Intergenic
1076644515 10:131943468-131943490 CAGGGTGCACAGCAGGGTGCTGG - Intronic
1077498723 11:2899248-2899270 AAGGGTGTACAGTGGGGTGACGG - Intronic
1077917516 11:6621242-6621264 CAGGAGGCACAGAGGGGTGGTGG - Intergenic
1078025891 11:7695389-7695411 CAGGGTGAACTCAGGGTTGAGGG + Intronic
1080559830 11:33452778-33452800 CAGGGGACACACAGGGGCGAGGG - Intergenic
1080594583 11:33759415-33759437 CAGGGTCCACAAAGGAGAGAGGG + Intronic
1083446374 11:62710298-62710320 AAGGGTGCACAGAGGCGAGATGG + Intronic
1084068984 11:66721559-66721581 CGGGGTGAAGAAAGGGGTGATGG + Intronic
1084972709 11:72780533-72780555 CAGGGTGCAGAAAGCGGGGAAGG + Intronic
1090569713 11:128032829-128032851 CATGGGGCACAGAGAGGTGACGG + Intergenic
1091047894 11:132341264-132341286 CAGAGTGCACATGTGGATGAGGG + Intergenic
1094476338 12:30843520-30843542 CAGGCTGGACATAGTGGAGAGGG + Intergenic
1096148214 12:49293581-49293603 CAGGACGCACAAAGGGGGGAGGG + Intronic
1096670739 12:53196926-53196948 GAGGGTGCACCTAGGGGGCAGGG + Intronic
1098542259 12:71670049-71670071 CAGGGTACGTATAGGGTTGAGGG + Intronic
1102722522 12:115029808-115029830 GGGTGTGTACATAGGGGTGAGGG - Intergenic
1103446159 12:120996560-120996582 CAGGGTGCTGACAGGGGGGAGGG - Exonic
1104703794 12:130927531-130927553 GGGGGTCCACATAGGGGAGAAGG - Intergenic
1104969411 12:132524419-132524441 CAGGGTGCACACAAGGCAGACGG - Intronic
1106618751 13:31354162-31354184 CAGGGTTCCCATGGGGGTTATGG + Intergenic
1107446770 13:40476482-40476504 CAGGGTTCACCTATGGGTTATGG - Intergenic
1107634756 13:42381001-42381023 CAGGGTGCACAGAGGGGAGGGGG + Intergenic
1112333932 13:98498714-98498736 CAGGGTGTACAGTGGGGAGACGG - Intronic
1112651034 13:101398778-101398800 CAGGGTGCACAGCGTGGGGAGGG + Intronic
1114726617 14:24944448-24944470 CTGGGAGCACATAGGGGATATGG + Intronic
1116412982 14:44647599-44647621 CAGGGTAGTCATAGGGGAGATGG - Intergenic
1116635507 14:47389727-47389749 CAGGGTGAAAAAAGGGGGGAGGG + Intronic
1119318491 14:73714790-73714812 CAGGGTGCACAGTGTGGTCAGGG - Intergenic
1119483865 14:74975889-74975911 AAGGGGGCACAGAGGGGAGATGG - Intergenic
1120272069 14:82325955-82325977 CTGGGTGGACATAGTGGTGTAGG + Intergenic
1121320433 14:92988647-92988669 AGGGGTACACACAGGGGTGAGGG + Intronic
1121760638 14:96441898-96441920 CAGTGGGGACAGAGGGGTGATGG - Intronic
1122706975 14:103628102-103628124 CAGGGTTCACAAAGGGCTGCTGG + Intronic
1122886398 14:104712327-104712349 CAGGGTGCACAGTGGGGTGCCGG + Intronic
1123042048 14:105494301-105494323 CAGGGGGCACCTAGGGGTGTGGG + Intronic
1123398805 15:19963801-19963823 CAGGATGCAGATAGTGGAGAAGG + Intergenic
1126098709 15:45106960-45106982 CAGGGTGCACCTGAGGGAGAGGG + Exonic
1128249664 15:66155430-66155452 TGGGGTGCACACAGAGGTGAAGG + Intronic
1129311773 15:74717787-74717809 CAGAGTTTACTTAGGGGTGATGG - Intergenic
1129787799 15:78320923-78320945 CGGGGGGCAAATAGGGATGAGGG + Intergenic
1131391312 15:92051173-92051195 CAGGGTCCACAGTGAGGTGAAGG + Intronic
1132718897 16:1306356-1306378 CATGGAGCAGGTAGGGGTGAGGG - Intergenic
1133622740 16:7542170-7542192 CAGGTAGCCCATAGGGTTGAGGG - Intronic
1135468768 16:22710918-22710940 GAGGTTGCACATAGGAGAGAAGG - Intergenic
1138421549 16:56902505-56902527 CAAGGTGCAGAGAGGGGTGGGGG + Exonic
1141163913 16:81647816-81647838 CAGGGTGGCCACAGGGATGAGGG - Intronic
1141169305 16:81681039-81681061 CAGGGTGCAGGTGGGGGTCAGGG + Intronic
1141244528 16:82293564-82293586 CAGGGGGATCATAGGGTTGAAGG + Intergenic
1145291377 17:21549277-21549299 CAGGGTTTACACAGGGGTGGGGG + Intronic
1145388698 17:22437776-22437798 CAGGGTTTACACAGGGGTGGGGG - Intergenic
1146499751 17:33354315-33354337 CAGGGGGCTCATAGTGGGGATGG - Intronic
1147376770 17:40027205-40027227 CAATGTGAACATAGGGCTGAAGG + Intronic
1147377719 17:40032807-40032829 CAGAGTCCACAGAAGGGTGACGG - Intronic
1147684211 17:42276982-42277004 CAGGGTGAACCTACGGGGGACGG + Intergenic
1147910529 17:43853398-43853420 GAGGGGGCACATGGTGGTGAGGG + Intronic
1148682227 17:49481043-49481065 CAGAGTGGGCAGAGGGGTGAAGG + Intergenic
1149640551 17:58199809-58199831 CAGGGGGCAAATGGGGGTGAGGG + Intronic
1149986920 17:61354420-61354442 CACCTTGCACAGAGGGGTGATGG - Intronic
1151579760 17:74971468-74971490 CAGGGTGGGGAAAGGGGTGAGGG + Intronic
1151670702 17:75570335-75570357 CAGTGTGCACCTTGGGGGGATGG - Exonic
1152676250 17:81642709-81642731 CAGGGTGCAGGAGGGGGTGAAGG + Intronic
1156490237 18:37491732-37491754 TAGGGTGCACGCAGGGGTGGCGG + Intronic
1157365012 18:47056556-47056578 CAGGGTGCACCTAGGACTAATGG + Intronic
1157546323 18:48549146-48549168 CAGGGTGCACATAGGGGTGATGG + Intronic
1160421010 18:78744280-78744302 CAGTGTTCACACAGTGGTGAAGG + Intergenic
1160490951 18:79336205-79336227 GAGGGTGCACATGGCGGTGCTGG - Intronic
1162582793 19:11540703-11540725 CAGGGGGCACAGAGGGGGCAGGG + Intronic
1163416167 19:17187766-17187788 CAGGGTGCACACGTGGGTGCTGG - Intronic
1163824506 19:19515527-19515549 CAGTGGGCACATGGGGGTGCGGG - Exonic
1165396520 19:35567178-35567200 CAGGGTGGACATGGTGGGGAGGG + Intergenic
1165554300 19:36616901-36616923 CAGGGTGGACAGAGGGATGGAGG + Intronic
1166712145 19:44944596-44944618 CAGGGGACACATAAGGGTAAAGG + Intronic
1167418475 19:49389535-49389557 CAGGGTGCAAAGGGGGGCGATGG - Intronic
1168242610 19:55095070-55095092 CAGTGTGCACCTCGGGGTGGGGG + Intronic
925868297 2:8247823-8247845 CTGGGTGCAGCTAGAGGTGATGG - Intergenic
928629654 2:33177961-33177983 CAGGGGGTACAGAGGGGTGCAGG - Intronic
929502854 2:42504971-42504993 CAAGGTCCACAGAGTGGTGATGG - Intronic
934052203 2:88220373-88220395 TAGGGTGTGCATGGGGGTGAGGG - Intergenic
935944322 2:108271676-108271698 CAGGGTGCACATGGGGGCTGAGG + Intergenic
937335302 2:121058792-121058814 AAGGCTGCCCATAGGGGTGTCGG - Intergenic
941882510 2:170495858-170495880 CATGGAGCACATAGGGATGGTGG - Intronic
942541604 2:177020936-177020958 CAGTGTGAGCATGGGGGTGAGGG - Intergenic
944780176 2:203009551-203009573 CAGGTTGCACATAGTGGAAATGG + Intronic
945048955 2:205805699-205805721 CTGGGTGCCAATAGGGATGAGGG - Intergenic
947796388 2:232896566-232896588 GAGGGTGAAGGTAGGGGTGAGGG + Intronic
947796460 2:232896736-232896758 GAGGGTGAAGGTAGGGGTGAGGG + Intronic
947796478 2:232896790-232896812 GAGGGTGAAGGTAGGGGTGAGGG + Intronic
948208141 2:236173522-236173544 CAGAGGGCACGGAGGGGTGAGGG + Intergenic
1168761375 20:352228-352250 CAGGGTGCACCAATGGGTCAAGG + Intronic
1169289925 20:4340863-4340885 CAGGCTGCCCACAGTGGTGATGG + Intergenic
1171774076 20:29349586-29349608 CAGGGGGCAGAGAGGGGTGGTGG + Intergenic
1171816077 20:29787140-29787162 CAGGGGGCAGAGAGGGGTGGTGG + Intergenic
1171973892 20:31581629-31581651 CAGGGTGCAAATGGGGCTGGGGG - Intergenic
1172162020 20:32875403-32875425 CAGGGGGCACAGAAGGGAGATGG - Intronic
1172225569 20:33303046-33303068 CAGGGTGAACAAAGGGCGGAGGG - Exonic
1172763692 20:37339510-37339532 CAGGGTGGAAAGAGGGGTGGGGG - Intergenic
1175490979 20:59381147-59381169 CAGGGAGCAGAGAAGGGTGAAGG - Intergenic
1175583517 20:60119060-60119082 CAGGGAACACATAGGGGAGCTGG - Intergenic
1175629310 20:60519913-60519935 CAGTGTCTACATAGGGCTGATGG - Intergenic
1176025753 20:62984746-62984768 CCGGGTGCACAGAGGCTTGAAGG + Intergenic
1176409110 21:6438200-6438222 CAGACTGCAGATGGGGGTGAGGG - Intergenic
1176745492 21:10648544-10648566 CAGGATGCAGATAGTGGAGAAGG + Intergenic
1178007243 21:28235179-28235201 CAGGGTGGTCACAGGGGTGTAGG + Intergenic
1178577418 21:33807233-33807255 CAGTGTACACCTAGGAGTGAAGG - Intronic
1179684603 21:43046522-43046544 CAGACTGCAGATGGGGGTGAGGG - Intergenic
1179717792 21:43298718-43298740 GAGGGTGCACATGTGGGTGTAGG - Intergenic
1180319530 22:11307704-11307726 CAGGGTGCAGAGAGGGGTGGTGG + Intergenic
1181625714 22:24120895-24120917 CGGGGGGCATAGAGGGGTGAGGG + Intronic
1182485615 22:30636872-30636894 CAGGGTGAACAGAGGTGTGGTGG - Exonic
1184038084 22:41927984-41928006 TAGGGAGCAGATGGGGGTGAAGG + Intergenic
1184218083 22:43080607-43080629 CAGGGTGCACACAGGCTTGCAGG - Intronic
1184279393 22:43428394-43428416 CAGGGTGGGCACAGGGATGAGGG + Intronic
950860118 3:16140405-16140427 CAAGGTGGACAAAGGGGTAAGGG - Intergenic
951413141 3:22389610-22389632 TTGGGTACACATAGTGGTGATGG - Intergenic
952785147 3:37146455-37146477 GAGGGAGCACAGTGGGGTGAGGG - Intronic
957980913 3:87509576-87509598 CGGGGCGCAGAGAGGGGTGAGGG - Intergenic
965984528 3:174735921-174735943 AAGGGTGAACAGAGTGGTGAGGG + Intronic
966853238 3:184177168-184177190 CAGGGTGCAGCCAGGGGTCAGGG - Intronic
967062205 3:185882260-185882282 CAGGGTGCCCAGAGGGGGGAGGG + Intergenic
976326508 4:83777812-83777834 CTGGGTGAAGATAGGGGTGGAGG + Intergenic
982062638 4:151620209-151620231 GAGGGTGCAGATAGGAGAGATGG + Intronic
985010154 4:185573857-185573879 CAGCGTGCACAGAGTGGTGAGGG + Intergenic
985548573 5:522005-522027 CAGAGTGCACAGTGGGTTGAGGG + Intronic
985875636 5:2591838-2591860 CAGTGTGCACATTGGGGTGGAGG - Intergenic
986703913 5:10439826-10439848 CAGGGTGAACACAGAGGTGATGG - Exonic
986706555 5:10458568-10458590 GATGGTGTACATAGGGGGGATGG - Intronic
988063163 5:26199940-26199962 CAGGCTGCCCATATTGGTGATGG + Intergenic
999992713 5:157063969-157063991 CAGGGATCACAGAGGAGTGAGGG + Intergenic
1000131115 5:158300553-158300575 CATGGTTCACTTAGGAGTGATGG + Intergenic
1001854081 5:174995623-174995645 CAGGGAGGAGAGAGGGGTGAGGG + Intergenic
1006129392 6:31860249-31860271 CTGGGAGCTCATAGGGCTGAGGG + Exonic
1007685520 6:43665233-43665255 CAGAGGGCAGATAGGGCTGATGG - Intronic
1007991658 6:46262331-46262353 CAGGGTGAACAGGGGGCTGATGG - Intronic
1009338628 6:62526086-62526108 CACTGTGCACAGAGGGGTGGTGG - Intergenic
1010096177 6:72048979-72049001 GAGGCTGGACATAGGGGAGAAGG + Intronic
1011741622 6:90366498-90366520 CTGGGTGCATAGAGGGGCGAAGG - Intergenic
1012543988 6:100395711-100395733 CAGGGTGGGCCTAGTGGTGAGGG - Intronic
1012604821 6:101144853-101144875 CAGGGTGCAGAGTAGGGTGAAGG + Intergenic
1012962008 6:105631866-105631888 CATGGTGGAAATAGGGGAGAGGG - Intergenic
1019219553 6:170463265-170463287 CTGGGTGCATAAAGTGGTGATGG + Intergenic
1019480499 7:1264582-1264604 CAGGGTGCACACAGGGTGGGTGG - Intergenic
1019709405 7:2511450-2511472 CAGGCTGCACCTCGGGGAGACGG - Intergenic
1022100264 7:27165175-27165197 GGGGGTGCACGTAGGGGTGGTGG + Exonic
1023310611 7:38882617-38882639 CAGGGTGAAAATAGTGGTGGTGG - Intronic
1024301223 7:47889120-47889142 GTGGGTGCACAGTGGGGTGATGG + Intronic
1024572203 7:50732596-50732618 AAGGGTGCCCAGAGTGGTGAGGG + Intronic
1026117505 7:67508414-67508436 CAGGGTGCACATTGAAATGAAGG + Intergenic
1027187819 7:75982269-75982291 CAAGGTGTACATGGGGGAGATGG + Exonic
1029642885 7:101832250-101832272 CAGGGACCACTGAGGGGTGATGG + Intronic
1031886118 7:127247692-127247714 ATGGAAGCACATAGGGGTGAGGG - Intronic
1033212838 7:139472959-139472981 CAGGGTTCAGTTAAGGGTGAAGG + Intronic
1033630080 7:143148958-143148980 CAGAGTGAACAGAGGGGTGCAGG - Intergenic
1035263344 7:157675278-157675300 CAGGGCTCACATCGAGGTGAGGG - Intronic
1035303377 7:157913370-157913392 AAGGGTGCACTTAGGAGAGAAGG - Intronic
1036848541 8:12185974-12185996 GAGTGTGCTCACAGGGGTGAGGG + Intronic
1036869901 8:12428255-12428277 GAGTGTGCTCACAGGGGTGAGGG + Intronic
1038400329 8:27279649-27279671 CAGGGTGTAGACAGGGGAGAGGG + Intergenic
1039474000 8:37829825-37829847 CAGGGTGGGCAGAGGGGTCACGG - Intronic
1041381597 8:57258848-57258870 CTGGCTGCACAAAGGGTTGAGGG - Intergenic
1042955341 8:74244317-74244339 CTGGGTGAACATAGGGGTGGTGG + Intronic
1047164419 8:122421200-122421222 CAGGGAGGACAGAGGGGGGAAGG + Intergenic
1048793791 8:138129581-138129603 AAGAGTGCACACTGGGGTGACGG + Intergenic
1049600603 8:143505689-143505711 CAGGATGCACATGTGGCTGAGGG - Intronic
1049956100 9:694715-694737 CAGGCTGCACGTAAGAGTGAGGG - Intronic
1050062721 9:1727291-1727313 CAGGGTGCACAATGGGCTCAAGG + Intergenic
1052614118 9:30816120-30816142 CAGGCTGCACATGTGGGTGGCGG + Intergenic
1052640931 9:31165295-31165317 TAGGGTCCACATAGGGGCAATGG - Intergenic
1053274227 9:36771146-36771168 CAGGGGGCACATGGTGGGGAAGG - Intergenic
1053307729 9:36995864-36995886 CAGGGAGCACAGGGGGGTGGAGG - Intronic
1055986887 9:82061986-82062008 CTGGATGCAGAGAGGGGTGAGGG - Intergenic
1056899482 9:90584599-90584621 CAGGATGCTCATCGGGGTGTGGG - Intergenic
1057084203 9:92193647-92193669 CATGTTACACATAGGGGTTAGGG - Intergenic
1057799058 9:98178762-98178784 CAAGATGCACATTGGGGTGCAGG - Intronic
1061664618 9:132153267-132153289 CAGAGTGCTCAGAGGGGTGTAGG - Intergenic
1062077748 9:134601096-134601118 CAGGGTCCACATGGGGGACAAGG - Intergenic
1062187132 9:135224104-135224126 CAGGGTGCCCATAGGCGGGTGGG - Intergenic
1062403161 9:136381331-136381353 CAGGGTAAACACAGGGGTGCTGG + Exonic
1203367761 Un_KI270442v1:273454-273476 CAGGGTGCAGAGATGGGTGGTGG + Intergenic
1189060294 X:37746536-37746558 GTGGGTGGACATGGGGGTGATGG - Intronic
1189308180 X:40002943-40002965 CAGGGTGCAGAGAGGGGAGGAGG + Intergenic
1192318058 X:70067167-70067189 CACGGGGCACATGTGGGTGAAGG + Intergenic
1192545100 X:72006548-72006570 GAGGGTGCACAGAGGTGGGAAGG - Intergenic
1193359924 X:80569976-80569998 CTGGGAGCACAGAGGGGAGAGGG - Intergenic