ID: 1157546550

View in Genome Browser
Species Human (GRCh38)
Location 18:48550528-48550550
Sequence CATGGTCAGCCCCACGGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 162}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157546550_1157546559 29 Left 1157546550 18:48550528-48550550 CCCAGGCCGTGGGGCTGACCATG 0: 1
1: 0
2: 1
3: 16
4: 162
Right 1157546559 18:48550580-48550602 GGCTCCTCTCCACTCTGCTCAGG 0: 1
1: 0
2: 4
3: 41
4: 299
1157546550_1157546555 8 Left 1157546550 18:48550528-48550550 CCCAGGCCGTGGGGCTGACCATG 0: 1
1: 0
2: 1
3: 16
4: 162
Right 1157546555 18:48550559-48550581 GAGACAAATCTGTCCCCTCTGGG 0: 1
1: 0
2: 1
3: 14
4: 147
1157546550_1157546560 30 Left 1157546550 18:48550528-48550550 CCCAGGCCGTGGGGCTGACCATG 0: 1
1: 0
2: 1
3: 16
4: 162
Right 1157546560 18:48550581-48550603 GCTCCTCTCCACTCTGCTCAGGG 0: 1
1: 0
2: 2
3: 38
4: 295
1157546550_1157546554 7 Left 1157546550 18:48550528-48550550 CCCAGGCCGTGGGGCTGACCATG 0: 1
1: 0
2: 1
3: 16
4: 162
Right 1157546554 18:48550558-48550580 AGAGACAAATCTGTCCCCTCTGG 0: 1
1: 0
2: 0
3: 15
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157546550 Original CRISPR CATGGTCAGCCCCACGGCCT GGG (reversed) Intronic
900431220 1:2604075-2604097 CTTGGCCAGCCACACCGCCTGGG + Intronic
900475116 1:2872454-2872476 GAGGGTCAGCCCCAGTGCCTGGG - Intergenic
900609573 1:3538863-3538885 CAAGGCCAGCCCCACGCCCCGGG + Intronic
900610667 1:3543300-3543322 CTTGGTCACCCGCAGGGCCTGGG - Intronic
900830751 1:4963599-4963621 CCTTGTAAGCCCCATGGCCTGGG - Intergenic
900885912 1:5415298-5415320 AATGCTCAGCCCCACAGCCTGGG + Intergenic
901322465 1:8348285-8348307 CAGGGTTAGCCCAACAGCCTAGG - Intergenic
901728662 1:11262309-11262331 CATTGCCGGCCCCACGACCTGGG - Intronic
902331145 1:15731777-15731799 CAGGGTCTGCCCCACCGTCTTGG - Intronic
904363372 1:29993063-29993085 CATGGAAATCCCCAGGGCCTTGG - Intergenic
904631988 1:31849234-31849256 CCTGTGGAGCCCCACGGCCTGGG + Intergenic
907472423 1:54682599-54682621 CTGGGTTAGCCCCACTGCCTTGG + Intronic
917659595 1:177164490-177164512 CATGCACAGCCCCTCGGCCTCGG - Exonic
918464322 1:184806273-184806295 CTTGCTCAGTCCCATGGCCTTGG - Intronic
920534969 1:206731452-206731474 CCTGCACAGCCCCACAGCCTTGG - Intronic
921894618 1:220386844-220386866 CATGGTCAGCCAAAGGCCCTGGG + Intergenic
922004694 1:221517955-221517977 CATGTTCAGCACCACAGCCTGGG + Intergenic
924627929 1:245711186-245711208 CAAGGCCAGACCCACGCCCTGGG + Intergenic
1066166151 10:32790157-32790179 CATGGCCAGCCCCACTCCCAAGG + Intronic
1067848318 10:49739798-49739820 CATGGCCAGCCCCAATGCCCTGG - Exonic
1069657289 10:70099338-70099360 CATGGTCTTTCCCAGGGCCTGGG - Intronic
1069913473 10:71773418-71773440 CATGGGCGTCCCCACGGCCCTGG - Exonic
1073295618 10:102436604-102436626 CATCAGCTGCCCCACGGCCTTGG - Intergenic
1074762170 10:116675267-116675289 GATGGTGAGGCCCACGTCCTGGG + Exonic
1075413555 10:122246711-122246733 CTTGCTCTGCCCCAGGGCCTAGG - Intronic
1075784362 10:125038821-125038843 CAAGGCCAGGCCCACGGCCAAGG + Intronic
1076725118 10:132409544-132409566 CAGGGTGAGCCCCAGGGCCTCGG + Intronic
1076887196 10:133268256-133268278 CAGGGTCCGCCCCACCTCCTGGG - Intronic
1077963118 11:7096520-7096542 CATGGTCAGCTGCACAGCCTGGG - Intergenic
1083397364 11:62401026-62401048 CCTGGTGAGCCCCTCGGCCTGGG + Intergenic
1083740973 11:64711647-64711669 CATAGTCAGCCCCACGGCCCAGG + Intronic
1084749910 11:71197859-71197881 CATGCTCAGCCCCACGGAAAGGG + Intronic
1085017386 11:73183719-73183741 CATGTGCAGGACCACGGCCTGGG - Intergenic
1088064148 11:105695355-105695377 CATGGCCAGGCCCATGGCCTGGG + Intronic
1088829324 11:113521999-113522021 CATGGTCAGCCTCTGGGCCTGGG - Intergenic
1090196466 11:124821026-124821048 CAAGGTCAGCCACACCACCTGGG + Intergenic
1090399992 11:126442959-126442981 CTTGGTCAGCGCCAGGGCCCGGG + Intronic
1090886732 11:130883698-130883720 CATGCTGAGCCCAAAGGCCTAGG - Intronic
1091077433 11:132633557-132633579 CAGGCTCAGACCCAGGGCCTGGG - Intronic
1096694324 12:53339038-53339060 CCTGGTCTGCCCCACCCCCTGGG - Intronic
1097745383 12:63296372-63296394 CATGGGCATCCCCACAGCATGGG - Intergenic
1103943913 12:124516023-124516045 CCTTGTCACCCCCAGGGCCTTGG - Intronic
1113145196 13:107200288-107200310 CATGTGAAGCCCCACTGCCTGGG - Intronic
1113429378 13:110236599-110236621 CATGGCCATGCCCACGTCCTGGG + Intronic
1117719448 14:58614828-58614850 CATGGCCAGTGCCACAGCCTGGG - Intergenic
1119643967 14:76335237-76335259 CATTGTCTGCACCACTGCCTTGG + Intronic
1122389658 14:101371445-101371467 TATAGTGAGCCCCATGGCCTAGG - Intergenic
1123442377 15:20301684-20301706 CAGGGTCAGATCCACGGCATGGG - Intergenic
1129253481 15:74321028-74321050 CATGGTGAGCCCCAACCCCTGGG + Intronic
1129323146 15:74785871-74785893 CAGGGCCAGCCCCATGTCCTAGG - Intronic
1129823913 15:78621848-78621870 CTTTGTCACCCCCATGGCCTGGG - Intergenic
1129878076 15:78989986-78990008 CATGGTCAGCCCCACTTAATAGG + Intronic
1132298401 15:100761397-100761419 CCTGGTCAGCCCCGGGGCCTGGG + Intergenic
1132467077 16:82286-82308 CATGGTCAGTATCACGGGCTGGG - Intronic
1132583845 16:697314-697336 CCGGGCCAGCCCAACGGCCTGGG - Exonic
1132846304 16:2002460-2002482 CCCGGTTAGCCCCACGCCCTCGG + Intronic
1135150219 16:19998952-19998974 CATGGTCAGCGCCAGGCACTAGG - Intergenic
1135179204 16:20258303-20258325 CATGGTCACACTCACAGCCTAGG - Intergenic
1135691344 16:24539997-24540019 CACGAGCGGCCCCACGGCCTAGG - Intronic
1136247556 16:28984487-28984509 CAGGGGCAGCCCCAAGGGCTCGG + Exonic
1136517695 16:30777780-30777802 CATGGCCAGGCCCAGGGCCCAGG + Intergenic
1136862572 16:33712393-33712415 CAGGGTCAGGGCCAGGGCCTGGG - Intergenic
1138217058 16:55213673-55213695 CAAGGTCAGGGCCAAGGCCTTGG - Intergenic
1138415685 16:56870171-56870193 CATGGCCACACCCACGGCATTGG - Exonic
1138589306 16:57990988-57991010 CATTGCCAGCCCCAGGCCCTGGG - Intergenic
1139339583 16:66259374-66259396 CATGGGCAGCCCCAGAGCCCAGG + Intergenic
1140473677 16:75228220-75228242 CATGCTCAGCCCACCTGCCTTGG - Intronic
1141341333 16:83206370-83206392 CATGCCCAGCCCCTTGGCCTGGG - Intronic
1141565607 16:84899733-84899755 CATGGCCAGCCCAAGGGCCCTGG - Intronic
1142357963 16:89612785-89612807 CTTTGTCACCCCCACGACCTGGG - Intergenic
1143408025 17:6690923-6690945 CACGGACAGCCCCGAGGCCTGGG + Exonic
1144693013 17:17281102-17281124 CATGCCCAGCCCGGCGGCCTAGG + Intronic
1144812266 17:18008050-18008072 CAGGGTCAGCCCGAGGGTCTGGG - Intronic
1148739080 17:49881705-49881727 CATGGTCTCCCCCACTGACTGGG + Intergenic
1150291957 17:63987400-63987422 CATGGGCAGCCCTACGGCTGGGG - Intergenic
1151679156 17:75614719-75614741 CATGGGAAGCCCCACGCCCCGGG + Intergenic
1152567795 17:81107916-81107938 CATGGCCTGGCCCGCGGCCTAGG - Intronic
1153804077 18:8696856-8696878 AATGGTCAGCCCCACGGTGATGG - Intergenic
1153927161 18:9844159-9844181 CAGGGTCAGCTCCACAGTCTAGG - Intronic
1154175861 18:12087040-12087062 CAGGGTCAGGGCCAGGGCCTGGG - Intergenic
1156864777 18:41876493-41876515 CAAGGTCTGCCCCATGGCCTTGG + Intergenic
1157546550 18:48550528-48550550 CATGGTCAGCCCCACGGCCTGGG - Intronic
1157586556 18:48804904-48804926 CATCCTCATCCCCAGGGCCTGGG + Intronic
1157597329 18:48871641-48871663 CAGGGTCAGCAGCAGGGCCTTGG - Intergenic
1157614393 18:48978136-48978158 CAGGGTCAGCAGCAGGGCCTTGG + Intergenic
1159915764 18:74186279-74186301 CATGGTCAGCACCTTGGCTTTGG - Intergenic
1161161073 19:2762159-2762181 CAGGGGCAGCCCCCAGGCCTGGG + Intronic
1161245841 19:3251398-3251420 CATGGTCCTCCCCCGGGCCTTGG - Intronic
1162498053 19:11034508-11034530 CCTGGTCAGTCCCTTGGCCTTGG - Intronic
1165840865 19:38788593-38788615 CCTGGGCAGCCCAAGGGCCTGGG + Intergenic
1167434347 19:49470436-49470458 CATAGGCAGCCACAGGGCCTTGG - Exonic
1168484367 19:56748296-56748318 CATGGCCATCCCCACAGCCCTGG - Intergenic
925467509 2:4121021-4121043 CATGCTCAGTTCCAAGGCCTTGG - Intergenic
925467840 2:4125601-4125623 CATGCTCAGTTCCAAGGCCTTGG + Intergenic
927643680 2:24861710-24861732 CAACGTCAGCCCCAATGCCTTGG + Intronic
931791341 2:65666653-65666675 CCTGGCCATCCCCACGGCCAGGG - Intergenic
932391602 2:71395593-71395615 AATTGTCACCCCCACCGCCTTGG - Intronic
934853360 2:97714841-97714863 CATCCTCAGCCCCACTGCCCTGG + Intronic
937277462 2:120694619-120694641 CATGATCAGCCCCTCTTCCTTGG + Intergenic
938733056 2:134161287-134161309 CAAGGCTAGCCCCACGGCCTTGG - Intronic
944353173 2:198754392-198754414 CATGGTCTTCCCCACAGCATAGG - Intergenic
946361831 2:219223577-219223599 CATGGTCATCCCCAGGTACTGGG - Exonic
948652717 2:239458534-239458556 CAGAGGCAGCCCCACGACCTTGG - Intergenic
948886591 2:240888036-240888058 CAGGGTCAGACCCACTGCCCTGG + Intronic
948908117 2:240989467-240989489 CATGTTCAGCCCGTGGGCCTTGG - Intronic
1170583360 20:17715625-17715647 CAGGGTCAGGCCCATGGCTTAGG - Intronic
1172946402 20:38692965-38692987 AATTGACAGCCCCACGGCCCTGG + Intergenic
1175822148 20:61915802-61915824 CACGGCCAGCCCCACGGCCAAGG - Intronic
1175910785 20:62404643-62404665 CAAGGTCAGCACCACGAACTTGG + Intronic
1177459922 21:21396836-21396858 CATGGGGAGCCCCAAGGTCTAGG + Intronic
1179040901 21:37801509-37801531 CACGGGCAGCCCCAGGGCATGGG + Intronic
1179134442 21:38667461-38667483 CAGGGAAAGCCCCAAGGCCTGGG - Intergenic
1181541018 22:23573416-23573438 CGTGGTCATCTCCACGCCCTGGG + Exonic
1181797362 22:25319914-25319936 CGTGGTCATCTCCACGCCCTGGG - Intergenic
1181854985 22:25775063-25775085 CCTGCTCAGGCCCACTGCCTAGG - Intronic
1181891123 22:26064681-26064703 CAAAGTCAGCCCCAAGGCATGGG - Intergenic
1183044398 22:35208159-35208181 CAGGGTCAGCCCCACCCCCAAGG + Intergenic
1183581339 22:38728335-38728357 CATGGTCACCACCACTGCCCAGG - Intronic
1184751125 22:46487517-46487539 CATGGTGAGCCCCACGGGGGAGG + Intronic
1184759267 22:46535743-46535765 CGTGTTGAGCCCCACGTCCTCGG + Exonic
1185100110 22:48835852-48835874 CATGGTCAGCCCCCAGGTCAGGG + Intronic
1185359921 22:50399883-50399905 CATGGTCAGCCCTAGAGCCTGGG + Intronic
1185384184 22:50524245-50524267 CAGGGCCAGCCCCAGGGCCCTGG - Exonic
949486062 3:4539781-4539803 CATGCTCAGCCCCATCGCCATGG + Intronic
950496772 3:13338606-13338628 CCTGGCCCACCCCACGGCCTTGG + Intronic
951487880 3:23234450-23234472 CATGGTCAGCCCCATCAGCTGGG + Intronic
953878666 3:46680491-46680513 GCTGGTCAGCGCCACGGCCCAGG - Exonic
953981463 3:47415222-47415244 CATGCTCAGCCCCAGGGCTGGGG - Intronic
954116548 3:48469810-48469832 GATGGTCAGGCCAACGGCCAAGG + Exonic
954794292 3:53153712-53153734 CATGGTCAGCCTCAGGGCTGGGG + Intergenic
959974013 3:112437654-112437676 CAAGGTCTGCTCCAGGGCCTTGG - Intergenic
961403862 3:126665494-126665516 CCTGGCCCACCCCACGGCCTTGG - Intergenic
961479060 3:127167843-127167865 CGGGCTCAGCCCCACAGCCTGGG - Intergenic
965720580 3:171656881-171656903 CAAGGTCATCCCCACTCCCTAGG + Intronic
967528137 3:190517567-190517589 GATGAACAGCCCCACTGCCTGGG - Intronic
975581983 4:75915395-75915417 CTTGGTCTCCCCCACTGCCTTGG - Intronic
981363133 4:143870701-143870723 CATGGTAAACCCCCCCGCCTCGG + Intergenic
982220920 4:153124480-153124502 AGTGGTCAGCCCCATGCCCTTGG - Intergenic
987053276 5:14166237-14166259 CAGGCTCAGACCCAGGGCCTTGG - Intronic
996616942 5:125453318-125453340 CATTCTCAGCCTCACTGCCTTGG - Intergenic
999153209 5:149440522-149440544 CAGGCTCAGCCCCAGGGCCAAGG - Intergenic
1001818806 5:174693737-174693759 CAGGGTCAGTCCCAGGGACTGGG - Intergenic
1003074387 6:2971089-2971111 CCCGGTCGGCCCCGCGGCCTCGG - Intronic
1005956877 6:30670391-30670413 CATGGTGAGTCCCAGGGCCTAGG - Exonic
1007112769 6:39322559-39322581 CATAGCCAGCCCCACGGCCCTGG - Intronic
1007728556 6:43931950-43931972 CATGGTGAGCCCCAAGCACTTGG + Intergenic
1008554653 6:52663243-52663265 CATGGAAAGTCCCATGGCCTTGG + Intergenic
1014817255 6:125949799-125949821 CGTGGTCAGCACCAGGACCTTGG - Intergenic
1015913616 6:138192578-138192600 CATGGCCAGCCCTTAGGCCTAGG - Intronic
1017817527 6:158026606-158026628 CCTGGGCAGGACCACGGCCTGGG - Intronic
1020017104 7:4837446-4837468 CATCGGCAGCCCCATGGGCTGGG - Intronic
1024844983 7:53632994-53633016 CATGCTCAGCCCCAGTGCCCTGG - Intergenic
1026545573 7:71318971-71318993 CCTGGTCAGCCCAATGACCTTGG - Intronic
1029309939 7:99653717-99653739 CAGGGTCAGCCCCACAGGCCAGG + Intronic
1029448262 7:100626886-100626908 CAGGGTCAGCCCGCGGGCCTGGG + Exonic
1029465204 7:100720872-100720894 CAGGGCCAGCCCCACGGGCCTGG - Exonic
1029962692 7:104705678-104705700 CATGCTCAACCTCATGGCCTGGG - Intronic
1029966051 7:104741934-104741956 CATGATCAGCCCCAGAGCCAGGG - Intronic
1034274382 7:149817678-149817700 CCTGGTCAGCCCCTCGGGCCTGG + Intergenic
1036644069 8:10601275-10601297 CAGGGCCAGCCCCTCAGCCTGGG - Intergenic
1037838194 8:22226981-22227003 CATGGGCAGCGGCACTGCCTTGG + Exonic
1037991717 8:23326092-23326114 CAGGGTCAGCCCCTCAGCCCTGG - Intronic
1038424320 8:27454526-27454548 CAGGGTCAGCCCCACATTCTGGG - Exonic
1038950252 8:32406250-32406272 CATGGTCAGGGGCACGGTCTCGG + Intronic
1044732029 8:95236720-95236742 GATGCTCAGCACCACGTCCTCGG - Intergenic
1049180198 8:141218290-141218312 CTTGATCAGCACCACGGCGTTGG + Exonic
1052955471 9:34250377-34250399 AATGGTCAACTCCACAGCCTGGG - Intronic
1053284080 9:36839288-36839310 GATGGTCAGGGCCACGGCCAAGG - Exonic
1060002522 9:119971172-119971194 CATGGACACCAACACGGCCTTGG - Intergenic
1060402296 9:123356021-123356043 CCAGGTCAGCCCCACAGGCTAGG + Intergenic
1061194411 9:129099987-129100009 CCCGGTCAGCCCCAGGGCCCTGG + Intronic
1061995964 9:134185994-134186016 CATGGGCAGCCCCTCGGCCCAGG - Intergenic
1062273353 9:135719723-135719745 CATGGCCAGGGCCACTGCCTTGG + Intronic
1062678377 9:137762041-137762063 CATGGTCAGGCAGGCGGCCTTGG - Intronic
1189472283 X:41323297-41323319 GATGGTCAGGCCGACGGCCACGG + Intergenic
1194415552 X:93606930-93606952 TTTGGACAGCCCCAGGGCCTGGG + Intergenic
1199746389 X:150774456-150774478 CATGGCCTTCCCCACGGCCAGGG - Intronic
1200077998 X:153561325-153561347 GCTGGTCAGCCCCACTGTCTAGG + Intronic
1200154046 X:153965876-153965898 CATGGTCAGCCGCCTGGCCCTGG - Intronic
1200211674 X:154349411-154349433 CTTGCTCAGCCCCAGGCCCTTGG + Exonic