ID: 1157555618

View in Genome Browser
Species Human (GRCh38)
Location 18:48611127-48611149
Sequence ACTGGGACCTTGGGGGCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 273}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157555618_1157555629 17 Left 1157555618 18:48611127-48611149 CCTTCAGCCCCCAAGGTCCCAGT 0: 1
1: 0
2: 0
3: 23
4: 273
Right 1157555629 18:48611167-48611189 AGCAGCTGAAGAGCTGTTGAGGG 0: 1
1: 0
2: 1
3: 16
4: 210
1157555618_1157555623 -7 Left 1157555618 18:48611127-48611149 CCTTCAGCCCCCAAGGTCCCAGT 0: 1
1: 0
2: 0
3: 23
4: 273
Right 1157555623 18:48611143-48611165 TCCCAGTGTCCTCACCTGCGTGG 0: 1
1: 0
2: 1
3: 34
4: 209
1157555618_1157555630 21 Left 1157555618 18:48611127-48611149 CCTTCAGCCCCCAAGGTCCCAGT 0: 1
1: 0
2: 0
3: 23
4: 273
Right 1157555630 18:48611171-48611193 GCTGAAGAGCTGTTGAGGGCAGG 0: 1
1: 0
2: 3
3: 20
4: 222
1157555618_1157555628 16 Left 1157555618 18:48611127-48611149 CCTTCAGCCCCCAAGGTCCCAGT 0: 1
1: 0
2: 0
3: 23
4: 273
Right 1157555628 18:48611166-48611188 CAGCAGCTGAAGAGCTGTTGAGG 0: 1
1: 0
2: 1
3: 17
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157555618 Original CRISPR ACTGGGACCTTGGGGGCTGA AGG (reversed) Intronic
900086212 1:898843-898865 ACTGGGAGCTTGTGAGCGGATGG + Intergenic
900347438 1:2216422-2216444 ACAAGGACCTTGGAGGCTGAGGG - Intergenic
900474456 1:2869638-2869660 ACTGCGTCCTTGGGGCCTGTGGG - Intergenic
900476510 1:2878780-2878802 CCTGTCCCCTTGGGGGCTGAAGG - Intergenic
900647321 1:3714840-3714862 TCTGGGGCCTTGGGGACAGAGGG - Intronic
900649086 1:3722348-3722370 ACTGGGAAAATGGGGGCTGGTGG - Intronic
900909701 1:5586429-5586451 ACTGTGTCCTTGAGGGCCGAGGG + Intergenic
901510376 1:9715475-9715497 ACTGGGAGGTGGGAGGCTGAGGG - Intronic
902408518 1:16199563-16199585 AGTTGGACGTTGGGGTCTGAAGG - Intronic
903154037 1:21431753-21431775 GCTGGACACTTGGGGGCTGAGGG - Intergenic
903190695 1:21653983-21654005 AGAGGGGCCATGGGGGCTGAAGG + Intronic
904321694 1:29701933-29701955 CCTGGGACCCTGGGGACAGAGGG + Intergenic
904436805 1:30504390-30504412 ACTAGGGCCTTGGGGACAGAAGG + Intergenic
904497546 1:30895701-30895723 ACAGGGGTCTTGAGGGCTGAGGG - Intronic
904622723 1:31784964-31784986 CCTGGGGCAGTGGGGGCTGAGGG + Intergenic
904897094 1:33825309-33825331 GCTGGGATCTTGGGGGCTGTAGG - Intronic
910790015 1:91041471-91041493 ACTAGGAGCTAGGGGCCTGAAGG - Intergenic
911039244 1:93579075-93579097 ACTAGGCCCTTGGGGGGTGGGGG + Intronic
912158917 1:106956834-106956856 ACTGATACCTTGGGACCTGAAGG + Intergenic
912420465 1:109539197-109539219 ACTGGGGCTGTGAGGGCTGATGG - Intergenic
912875282 1:113351596-113351618 AATGGGACCTTGGTGGGAGAGGG - Intergenic
915140353 1:153764049-153764071 ACTGGGATCGTGGGGGCAGGAGG + Intronic
915531197 1:156503155-156503177 TCTGGGACCCAGGGGTCTGACGG - Intergenic
916553399 1:165871637-165871659 GTTGGGATCTTGGGAGCTGAAGG + Intronic
918533762 1:185551650-185551672 ATTGGGACTTTGGGAGGTGAGGG + Intergenic
919717121 1:200790327-200790349 ACTGGAACCATGGGGGCAGCGGG + Intronic
919815017 1:201431722-201431744 ACGGGGGCCTTGGGAGCTGGGGG + Intergenic
919879436 1:201892132-201892154 GCTGGGATCTTGGGAGCAGAGGG - Exonic
919910873 1:202109986-202110008 CCTGTGGCCTTGCGGGCTGAGGG - Intergenic
919944598 1:202310066-202310088 ACAGGGAACTTGGGAGTTGAAGG + Intronic
921302481 1:213764387-213764409 CCTGGGCCCTTGGGTGCTGGAGG - Intergenic
921907762 1:220513179-220513201 ACTGGAACCTGGGAGGCAGAGGG + Intergenic
922302293 1:224312214-224312236 AATGGGACCCTTGGGCCTGAGGG - Intronic
922806675 1:228393904-228393926 GCTGGGACCCTGGGTCCTGAGGG + Exonic
1062944590 10:1450758-1450780 CCTGGGGCTTTGGGGGCTGCAGG + Intronic
1063382013 10:5591519-5591541 ACTGGGGCCCTGCGGGCTGTGGG - Intergenic
1063469613 10:6273837-6273859 ACTGGGTCCTTTGAGGCTGCGGG - Intergenic
1064432594 10:15283988-15284010 TCTGGCACCTCGGGGACTGATGG - Exonic
1066246551 10:33589102-33589124 ACTGGGAAATGGGGGGATGATGG + Intergenic
1067761858 10:49054421-49054443 AGTGGGGTCTTGGGGACTGAGGG + Intronic
1069283762 10:66688449-66688471 ACGGGAATGTTGGGGGCTGAGGG - Intronic
1069743196 10:70698666-70698688 CCTGATCCCTTGGGGGCTGATGG + Intronic
1069945074 10:71979889-71979911 AGTGGGAGCATGGGGGCTGGAGG + Intronic
1072981184 10:100099028-100099050 ACTGGGACATTGGGGGATTTGGG + Intergenic
1074336587 10:112582436-112582458 ACAGCGACCTTGGGGGCTGCTGG - Intronic
1074421167 10:113309769-113309791 AGTGGGCCCCTGGGGGCTGGGGG + Intergenic
1074912822 10:117927198-117927220 ATTGTGACCTTGGAGGCAGAAGG - Intergenic
1075098190 10:119487450-119487472 AATGGCACCTTGGCTGCTGAAGG + Intergenic
1075263183 10:120980139-120980161 GCTCAGCCCTTGGGGGCTGAGGG + Intergenic
1076353182 10:129832578-129832600 ACTGGGAGGCTGGGGGCTGGTGG + Intergenic
1076494795 10:130889989-130890011 CCCAGGACCTTGTGGGCTGAGGG - Intergenic
1077089976 11:773951-773973 CCTGGGACCTTGGAGGGTCAAGG - Intronic
1077722108 11:4639562-4639584 ACTGGGGCCTTGGAGGGTCAGGG + Intergenic
1077808515 11:5613560-5613582 ACTGGGACCTATGGGGCTGGTGG + Intronic
1078529717 11:12127608-12127630 ACTGGGACTTTGGGAGCACAGGG + Intronic
1081570657 11:44288897-44288919 AGAGGGGCCATGGGGGCTGAGGG - Intronic
1081865155 11:46355676-46355698 GGTGGGGCCCTGGGGGCTGATGG + Intronic
1082721919 11:56688726-56688748 ACTGTGACCTTGGGTGATAATGG + Intergenic
1083270649 11:61570665-61570687 TCTGGGACCTTGGGAACTCAGGG - Intronic
1084111071 11:67014582-67014604 ACTGGGAGCTTGGGGCCTTGTGG + Intronic
1084115340 11:67039909-67039931 ACTGGGGCCTCTGGAGCTGATGG + Exonic
1085928015 11:81045450-81045472 ACTGGTCCCTTGAGAGCTGAGGG + Intergenic
1086400424 11:86457004-86457026 ACTTGGACATTGGAGGCAGAGGG - Intronic
1088365130 11:109032416-109032438 ACAAGAACCTTGGGGGCAGAGGG - Intergenic
1091020194 11:132092594-132092616 ACTGGAACCTTGGAGCATGATGG - Intronic
1091112644 11:132984373-132984395 ACTGGGACCTTGGGGAAATAAGG + Intronic
1091694381 12:2618054-2618076 AAGGGGACTTTGGAGGCTGAGGG + Intronic
1100757902 12:97772789-97772811 TCTGGGGCTTTGGGGGCTGTGGG - Intergenic
1101962971 12:109264038-109264060 TGGGGGACCTAGGGGGCTGAGGG + Intronic
1104684728 12:130777426-130777448 GCTGGATCCTGGGGGGCTGAGGG + Intergenic
1104926387 12:132316160-132316182 ACTGGGACGCTGGGGTCTGTGGG - Intronic
1106555545 13:30805358-30805380 ACTTGGACCTTGGGGTGGGAGGG + Intergenic
1108493820 13:51005432-51005454 ACTGGGGCCTCGGGGGATGGGGG + Intergenic
1111483195 13:88859904-88859926 ACTGGGACCATTTTGGCTGAGGG + Intergenic
1112798806 13:103087950-103087972 GCTGGGACCCAGGGGGCAGATGG + Intergenic
1112868175 13:103934405-103934427 CCTGGGAGCCTGGGGACTGAAGG - Intergenic
1113928031 13:113952050-113952072 TCTGGTTCCTTGGGGGCTGTCGG - Intergenic
1114050415 14:18916363-18916385 GCTGGGAGCTTGGGCTCTGAGGG + Intergenic
1114112143 14:19485569-19485591 GCTGGGAGCTTGGGCTCTGAGGG - Intergenic
1114518768 14:23320160-23320182 TCTGGGATCTTGGGGGCTTGAGG + Intronic
1117230489 14:53712208-53712230 ACTTGGACCTAGGAGGCTGTAGG + Intergenic
1118776456 14:68977301-68977323 CCTGGGACCATGGGTGCTGTGGG - Intronic
1119404488 14:74389084-74389106 TCTGGGTCCTTAGGGGCTGCTGG + Intergenic
1119659364 14:76439439-76439461 ACTGGGGCTGTGGTGGCTGAGGG - Exonic
1120541746 14:85759566-85759588 ACTTGGACTTTGGGGACTCAGGG - Intergenic
1121218094 14:92264154-92264176 ACTGTGAGCTGGGGGGCTGCAGG + Intergenic
1121315584 14:92959274-92959296 CCTGGGGCCCTGCGGGCTGAGGG - Intronic
1121430297 14:93881755-93881777 ACTGAGAGCCAGGGGGCTGAGGG - Intergenic
1121610647 14:95276454-95276476 AGGGGGAACTTGGGAGCTGATGG + Intronic
1122001790 14:98664335-98664357 GCTGGAACCTTTGGGGCAGATGG + Intergenic
1122792750 14:104191258-104191280 AATGGGAACTTGGAGGCTTAGGG + Intergenic
1122804001 14:104247614-104247636 ACAGGGCCTTTGGGGGCTGCTGG + Intergenic
1122825944 14:104370497-104370519 GAAGGGACCTTTGGGGCTGAGGG + Intergenic
1125151476 15:36537395-36537417 ACTGAGACTTTAGGGGGTGACGG + Intergenic
1125608832 15:40957520-40957542 ACTTGTACCCAGGGGGCTGAAGG - Intergenic
1125830949 15:42716804-42716826 TTTGGGGACTTGGGGGCTGATGG + Intronic
1126373347 15:47970164-47970186 ACTGGGACAATGGGCTCTGAAGG + Intergenic
1127788946 15:62381175-62381197 ACTGGGGTGTTGGTGGCTGATGG - Intergenic
1128384093 15:67134970-67134992 AGCAGGACCCTGGGGGCTGAAGG - Intronic
1128617413 15:69121079-69121101 ACTGGGCCTTTGGGGGGTTACGG + Intergenic
1129295938 15:74600135-74600157 ACCCTGGCCTTGGGGGCTGAAGG + Intronic
1129359888 15:75018153-75018175 AGTGGTTTCTTGGGGGCTGAGGG + Intronic
1129375332 15:75126606-75126628 ACAGGGACCTTGGGGACAGAGGG + Intergenic
1129711159 15:77820757-77820779 GGTGGGACTCTGGGGGCTGAGGG - Intronic
1131107349 15:89744097-89744119 TGTGGAACCTTGGAGGCTGAGGG + Intergenic
1131393655 15:92069618-92069640 ACCAGGACCTTGGGGGCAGAGGG + Intronic
1131605935 15:93902221-93902243 ACAGGGACCATGGGGATTGAAGG + Intergenic
1132305013 15:100804799-100804821 ACTGTGGCTTTGGGGCCTGAAGG + Intergenic
1132659712 16:1055891-1055913 ACTGTGGCCTTGTGGGGTGAGGG + Intergenic
1132670890 16:1101953-1101975 GCTGGGGTCTTGGGGGCTGGGGG - Intergenic
1132810292 16:1793894-1793916 AATGCGGCCCTGGGGGCTGACGG + Intronic
1133809362 16:9149268-9149290 TCTGAGACCTTCAGGGCTGAGGG - Intergenic
1135181668 16:20279912-20279934 TCTGAGATCTTGGGTGCTGAAGG + Intergenic
1135407743 16:22210167-22210189 CCTGGGACTTTGGGGGTTGTGGG - Intronic
1136670814 16:31855263-31855285 ACTGTCACCATGGGGGCTGAAGG + Intergenic
1137562285 16:49510648-49510670 CATGGGGCCTTGGGGCCTGAGGG - Intronic
1139401731 16:66687413-66687435 CCTTGGACTTTGGGAGCTGAAGG + Intronic
1140760384 16:78103814-78103836 ACTGAGACCTCGGGGTCTGGTGG + Intronic
1141806944 16:86348061-86348083 GCTGGAACCTTTGGGGCTCAGGG + Intergenic
1142245198 16:88967164-88967186 AGTGGCACCTCGGGGGCTGGGGG - Intronic
1142245217 16:88967218-88967240 AGTGGCACCTCGGGGGCTGGGGG - Intronic
1143612060 17:8024431-8024453 ATTGGAATCTTGAGGGCTGAAGG + Intergenic
1143658587 17:8311502-8311524 ACTGGGAAATGGGGGGCGGAGGG + Intronic
1144177708 17:12723079-12723101 ACTAGGATCTTTGGGGATGAGGG + Intronic
1144704909 17:17362049-17362071 ATTGGGAACATGGGGTCTGAGGG + Intergenic
1144889182 17:18484177-18484199 AATGGGGCCCTGGGAGCTGAAGG + Intronic
1145143026 17:20460119-20460141 AATGGGGCCCTGGGAGCTGAAGG - Intronic
1145792847 17:27638566-27638588 AATGGGGCCCTGGGAGCTGACGG + Intronic
1145807713 17:27746435-27746457 AATGGGGCCCTGGGAGCTGACGG + Intergenic
1145941745 17:28746353-28746375 ACAGGCTCCTTGGGTGCTGACGG + Intronic
1147534855 17:41313615-41313637 ACTGGGAATTTTGGGGGTGATGG + Intergenic
1151698808 17:75731719-75731741 CCTAGGAACTTGGGGGCCGAGGG + Intronic
1151932096 17:77238929-77238951 ACTGGGACTCTGGGGCCAGATGG + Intergenic
1152045188 17:77930695-77930717 ACTGGGGCCTGGGGAGCTGCAGG - Intergenic
1152785792 17:82247279-82247301 ACGGCCACCTTGGGGGCTGGTGG + Intronic
1155286456 18:24293712-24293734 ACTGGGAGGTGGGGGGCTGAGGG + Intronic
1155306543 18:24484220-24484242 AGTGGAACCCTGGGGGCTGACGG - Intergenic
1157281383 18:46348293-46348315 ACAGGGAGCTGGGGGACTGATGG + Intronic
1157555618 18:48611127-48611149 ACTGGGACCTTGGGGGCTGAAGG - Intronic
1161347954 19:3777443-3777465 ACTTGGACCTTGAGGGCTGTTGG + Intergenic
1161354867 19:3813407-3813429 ACTGGGACTGTGGTGACTGATGG + Intronic
1162001282 19:7746605-7746627 CCTGGGTCCTGGGGTGCTGAGGG - Intronic
1162003894 19:7765090-7765112 CCTGGGTCCTGGGGTGCTGAGGG + Intronic
1162054832 19:8056273-8056295 AGTGGGGCCGTGGGGGCTGGGGG + Intronic
1162228733 19:9247282-9247304 TCTAGGGCCTTGGGGGCTCAAGG - Intergenic
1162502098 19:11059928-11059950 GCTGGGGCCTTGGGGGCTCTCGG - Intronic
1162525343 19:11203377-11203399 ACCAGGACCCTGGGGGTTGAGGG - Intronic
1163655791 19:18543901-18543923 ACTCTCACCTTGGGGGCTGCTGG + Intronic
1164977208 19:32581839-32581861 ACCGGGACCTTAGGGACGGAGGG + Intronic
1165346188 19:35249930-35249952 AGTGGGGCCTTGGGCGCTGGGGG + Intronic
1165384846 19:35504219-35504241 ACAGGGAACTTAGGGTCTGATGG - Intronic
1165454489 19:35902778-35902800 CCTGGGTCCTTGGGGGCGGAAGG + Intronic
1165809840 19:38605678-38605700 CCTGGGAGCATGGGGGATGATGG - Exonic
1166558228 19:43715814-43715836 ACTTTGTCCTTGGGGGGTGATGG + Intergenic
1167094871 19:47369798-47369820 ACTGGGTCCTAAGTGGCTGAAGG + Intronic
1167250350 19:48395823-48395845 CCTGGGTCCTTGGGGGAAGAGGG + Intronic
1167357249 19:49011523-49011545 ACTGCAGCCTTGGGGGCTAAAGG - Intronic
1167388436 19:49178485-49178507 ACATGAAGCTTGGGGGCTGATGG + Intronic
1167548578 19:50144031-50144053 AATGGGACCTTGATGGCCGAGGG - Intergenic
926393986 2:12423086-12423108 TCTGGGTCCTTCTGGGCTGATGG + Intergenic
926722561 2:15971974-15971996 CCTAGGACCTTGGGAGATGAAGG + Intergenic
927055989 2:19365933-19365955 ACTGGCTACTAGGGGGCTGAAGG + Intergenic
928021954 2:27712403-27712425 ACTGGGAACGTTGGAGCTGAGGG + Intronic
929612099 2:43278536-43278558 TCTGGCAGGTTGGGGGCTGAGGG + Intronic
929995525 2:46823901-46823923 GCTGGGGTCTTGTGGGCTGAGGG + Intronic
932335144 2:70926608-70926630 ACTGGGAACCTCTGGGCTGAGGG - Intronic
932581814 2:72996988-72997010 ACTGGGGACTTGGTGGGTGAAGG - Intronic
933774014 2:85761015-85761037 GCTGGGCTGTTGGGGGCTGAGGG + Intronic
933810101 2:86027766-86027788 AGTGGGATCTTGGGATCTGAGGG - Intronic
934962748 2:98691355-98691377 ACTGGAGCCTAGGAGGCTGATGG + Intronic
935063824 2:99631127-99631149 CCTGGGACTTTGGCGGCCGAGGG - Intronic
936012571 2:108934319-108934341 ACTGGGCGCTGGGGGGCTGACGG + Intronic
937135738 2:119550502-119550524 AATGTGACCTTGGAGGTTGATGG - Intronic
938062784 2:128265922-128265944 GCTGGACACTTGGGGGCTGAGGG + Exonic
941333464 2:164209966-164209988 AATGGAACCTTGGACGCTGAGGG + Intergenic
943731124 2:191305067-191305089 ACTGAGGCCTTGGCTGCTGAAGG + Intronic
944543520 2:200777087-200777109 ACTGGGAAATGGGGGGCAGAAGG + Intergenic
947524886 2:230871845-230871867 CCTGGGCCCTGGGGAGCTGAGGG - Intronic
947935803 2:234002365-234002387 ACTGTGACTTGGTGGGCTGAGGG - Intronic
948376876 2:237526474-237526496 ACGGGGACCTTGGAGGCTTTGGG + Intronic
1169084151 20:2816492-2816514 CCTGGGACCTTGGGGGGGGGGGG - Intronic
1170678322 20:18502658-18502680 ACTGGGAGCCAGGGGGATGATGG + Intergenic
1172135469 20:32683862-32683884 ACTGGAACCTGGGAGGCAGAGGG - Intergenic
1172499251 20:35413254-35413276 ACTGGTGCTTTGGGGGTTGAGGG + Intergenic
1172766147 20:37352008-37352030 ACTGGGATCTTGGGTGCTCACGG + Intronic
1173495607 20:43515194-43515216 AATGAGGCTTTGGGGGCTGAAGG - Intronic
1173847627 20:46198061-46198083 CCTGAGACCTTGAGGGCTGATGG + Intronic
1174380563 20:50153154-50153176 ACCGGGTCCTGGGGGGATGAGGG + Intronic
1175156920 20:56977438-56977460 ACTTGGACCTAGGTGGCTGCAGG - Intergenic
1175372170 20:58499454-58499476 ACTGGGAAACTGGAGGCTGAGGG - Intronic
1176267026 20:64215028-64215050 GCTGGGACCTGCAGGGCTGAAGG - Intronic
1179958900 21:44757472-44757494 ACGGGGACCCTGGGACCTGATGG + Intergenic
1180468891 22:15638737-15638759 GCTGGGAGCTTGGGCTCTGAGGG + Intergenic
1181466744 22:23114471-23114493 ACTGGACCTCTGGGGGCTGAGGG - Intronic
1182010296 22:26995101-26995123 ACTGGGAGCCTGGAGGGTGAAGG + Intergenic
1182355990 22:29722421-29722443 CCTGGGCCCTGGGGAGCTGAGGG + Intronic
1182444026 22:30379945-30379967 TCTGTGGCCCTGGGGGCTGAAGG + Intronic
1185032099 22:48449565-48449587 GCTGGGACCTGGGGGGCTCTTGG + Intergenic
950120490 3:10479287-10479309 ATGGGGTTCTTGGGGGCTGAAGG - Intronic
952967723 3:38631533-38631555 ACTGGGCTTTTGGGGGCTGGTGG - Intronic
953383712 3:42492874-42492896 TCTGGGGCTTTGGGGACTGAGGG - Intronic
953891541 3:46755218-46755240 ATTGGGACCTTGGGGCTTGGGGG - Intronic
954003927 3:47578045-47578067 ACTGGGGCGGTGGGGTCTGAGGG - Intronic
957076349 3:75605980-75606002 ACTGGCACCTGGAGGGCTGTGGG - Intergenic
960435601 3:117622758-117622780 AATGGGACCTTAGGCGATGACGG + Intergenic
960873210 3:122271754-122271776 ACTGGGGCTTTGGGGGCCTAGGG - Intronic
961919817 3:130414093-130414115 ACAGGCACATTGGGAGCTGAAGG + Exonic
962240986 3:133750655-133750677 ACTGGTGCCTCGGGGGCTCAGGG - Intronic
962462598 3:135628406-135628428 ACTTGGACCTTGAGGGATGAAGG - Intergenic
962972556 3:140417525-140417547 ACTCGGAGAGTGGGGGCTGAGGG - Intronic
964017812 3:151968785-151968807 ACTTGGACTTTGGGGACTCAGGG + Intergenic
965484965 3:169267520-169267542 AAAGGGACCTGTGGGGCTGAGGG + Intronic
965803506 3:172518162-172518184 ACTTGGGCATTGGGGGCAGAAGG + Intronic
966845035 3:184121963-184121985 ACGGGGACCTGGGAGGCAGAGGG + Intergenic
968529709 4:1084966-1084988 ACTGGGGCCGTGGGGCCTGTGGG - Intronic
975697527 4:77028176-77028198 TCTTAGACCTTGGAGGCTGAGGG + Intronic
980975147 4:139604154-139604176 ACTGGGACCTTGGGAGCAGCTGG + Intronic
981066565 4:140492298-140492320 ACTGGGACATTTGGAGCTGAAGG - Intronic
981866410 4:149425449-149425471 ACTAGGATCTTGGGGGTTGATGG + Intergenic
982110428 4:152048292-152048314 ACTGGGACTTTCGGTGCTGGAGG - Intergenic
985543164 5:496005-496027 ACTGGGACACTGGTGGGTGAGGG + Intronic
985769277 5:1799043-1799065 GCAGGGACCTCGGGGACTGAGGG + Intronic
985886974 5:2687386-2687408 ACTGTGACCTTGCTGGCTGTGGG + Intergenic
988488629 5:31688626-31688648 TCTGGGTCCTGGGGTGCTGAGGG + Intronic
989244373 5:39237430-39237452 ACTAAGGCCTTGGGGGCTGTGGG + Intronic
991908676 5:71538324-71538346 GGTGGGACCTTGGGGACTGGGGG + Intronic
992460996 5:76960164-76960186 ACTGGGAGCATGGGGGTGGATGG + Intronic
996969463 5:129346160-129346182 AATGGGGCCTTGTGGGCTGTGGG - Intergenic
998800803 5:145866852-145866874 ACTGTGACTTTGGGGTCTGATGG - Intronic
999135816 5:149318027-149318049 ACTGACACCATGGGGACTGAAGG + Intronic
999235017 5:150085443-150085465 AAAGGGACCTTGGGGGAGGATGG - Intronic
1006422342 6:33943013-33943035 ACTGGCACTTTGGGAGCTCAGGG + Intergenic
1006619959 6:35356898-35356920 ACTGGGCCCTTGAGGGCTTTGGG + Intronic
1007385625 6:41518441-41518463 CCTGGGGTCTTGGGTGCTGAAGG - Intergenic
1007537406 6:42605310-42605332 ACTGGGGCTTTGGGTGCTGCTGG - Intronic
1008615540 6:53222196-53222218 AGTGGGACCTTGGGAGGTGATGG + Intergenic
1009837226 6:69017611-69017633 ACTTGGACCATGGAGGCAGATGG + Intronic
1011685390 6:89819664-89819686 ACTGGGACCTCGGCGGCTTGGGG - Exonic
1013612929 6:111811997-111812019 ACTGGGTCCTGGGGTGCAGAGGG - Intronic
1018840721 6:167514382-167514404 ACTGGGGGCCTGGGGGCTGGGGG + Intergenic
1018845270 6:167551557-167551579 ACAGGGCCCTTGGAGGCTGACGG - Intergenic
1018924769 6:168198450-168198472 ACTGGGACTCTAAGGGCTGAGGG + Intergenic
1019194412 6:170272804-170272826 ACAGGGACCCTCGGGGCTGCGGG + Intergenic
1019635645 7:2074314-2074336 ACTGCGTCCTTGGCGCCTGAGGG - Intronic
1022325845 7:29331414-29331436 ACTGGGACAGTGGTGGCTGTAGG + Intronic
1023619541 7:42055665-42055687 ACTAGGGGCCTGGGGGCTGATGG - Intronic
1023965431 7:44961326-44961348 GCTGGGGGCTGGGGGGCTGAGGG + Intergenic
1028009333 7:85620639-85620661 ACTGGGGCTTTGGGGGGTGGAGG + Intergenic
1030996262 7:116362004-116362026 AATGTGGCCTTGGAGGCTGATGG - Intronic
1032102479 7:128994238-128994260 ACTGGAACCTGGGAGGCGGAGGG - Intronic
1032850023 7:135786436-135786458 ACTTGGACCTGGGAGGCGGAGGG - Intergenic
1033206463 7:139427238-139427260 AGTGGGGCCTTGGGGGCTCTAGG + Intergenic
1034747822 7:153538786-153538808 ACTGTAACCTTGGGGGCTCCCGG + Intergenic
1035300355 7:157893360-157893382 CGGGGGACCGTGGGGGCTGAGGG - Intronic
1036696617 8:10979243-10979265 GCTGGGCCCTTGGGGGTTGGGGG - Intronic
1038331053 8:26609763-26609785 GCAGGGACCCTGGGGGCTGGGGG - Intronic
1039360923 8:36876127-36876149 AGTGGGACCTCGGTGGCTGTGGG - Intronic
1039558868 8:38496848-38496870 AGTGGGTCCTTGGGGACCGATGG - Intergenic
1040291201 8:46125941-46125963 TCTGGTTCCTTGGGGGCTGTTGG - Intergenic
1041112997 8:54504900-54504922 ACTGGGACCGTGGGGGGTTTGGG + Intergenic
1043455296 8:80406575-80406597 ACTGAGACCACGGGGGCTGAGGG + Intergenic
1044743542 8:95351295-95351317 ACTGAGACCTTTGGGGTTGATGG + Intergenic
1044839438 8:96325477-96325499 GCTGGGGCCTGGGGGGCTGGGGG - Intronic
1046846472 8:118921842-118921864 TCTGGGTCCTTTGGGGCAGAAGG - Intergenic
1048008378 8:130437522-130437544 CCTGAGACCTTGGGGGATGCAGG - Intronic
1048054291 8:130848636-130848658 ACTGTGCCCTTTGGGCCTGAGGG - Intronic
1048554146 8:135458097-135458119 ACGGGGACCTGGGAGGCTGTGGG + Intronic
1048984860 8:139729925-139729947 CCTGGGACCTGGGGAGCTAAGGG + Intergenic
1052916462 9:33927321-33927343 AGTGGGACCTTAGGGACTGGGGG - Intronic
1052919033 9:33948395-33948417 ACTGGGATGTTGGGGGCTTGAGG + Exonic
1054161080 9:61672359-61672381 CCTGGGACCCTGGGGGGTGGGGG + Intergenic
1055442337 9:76348795-76348817 GCTGGGGGCTGGGGGGCTGAGGG - Intronic
1056862794 9:90202600-90202622 ACTTGAACCTTGGTGGCAGAGGG + Intergenic
1057187123 9:93063143-93063165 ACTGGGGCCTGGAGGGTTGAAGG + Intronic
1057334625 9:94146315-94146337 GATGGGCCCTGGGGGGCTGAAGG - Intergenic
1057918578 9:99076743-99076765 AGTGGGAACTTGGGGGTTTATGG + Intergenic
1059386434 9:113968544-113968566 ACTGGGGCCTTGGGCACAGAGGG - Intronic
1061358440 9:130124143-130124165 AATGGGACCGTGGGTGGTGAAGG - Intronic
1061406909 9:130397428-130397450 ACTGGGAAAGTGGGGGCAGAGGG + Intronic
1061574640 9:131498428-131498450 AATGAGACTTGGGGGGCTGAGGG + Exonic
1061577146 9:131514268-131514290 CCAGGGACCTTGGCGGGTGACGG - Intronic
1062051780 9:134451121-134451143 GCGGGGACCATTGGGGCTGAGGG + Intergenic
1185873094 X:3680740-3680762 ACTGGCGGCTTGGGGGCTGGGGG + Intronic
1185879889 X:3731597-3731619 ACTTGAACCTGGGGGGCGGAGGG + Intergenic
1186472661 X:9833550-9833572 ACTAGGACATTGAGCGCTGAAGG + Intronic
1189173803 X:38934202-38934224 ACTGGGACATGGGGGGCTCTAGG - Intergenic
1190760483 X:53434042-53434064 GTTGGGACCTCGGGGGCAGAAGG + Intronic
1192233915 X:69284360-69284382 ACAGGAAGGTTGGGGGCTGAGGG + Intergenic
1192534866 X:71918582-71918604 CCTCTGTCCTTGGGGGCTGAGGG + Intergenic
1195144240 X:101997552-101997574 ACTAGGACCATGGAGGATGATGG + Intergenic
1195761899 X:108255401-108255423 AGGATGACCTTGGGGGCTGAAGG + Intronic
1196631856 X:117950382-117950404 ACTTGAACCTGGGGGGCGGAGGG + Intronic
1197159095 X:123303741-123303763 AGTGGGGCTTTGGGGGCTAATGG - Intronic
1197367369 X:125580568-125580590 GCTGGGGCCTTAGGGGCAGAAGG - Intergenic
1199727911 X:150603234-150603256 GCTGGAACATTGGGGGTTGATGG + Intronic
1199973481 X:152877499-152877521 ACAGGGACCTTGGGAGCTCCTGG - Intergenic
1200068889 X:153518156-153518178 ACAAGGCCCTTGGGGGCTGCGGG + Intronic