ID: 1157555027

View in Genome Browser
Species Human (GRCh38)
Location 18:48607800-48607822
Sequence GGTGTCACTCAGCAGAAACT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157555027_1157555031 18 Left 1157555027 18:48607800-48607822 CCGAGTTTCTGCTGAGTGACACC No data
Right 1157555031 18:48607841-48607863 GGCTATCTTCAGCCAGGTTATGG No data
1157555027_1157555028 -3 Left 1157555027 18:48607800-48607822 CCGAGTTTCTGCTGAGTGACACC No data
Right 1157555028 18:48607820-48607842 ACCATCTTCTATAATAGCTGTGG No data
1157555027_1157555030 12 Left 1157555027 18:48607800-48607822 CCGAGTTTCTGCTGAGTGACACC No data
Right 1157555030 18:48607835-48607857 AGCTGTGGCTATCTTCAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157555027 Original CRISPR GGTGTCACTCAGCAGAAACT CGG (reversed) Intronic