ID: 1157550201

View in Genome Browser
Species Human (GRCh38)
Location 18:48576071-48576093
Sequence GGCGCCGCTGCCCGAGGACC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157550201_1157550210 23 Left 1157550201 18:48576071-48576093 CCCGGTCCTCGGGCAGCGGCGCC No data
Right 1157550210 18:48576117-48576139 CCCCCTTGCCCTGGCCCGAGAGG No data
1157550201_1157550204 -4 Left 1157550201 18:48576071-48576093 CCCGGTCCTCGGGCAGCGGCGCC No data
Right 1157550204 18:48576090-48576112 CGCCTGTGTACAGAGCACCCAGG No data
1157550201_1157550208 14 Left 1157550201 18:48576071-48576093 CCCGGTCCTCGGGCAGCGGCGCC No data
Right 1157550208 18:48576108-48576130 CCAGGTGTGCCCCCTTGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157550201 Original CRISPR GGCGCCGCTGCCCGAGGACC GGG (reversed) Intronic