ID: 1157557307

View in Genome Browser
Species Human (GRCh38)
Location 18:48621357-48621379
Sequence CTGGGCTGGAAGAAGAGTCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 388
Summary {0: 1, 1: 0, 2: 0, 3: 37, 4: 350}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157557302_1157557307 -7 Left 1157557302 18:48621341-48621363 CCAGCCTGTGCCAGGGCTGGGCT 0: 1
1: 0
2: 10
3: 91
4: 554
Right 1157557307 18:48621357-48621379 CTGGGCTGGAAGAAGAGTCCGGG 0: 1
1: 0
2: 0
3: 37
4: 350
1157557296_1157557307 20 Left 1157557296 18:48621314-48621336 CCGGATAGGAACATCTGGGCAGA 0: 1
1: 0
2: 0
3: 11
4: 136
Right 1157557307 18:48621357-48621379 CTGGGCTGGAAGAAGAGTCCGGG 0: 1
1: 0
2: 0
3: 37
4: 350

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157557307 Original CRISPR CTGGGCTGGAAGAAGAGTCC GGG Intronic
900799069 1:4726537-4726559 CTGGGCCGGAGGAAGAGGTCAGG + Intronic
901195728 1:7438823-7438845 TTGGACAGGAAGAAAAGTCCTGG + Intronic
901296140 1:8162154-8162176 CTACGTAGGAAGAAGAGTCCAGG - Intergenic
901392609 1:8956870-8956892 CTGGGCGGGAAGGAGCGTGCTGG + Intronic
902071715 1:13745355-13745377 GTCTGCTGGAAGAACAGTCCAGG + Intronic
902585176 1:17434649-17434671 CTGGGGTGGAAGGACAGTCTTGG + Intronic
903307004 1:22419964-22419986 CTGGCCTGGAAGGAGGGTTCTGG + Intergenic
903334700 1:22617057-22617079 CAGGCCTGGGAGAACAGTCCAGG + Intergenic
903339057 1:22642950-22642972 CAGGGCTGGAAGGAGAAGCCAGG + Intergenic
904547361 1:31286031-31286053 CTGGGCTGAAATAGGAGCCCTGG + Intronic
904616358 1:31752346-31752368 CTGGGCTGGAAGGACCTTCCAGG + Intronic
904998603 1:34650667-34650689 CTGCGCTGGCAGAGGAGTGCCGG + Intergenic
905171001 1:36109447-36109469 CTGTGCTGAAACAGGAGTCCAGG - Intronic
905264070 1:36739174-36739196 CTCAGCAGGAAGAAGATTCCAGG - Intergenic
905561087 1:38927919-38927941 GAGGGCTGGGAGAAGAGTCTCGG + Intronic
905839405 1:41162191-41162213 CTGGGAGGGAAGAGGGGTCCTGG - Intronic
906111847 1:43329240-43329262 CGGGACTGAAAGAAGAGTCTAGG + Intergenic
906693660 1:47809800-47809822 CTGGGCTGGGAGCAGGGACCAGG + Intronic
906792356 1:48670012-48670034 ATGAGCTGGAAGAAGAGAACAGG + Intronic
907832896 1:58082117-58082139 CAGGGCTGCAACCAGAGTCCAGG + Intronic
909123477 1:71634940-71634962 CTGGGCAGGAATAAGAAACCAGG + Intronic
912483694 1:110006756-110006778 TTGGGGTGGAAGAAAAGACCAGG + Intronic
912531245 1:110324441-110324463 TTAGGCTGGAAAGAGAGTCCTGG - Intergenic
914420776 1:147526738-147526760 AAGGGCTGGAAGAAGAGACTGGG + Intergenic
916253670 1:162764508-162764530 TGGGCCTGGAAGAAAAGTCCAGG + Intronic
916489406 1:165288255-165288277 CAGGGCTGGAAGTAGACTCTGGG - Intronic
916906633 1:169292789-169292811 CTGGGCTGCTGCAAGAGTCCTGG - Intronic
918033219 1:180837907-180837929 CTGGGATGGAAGAAAAGTAAAGG - Intronic
918063887 1:181086489-181086511 CTGGGGTGGGAGAAGAGGCTGGG - Intergenic
918079274 1:181193186-181193208 AGGGGCTGCAAAAAGAGTCCAGG - Intergenic
919685543 1:200479970-200479992 CTGGGCTGGAAGTATAGCCATGG - Intergenic
919858238 1:201720150-201720172 CTGGGCAGGAAGGAGAGCCAAGG + Intronic
921010620 1:211137331-211137353 ATTGGCTGGGAAAAGAGTCCAGG + Intergenic
922613272 1:226945354-226945376 CGGGGCTGGATGAGGGGTCCTGG + Intronic
922880269 1:228975399-228975421 CTGGGCTGGAAGCTGAGGCCAGG - Intergenic
924362507 1:243255811-243255833 CTGGGCTGGAGGAAAAGGGCGGG + Intergenic
1063193528 10:3719161-3719183 CTGGGGTGGAAGGAGGGGCCTGG + Intergenic
1063670410 10:8095515-8095537 CTGGGCAGGTTGGAGAGTCCAGG + Intergenic
1064106785 10:12507151-12507173 CAAGGCTGCAAGAAAAGTCCAGG - Intronic
1064347800 10:14548541-14548563 CAGGGCTAGGAGAAGAGCCCAGG - Intronic
1064853203 10:19734009-19734031 AGGTGCTGGAAGAAGAGTCAGGG + Intronic
1067147312 10:43702960-43702982 CTGGGCTAGAATAAGTGCCCGGG - Intergenic
1067702572 10:48584322-48584344 GAGGGATGGAAGAAAAGTCCAGG - Intronic
1068162809 10:53288240-53288262 CTGGGCAGGATGAACAGTCCTGG - Intergenic
1070543089 10:77431389-77431411 CAGGGCTGAAAGAGGATTCCTGG - Intronic
1070606558 10:77902322-77902344 CTGGGCTGAAACAGCAGTCCTGG - Intronic
1070764218 10:79047310-79047332 CTGGGCTGCTGGAGGAGTCCAGG + Intergenic
1070972551 10:80579527-80579549 CCGGGGTGGAAGAAGAGCACAGG - Intronic
1071150978 10:82634113-82634135 CTGGACTAGAAGAAGTGTTCAGG + Intronic
1071573357 10:86709908-86709930 CGGGGCTGTAGGAAGAGGCCTGG - Exonic
1072785360 10:98275765-98275787 CTGGGCAGGCAGAAGAGACCCGG + Intergenic
1073423571 10:103442871-103442893 TTGGGCTGGACGCAGAGTCCTGG - Intronic
1073434563 10:103508440-103508462 CGGGGCTGGAAGAGAAGTCAGGG - Intronic
1074464096 10:113666734-113666756 CTGGGCTCTCAGCAGAGTCCTGG + Intergenic
1075205107 10:120440353-120440375 CTTGACTCGAAGAAGAGTGCAGG + Intergenic
1076383989 10:130044370-130044392 CTGGGCTGGAGGAGGCGTCATGG - Intergenic
1076546887 10:131251308-131251330 CTGGGCTGGGAGGAGGGGCCGGG - Intronic
1076795256 10:132795131-132795153 CTCGGCTGGAAGAGGAGGCTGGG - Intergenic
1076821477 10:132942140-132942162 CTGGGCTGGGAGAAGTGAGCCGG + Intronic
1078445936 11:11404874-11404896 ATGGGCTGGGAGTGGAGTCCGGG - Intronic
1081677740 11:44980764-44980786 CAGGGCTGCAGGAGGAGTCCAGG + Intergenic
1081998311 11:47378279-47378301 TTGGGCTGGTGGAGGAGTCCCGG + Intronic
1083246184 11:61429863-61429885 TTGGGCCGGAAGAGGGGTCCGGG - Exonic
1083274117 11:61587349-61587371 CTGGGCGGGAAGAAGAGTAACGG - Intergenic
1083327820 11:61882053-61882075 CTGGGAGGGAAGAAGACTCTTGG + Intronic
1083622680 11:64056781-64056803 CTGGGCTGAAGGAAGGGTTCTGG + Intronic
1083759854 11:64809913-64809935 CTGGGCTGGAAGGTGAGCTCGGG + Exonic
1083851803 11:65372364-65372386 CTGGGCTGGGAGAGCAGTCCTGG - Intergenic
1085340568 11:75728649-75728671 CTGGGCTGGAGGTGGAGGCCTGG - Intronic
1086937845 11:92764107-92764129 CTGGGCAGGGTGAAGAGTCCAGG - Intronic
1087795883 11:102454268-102454290 CTGGGGTGGAATAAGAGGTCTGG + Intronic
1087802439 11:102518743-102518765 CTGGGCTGAGAGAAGAGTACAGG - Intergenic
1089134097 11:116235478-116235500 ATGGGCTGGAGGCAGAGCCCTGG - Intergenic
1090261386 11:125323202-125323224 CTGGGCTCAAAGCAGAGCCCAGG - Intronic
1090282575 11:125468863-125468885 CTGGGTTGGAAGAAGACACTTGG - Intronic
1091159066 11:133402930-133402952 CTGGTCTGGAATATGAATCCAGG + Intronic
1091329998 11:134724850-134724872 CTGATCTGGAAGAGGATTCCAGG - Intergenic
1091940642 12:4477466-4477488 CTGCCCTGGGAGAAAAGTCCAGG + Intergenic
1092285181 12:7124529-7124551 CTGGGCTGGGGGAAGAGTGGTGG + Intronic
1095144774 12:38712777-38712799 CTGGACTGAAAGAAGTATCCTGG + Intronic
1095554469 12:43483686-43483708 CTGGCTTGGAAGGAGAGTCACGG + Intronic
1095952132 12:47787308-47787330 CTGGGCTCTGAGAAGACTCCAGG + Intronic
1096413424 12:51392734-51392756 CAGGGCTGGAATGAGAATCCTGG + Intronic
1097981760 12:65742582-65742604 CTGGGCTGGTAGAAGCTCCCGGG - Intergenic
1098973490 12:76878983-76879005 CTGGGCTGGAGGGAGGGTCCAGG + Exonic
1100599418 12:96100141-96100163 CTGGGCTGGAACCAGAGAGCAGG + Intergenic
1101193567 12:102360138-102360160 CTAGGATGGAGGAAGAGGCCAGG + Intergenic
1102465668 12:113129740-113129762 CTGGGCTGGAGGAAGAAGGCGGG - Intronic
1102492565 12:113297934-113297956 CTGGGGAGGAAGAAGGGCCCAGG - Exonic
1103147784 12:118610467-118610489 GTGGGCTGGTGGAAGAGTGCTGG + Intergenic
1103483075 12:121263885-121263907 CTGGGCTGGATGCAGCCTCCAGG + Exonic
1103744711 12:123114599-123114621 CTGGGTGGCAAGAGGAGTCCTGG + Intronic
1103910438 12:124349255-124349277 CTGCCCTGGAAGGAGAGCCCTGG - Intronic
1104219012 12:126763893-126763915 CTGGGCAGGAAGTCGGGTCCAGG - Intergenic
1104289555 12:127455570-127455592 CAGTGCTGGAAGAAGAGGCGCGG - Intergenic
1104642356 12:130475582-130475604 CTGGACTGAAGGAAGAGGCCAGG + Intronic
1104673406 12:130695867-130695889 ATGGGCTTGAAGAGGAGTCATGG + Intronic
1104724157 12:131065894-131065916 CGGGGGTGGAGGAAGAGACCTGG + Intronic
1106615146 13:31319705-31319727 CTAGGCTGGAGAAAGAGTTCTGG - Intronic
1106756791 13:32829838-32829860 CTGCCCTGGAGGAAGAGTCAGGG + Intergenic
1107457332 13:40566940-40566962 CTGGGTTGAAAAAAGAGACCTGG + Intronic
1111901087 13:94200497-94200519 CTGTGTTGGAAGAAGAGGCTTGG + Intronic
1113853320 13:113430266-113430288 CAGGGCTGGCAGGACAGTCCTGG + Intronic
1114484210 14:23053500-23053522 TTGGGCTGGCAGGGGAGTCCAGG + Exonic
1118987963 14:70772910-70772932 CTGGGCTGAATGAAATGTCCTGG - Intronic
1119442091 14:74635339-74635361 ATGTGCTGGAAGAAGAGGACAGG - Intergenic
1119521980 14:75293489-75293511 CAGCGCTGGAATTAGAGTCCAGG + Intergenic
1120503608 14:85326668-85326690 TGGGGATGGAAGAAGGGTCCAGG + Intergenic
1121702009 14:95961774-95961796 CTGGGCAGGAAGAGAATTCCAGG + Intergenic
1121942198 14:98081750-98081772 CTGAGCTGCAAGCAGAGTGCTGG - Intergenic
1122028565 14:98895640-98895662 CAGAGCTGGAAGTAGGGTCCTGG + Intergenic
1122793994 14:104196621-104196643 CTGGGCGGGAAGGAGGGTGCAGG + Intergenic
1123942188 15:25221960-25221982 CTGGGCTGGGGCAAGAGGCCTGG - Intergenic
1124008096 15:25810695-25810717 CTGGGCAGGACGAGGAGCCCAGG + Intronic
1124121759 15:26894154-26894176 CTGGGCTGCTCGCAGAGTCCGGG - Intronic
1125577058 15:40763457-40763479 CTGTGCTGGAATTAGAGTCTGGG + Intergenic
1127335047 15:57976266-57976288 CAGTGCTGGAAGAAGATGCCTGG - Intronic
1128232530 15:66045568-66045590 CAGGTCTGGAAGACTAGTCCGGG + Intronic
1128988228 15:72236762-72236784 CTGGGCTGGAGAAAGACTGCTGG - Intergenic
1129881449 15:79009340-79009362 CTGGGCTGGAGGAAGTGCCTGGG + Intronic
1129904768 15:79178718-79178740 CAGGGCTGGAAAAAGAGTAGGGG - Intergenic
1130788269 15:87123861-87123883 CTAGGCTGGAAGAAGGATTCTGG + Intergenic
1130854072 15:87825408-87825430 CTGGGCTGGTGGGACAGTCCAGG - Intergenic
1132502835 16:292192-292214 CTGGGCTGGCAGATGAGCCGTGG - Intronic
1132543975 16:524681-524703 CTGCCCTGGAACAAGAGCCCCGG + Intergenic
1132804672 16:1769931-1769953 CTGGGCAGGGAGAGCAGTCCAGG - Exonic
1133209821 16:4257426-4257448 TTGGGGTGGAAGATGAGACCTGG + Exonic
1133229853 16:4361321-4361343 CTGGGCTTGAGGGAGGGTCCTGG - Intronic
1133781245 16:8940991-8941013 CTGGACGAGAAGAAGGGTCCTGG - Intronic
1133891530 16:9883762-9883784 CTGGGCTGGAGGGAGAGATCTGG + Intronic
1134312167 16:13084838-13084860 AGGGGCTGGAAGAACATTCCAGG + Intronic
1134596439 16:15499709-15499731 ATGAGCTGGAAGAAATGTCCAGG - Intronic
1134867965 16:17625851-17625873 ATAGGGTGGAAGACGAGTCCAGG + Intergenic
1136533811 16:30887552-30887574 CTGAGCAGGAAGAGGGGTCCTGG + Intronic
1136554918 16:31001935-31001957 CTGGGCTCCATGAAGGGTCCTGG + Intronic
1136628185 16:31474259-31474281 CAGGGCTGAGAGATGAGTCCTGG + Intronic
1137440919 16:48497989-48498011 CTGGGCTAGAAGAGGGGTCTGGG - Intergenic
1137478678 16:48832849-48832871 CTGTGCAGGAAGAAGAATCTGGG - Intergenic
1137496476 16:48973015-48973037 CTGTCTGGGAAGAAGAGTCCTGG + Intergenic
1138459739 16:57141154-57141176 CTGGGCAGGAACCAGGGTCCTGG + Intronic
1138727993 16:59161878-59161900 ATTGGCTGGAAGGACAGTCCAGG - Intergenic
1139531980 16:67546932-67546954 CTGGGCTTGGAGAAGAGAGCAGG + Intergenic
1139700868 16:68707327-68707349 CTGGGCTGGAGGCTGAGTTCAGG + Intronic
1141616165 16:85210866-85210888 CTTGGCCAGAAGAAGAGTCCAGG - Intergenic
1141873592 16:86806424-86806446 CTGGGCTGGAAGCAGTCTGCAGG + Intergenic
1203144253 16_KI270728v1_random:1789930-1789952 CTGTGCTGGAAGCAGAAGCCTGG + Intergenic
1142742275 17:1938015-1938037 CTGGGCTGGGAGGTGAGTCTGGG + Intronic
1143895279 17:10131132-10131154 CTGGGGAGGAAGAAAAGTTCTGG - Intronic
1144746883 17:17621808-17621830 TTGGGCTGGAAGGTGAGTCTAGG - Intergenic
1146628876 17:34455783-34455805 CTGGGCTGGAAGGAGTGTTCTGG - Intergenic
1147256922 17:39187012-39187034 CTGGGCTGGGAGGTGAGTCTGGG - Intronic
1147564382 17:41527636-41527658 CGGGGCTGGATGCAGAGGCCGGG - Intronic
1149659182 17:58325499-58325521 CTGAGCTGGAAGAGGTGACCAGG + Intronic
1150156955 17:62861741-62861763 CTGAGCAGGAAAAGGAGTCCAGG + Intergenic
1150456219 17:65308877-65308899 CTGGGCTGGAGAAGGACTCCAGG + Intergenic
1150483832 17:65530776-65530798 ATGGGATGGGAGAAGAGGCCTGG - Intronic
1150555176 17:66247924-66247946 CTGACCTTGAAGAACAGTCCTGG - Intronic
1150634382 17:66902646-66902668 CTGGGCTGGGACAGGAGTCGGGG + Intergenic
1151155235 17:72119730-72119752 CTGGGATAGAAGAAAAGTCTTGG - Intergenic
1151328695 17:73394198-73394220 CTGGGCTATAAGGTGAGTCCCGG - Exonic
1152469505 17:80482970-80482992 CAGGGCTTGCAGAAGAGACCTGG + Intergenic
1152469609 17:80483374-80483396 CGGGGCTGACAGCAGAGTCCTGG + Intergenic
1152747309 17:82047252-82047274 CTGGGCTGGGAGAGGAATTCTGG - Intergenic
1153226109 18:2901265-2901287 CTGGGCTGCAGGAGGAGACCTGG - Intronic
1153941959 18:9986421-9986443 GTGGGCTGGAGGAAGAGGCGAGG + Intergenic
1154102231 18:11486776-11486798 CTGGGCTGGGACAAGGGTCATGG - Intergenic
1154473665 18:14730092-14730114 CTGAGCTGGCAGAAGAGACCTGG + Intronic
1156396062 18:36700889-36700911 CTCAGCTCGATGAAGAGTCCAGG - Intronic
1157240718 18:46007321-46007343 ATGGGCTGGAAGATGACTGCTGG - Intronic
1157557307 18:48621357-48621379 CTGGGCTGGAAGAAGAGTCCGGG + Intronic
1157879336 18:51305087-51305109 CTGCCCTGAAGGAAGAGTCCTGG + Intergenic
1158851158 18:61496435-61496457 CTGTGTTGGAAGAAGGGTCTGGG - Intronic
1159696130 18:71558255-71558277 CAGAGCTGGAAGAGGTGTCCTGG - Intergenic
1160327759 18:77966634-77966656 CGAGGCTGGAATAAGAGACCAGG + Intergenic
1160551844 18:79698422-79698444 CTGGGCTGGAGGAAAAGCCTGGG + Intronic
1160773349 19:843661-843683 CAGGGCTGGAGGAAGAGGGCGGG - Intronic
1160847393 19:1172615-1172637 CTGGCCCGGAGGAAGAGGCCTGG + Intronic
1161266729 19:3367591-3367613 CTGGGCTGGAAGGAGTCCCCGGG - Intronic
1161279098 19:3435361-3435383 CTTGGCTGGAAGTACGGTCCGGG + Intronic
1162014499 19:7837559-7837581 CTGGGATGGAAGAAGGTTACTGG - Intronic
1164524163 19:29001178-29001200 CTGGAATGGAACCAGAGTCCAGG + Intergenic
1164850451 19:31478819-31478841 CTGGGATGGGAGCAGGGTCCAGG + Intergenic
1165070303 19:33251589-33251611 CTGGCCTGGACGAAGAGCCTGGG - Intergenic
1165369547 19:35396013-35396035 CTGGGCCGGCGGAAGAGACCAGG + Intergenic
1166015824 19:39978640-39978662 GGTGGCTGGAAGGAGAGTCCTGG + Intronic
1166730049 19:45054056-45054078 CTGGGCTGGGAGAAAATTCCTGG - Intronic
1167288985 19:48614439-48614461 CTGTCCGGGAAGAAGCGTCCGGG - Intronic
1167560411 19:50223497-50223519 TGGGGCTGGAAGCAGAGTCAGGG + Intronic
1167934912 19:52897832-52897854 CCTGGCTGGGAGAAGAGTCCTGG + Intergenic
925118340 2:1398766-1398788 CTGGGCTGCAAGGAGAGCCTTGG - Intronic
925206201 2:2008370-2008392 GTGGGCAGGAAGAACAGGCCAGG + Intronic
925381627 2:3431361-3431383 CTGGGCTGGATGATGTTTCCTGG - Intronic
925390980 2:3493804-3493826 CTGGGCTGGAAGGAGAGCGGGGG + Intergenic
925751197 2:7091508-7091530 CAGGGCTGGAAGATGCTTCCAGG + Intergenic
926604281 2:14881540-14881562 CTGGGCTGCATGTAGATTCCTGG - Intergenic
926641383 2:15241355-15241377 ATGGGCAGGAAGTAGGGTCCTGG + Intronic
927844481 2:26464355-26464377 CTGGGCTGAGAGAAGGGTCAGGG + Intronic
927961480 2:27242981-27243003 CTGGGCTTGAGGAAGAAGCCAGG + Intronic
928205586 2:29281008-29281030 CTGGGATTGAAGAAAAGTTCTGG + Intronic
929055406 2:37872460-37872482 CTGGGGTGGGAGAAGGGTGCTGG + Intergenic
930241544 2:48940792-48940814 CTGGGCTTAAAGAATAGCCCAGG - Intergenic
930376201 2:50570237-50570259 ATGGGCTGGCAGCAGAGTACTGG + Intronic
931555249 2:63496593-63496615 CTGAGCTGGAAGACAAGTCCAGG - Intronic
931728104 2:65130251-65130273 CTTGGCGGGAAGCTGAGTCCTGG - Intergenic
931773382 2:65518520-65518542 CTGGGCCGGAAGCAGAGCCCAGG + Intergenic
931999135 2:67867634-67867656 CTGGGGTGGAAGAACTGTGCTGG - Intergenic
932706567 2:74030740-74030762 CTGGGGTGGAAGCAGAGGCAGGG + Intronic
932779988 2:74553895-74553917 AAGGGCTGGGAGAAGAGTGCTGG + Exonic
933836247 2:86248168-86248190 CTGGGCTGGAATTACAGGCCAGG - Intronic
934245193 2:90299458-90299480 CTGTGCTGGAAGCAGAAGCCTGG - Intergenic
934263551 2:91497573-91497595 CTGTGCTGGAAGCAGAAGCCTGG + Intergenic
934720684 2:96573766-96573788 CTGGGATGGAAGAGGTTTCCTGG - Intergenic
935165051 2:100562961-100562983 CTGGGCTGGGGGAAGAGGCGTGG + Exonic
936378199 2:111960733-111960755 TGGGGCTGGTAGAAGAGTCATGG + Intronic
936399973 2:112157458-112157480 CTGTGCAGGCAGCAGAGTCCAGG + Intronic
937916593 2:127102272-127102294 CTGGGCTGGACGCTGAGTCCAGG + Intronic
937976398 2:127584581-127584603 CTGAGCTGGGAGCAGAGGCCGGG - Intronic
938755810 2:134377961-134377983 CAGGGCTGGCAGAAGAGGCTAGG - Intronic
940692012 2:156930075-156930097 CTAGGCAGGAAGAAGAGGGCAGG - Intergenic
944638050 2:201693843-201693865 CTGGTCTAGAAAAGGAGTCCTGG + Intronic
945079860 2:206077982-206078004 ATGGGCTGGAAGAGTAGGCCAGG + Intronic
947574387 2:231261039-231261061 CTGGGCTGGAAGGAGAGCCGGGG - Intronic
947843733 2:233226970-233226992 CTGGGCTGGAGGCTGAGCCCTGG - Intronic
947934061 2:233988255-233988277 CTGGGCAGGAAGAGAAGTTCGGG - Intronic
948910940 2:241002382-241002404 CTTGGCTGGGAGGAGGGTCCTGG + Intronic
1170867747 20:20175009-20175031 CAGGGGTGCAAGAGGAGTCCAGG + Intronic
1170873370 20:20228997-20229019 AAGGGCTGGAAGAAAGGTCCTGG - Intronic
1171250146 20:23640371-23640393 CTGGGCTGGAATGTGACTCCAGG + Intergenic
1171263601 20:23752812-23752834 CTGGGCTGGAATGTGACTCCAGG + Intergenic
1171284187 20:23924098-23924120 CTGGGCTGGAATGTGACTCCAGG + Intergenic
1172352826 20:34256596-34256618 CTGAGCTAGAAAAAGAGGCCAGG - Intronic
1172487839 20:35309565-35309587 CAGAACTGGAAGAAGGGTCCTGG + Intronic
1173187696 20:40853770-40853792 TTGAGTTGGAAGAGGAGTCCAGG + Intergenic
1173243893 20:41320833-41320855 ATGGGCTGGAAGCAGAGTAAGGG + Intergenic
1173245840 20:41336853-41336875 CTGGGCTGGCAGAAGAGCCAAGG + Intergenic
1173640019 20:44595034-44595056 CTTGGCCAGAAAAAGAGTCCTGG - Intronic
1173662423 20:44743969-44743991 GTGGGCTGGAAGCAGCGTGCTGG - Intergenic
1175816399 20:61885255-61885277 CTGGGGTGATGGAAGAGTCCTGG - Intronic
1176336891 21:5607357-5607379 CTTGGCTGGGAGAAGATCCCAGG - Intergenic
1176390866 21:6213591-6213613 CTTGGCTGGGAGAAGATCCCAGG + Intergenic
1176470553 21:7102583-7102605 CTTGGCTGGGAGAAGATCCCAGG - Intergenic
1176494114 21:7484361-7484383 CTTGGCTGGGAGAAGATCCCAGG - Intergenic
1176506528 21:7654022-7654044 CTTGGCTGGGAGAAGATCCCAGG + Intergenic
1178595298 21:33947986-33948008 CGGGGCTGGAAGGAGTGTCATGG + Intergenic
1179192762 21:39137261-39137283 CTCGGCTGGAAGAAGAGAGCTGG + Intergenic
1179608911 21:42536342-42536364 CTGGGCTGGCAGCACAGGCCAGG - Intronic
1179825987 21:43966825-43966847 CTGAGCTGGAAGCCGCGTCCTGG + Intronic
1182093277 22:27610099-27610121 ATGGGCTGGAATGAGACTCCAGG - Intergenic
1182473271 22:30561531-30561553 CAGGGCTGGAATTAGAGCCCAGG + Intronic
1182577709 22:31284375-31284397 CAGGGCTGGAAGAGCAGTCAAGG + Intronic
1183009261 22:34931565-34931587 CTGGGGTGGAAGAAAAGCCTGGG + Intergenic
1183291211 22:37003005-37003027 CTGGGGTGGAGGATGAGGCCAGG - Intronic
1183350878 22:37334244-37334266 CTGGCCTGGAAGGAGGGTTCTGG - Intergenic
1183979341 22:41530612-41530634 CAGGGCTGGAAGCTGTGTCCTGG - Intronic
1184320575 22:43739537-43739559 CTGGGCTCTGAGAAGAGTCCAGG - Intronic
1184421320 22:44384442-44384464 CTGGGCTAGAGGAAGAGCCAGGG + Intergenic
1184707659 22:46225307-46225329 CAGGGATGGAAGCAGAGTCAGGG + Intronic
1184719337 22:46300783-46300805 CTGGCGTGGAAAAAGAATCCAGG - Intronic
1184856993 22:47151751-47151773 CTGGGGTTGAAGAAGACCCCTGG + Intronic
1184864251 22:47193445-47193467 CTGGGCTGTGAGGAGAGACCAGG - Intergenic
1185146019 22:49137116-49137138 CTGGGCTGGAAGAAAAGGCGCGG + Intergenic
1185231254 22:49685386-49685408 CACGGGTGGCAGAAGAGTCCAGG - Intergenic
949454396 3:4223615-4223637 ATGGGCTGGAAGAAGAGAGGAGG - Intronic
951091030 3:18574070-18574092 CTGGCTTGGAAGAACATTCCTGG - Intergenic
951704071 3:25526189-25526211 CTGGGCTGGAATAAGTCTTCTGG + Intronic
954292897 3:49659052-49659074 GTGGGCTGAAGGAAGAGACCTGG + Intronic
954317392 3:49808512-49808534 CAGGGCTCCAAGAAGAGTGCAGG - Intronic
954649134 3:52149627-52149649 CAGGGTTGGAAGAGGAGTTCTGG - Intronic
958076656 3:88690064-88690086 CTGGGATGGAAGCTGAGTCCAGG + Intergenic
959703059 3:109316284-109316306 CTGGGATGGAAGGAGATTGCGGG + Exonic
960389697 3:117062390-117062412 CTGGGCTTCAAAAAGATTCCAGG + Intronic
960608368 3:119531575-119531597 CTGGGCTGGAGAGAGGGTCCAGG + Intronic
960964021 3:123092167-123092189 CTGTGCTGCAAGAATGGTCCTGG - Intronic
960982354 3:123242123-123242145 AAGGGATGGAAGAAGAGTCAGGG - Intronic
961393554 3:126570652-126570674 CTGGGCTGGCAGAAGCGGTCGGG + Intergenic
961833581 3:129638467-129638489 CTGAGCTGGAATCAGAGCCCAGG + Intergenic
961967345 3:130919165-130919187 CTGGGCTGGAGGGAGTGTCCAGG + Intronic
963078109 3:141366971-141366993 CTGGGCCTGAGGAAGAGTCCTGG - Intronic
965305942 3:167063130-167063152 CTGGACTGATAGAAGAGTCTTGG + Intergenic
967226150 3:187293303-187293325 CTGTGCTTGTAGAAGTGTCCAGG + Intergenic
968377364 4:54369-54391 CTGGGCTGGAGAAAGATGCCTGG + Intronic
968401739 4:304393-304415 CTGGGCTGGAGAAAGATGCCTGG - Intronic
969078396 4:4598964-4598986 CTGGGCTGGGAGAGGAGGCAAGG + Intergenic
969517423 4:7655356-7655378 CAGGGCTGGAAGGGGAGCCCGGG + Intronic
971093889 4:23375922-23375944 CTGGGATGGAGAAAGAGTCCTGG - Intergenic
977251215 4:94691744-94691766 CAGGGCTGGAGGAAGGGTCACGG - Intergenic
978238364 4:106487491-106487513 CTGGGCTGGAGGTCCAGTCCTGG + Intergenic
978954130 4:114594831-114594853 CTGGGCTTGGAGAATAGCCCAGG - Intergenic
983204761 4:164901094-164901116 CTGGGATGAAAGAGGAGGCCTGG + Intergenic
984140658 4:176001280-176001302 CTTGGCTGGAAGAAGTGAGCGGG + Intronic
984364799 4:178784829-178784851 ATGGGCTGTAAGAAGGGTCAAGG + Intergenic
984518440 4:180771056-180771078 CTAGGCTGGAATAAAACTCCTGG - Intergenic
984623625 4:181980349-181980371 GTGGTCTGGAAGGGGAGTCCAGG + Intergenic
984935021 4:184882454-184882476 CTGCGCTGAGAGCAGAGTCCAGG + Intergenic
985017424 4:185651111-185651133 CTGGGCAGGGAGAGGAGCCCTGG + Intronic
985537651 5:473801-473823 CTGAGCTGGAGGCAGAGTCCGGG + Intronic
985551195 5:534467-534489 CCGGGCTGGGAGACGAATCCTGG - Intergenic
985788983 5:1915343-1915365 CTGGCCTGGAAGTAGAGTTGTGG + Intergenic
985848230 5:2370078-2370100 CTCCTCTGGAAGAGGAGTCCCGG - Intergenic
986212436 5:5686599-5686621 CTGTGGTGGAAGAAGATTTCTGG - Intergenic
987502395 5:18730701-18730723 CTGAGCTGGCAGAAGAGACCTGG + Intergenic
989809233 5:45652808-45652830 CTGGGCAGAGAGAAGAGTCAGGG - Intronic
990615435 5:57502777-57502799 CTGGGCTGTAGGAACAATCCTGG + Intergenic
996538908 5:124608510-124608532 CTGGTGAGGAAGAAGAGTCAAGG + Intergenic
997203004 5:132024073-132024095 ATGGCCTGGAAGAAGAGAGCAGG - Intergenic
997406610 5:133654018-133654040 CTGGGCAGGAAGAAAACTCTAGG + Intergenic
998562757 5:143186572-143186594 CTGCCCTGAAAGAAGAGTCTGGG + Intronic
998583751 5:143404784-143404806 CCGGGGTGGAAGAAGAGGTCAGG - Intronic
999075731 5:148793504-148793526 ATAGACAGGAAGAAGAGTCCTGG - Intergenic
999760861 5:154699954-154699976 CTGGATGGGAATAAGAGTCCTGG - Intergenic
1001228512 5:169965897-169965919 CTGTGCTGGAGGAGGAATCCAGG + Intronic
1002401526 5:178994004-178994026 CTGCTCTGGAAGAAGGGCCCGGG + Intronic
1002454518 5:179338583-179338605 CTGGTCTGGAATGAGACTCCGGG - Intronic
1002565970 5:180113153-180113175 CTGGGCTGGACGGAGGGACCGGG + Intronic
1003136707 6:3439855-3439877 CTGGGCTGAAAGAAGAGCATGGG + Intronic
1003883819 6:10502706-10502728 CAGGGCAGGCAGAGGAGTCCAGG - Intronic
1004775074 6:18834963-18834985 CTGGCCTTTCAGAAGAGTCCTGG + Intergenic
1005696215 6:28355018-28355040 CTGGGCTGCAACAGCAGTCCAGG + Intronic
1006167483 6:32073570-32073592 CAGGGCTGGAAGAAGGGCCATGG + Intronic
1006263341 6:32894959-32894981 CCTGCCTGGAAGAAGAGTTCCGG + Intergenic
1006436012 6:34026564-34026586 CTGGGCAGGAAGCAGGGGCCTGG + Intronic
1006591494 6:35161221-35161243 CTGGGCTGGACTAAGAGGACAGG + Intergenic
1010984922 6:82412734-82412756 ATGGGTAGGAAGAAGAGTCCAGG + Intergenic
1013100375 6:106981354-106981376 CTGTGCAGGAGGCAGAGTCCAGG + Intergenic
1014048993 6:116929564-116929586 CCTGGTTGGAAGAAGATTCCAGG - Intronic
1016641621 6:146355919-146355941 CTGGACTAGAAGATGAGTCACGG - Intronic
1017761591 6:157573756-157573778 CTGGGCTGGATGGAGAGTACTGG - Intronic
1018133600 6:160756127-160756149 CTGATGTGGTAGAAGAGTCCTGG + Intergenic
1018205856 6:161436378-161436400 CTGGGATGGAAGAGGAGGCATGG + Intronic
1018378142 6:163232752-163232774 CAGAGCAGGAAGAACAGTCCAGG + Intronic
1018424385 6:163667377-163667399 CTGGCCTGTGAGAAGAGTCAAGG - Intergenic
1018949609 6:168370630-168370652 CTGGGATGCAGAAAGAGTCCTGG + Intergenic
1020107323 7:5428149-5428171 CCCGGCTGGAGGAAGAGGCCAGG - Intergenic
1020276122 7:6625608-6625630 CAGGGCTGGGAGGAGACTCCAGG - Intergenic
1021380464 7:19959764-19959786 CTGAGCAGGAAGAAGAGGCGAGG - Intergenic
1024082875 7:45869756-45869778 GTGGGTTGGAAGAATAGTACAGG + Intergenic
1024482968 7:49884173-49884195 GTGGGAGGGAAGAAGGGTCCAGG + Intronic
1025705377 7:63857955-63857977 CTGGGCTGGAAGGAGACTTCAGG + Intergenic
1025725776 7:64058161-64058183 CTGGGCTGAAGGGAGACTCCAGG + Intronic
1025858189 7:65302662-65302684 CTGGGCTGGGGGTAGACTCCGGG + Intergenic
1026555414 7:71404609-71404631 CTGGGCTTGAAGAATAGCCATGG - Intronic
1026960360 7:74404020-74404042 CTGGGCTTGAGGAAGCGTCCTGG - Exonic
1028294118 7:89105975-89105997 GTGGTCTGCAAGAAGAGTCATGG + Intronic
1028629632 7:92920652-92920674 CTGGGCAGGAAGAACAATGCTGG - Intergenic
1029544604 7:101203568-101203590 CTGGGCTGGAAGATGGGGCAGGG + Intergenic
1031874847 7:127127817-127127839 CTGGGGTGGAAGGAGAGACCAGG - Intronic
1032094979 7:128933479-128933501 CTGAGCTGGGAGAGGAATCCCGG + Intergenic
1034888124 7:154814591-154814613 CTGTCCTAGAAGATGAGTCCAGG - Intronic
1035396382 7:158537696-158537718 CTGGGCTGGCAGATGAGGCCGGG - Intronic
1035602002 8:902574-902596 CTGGGAAGGAAGAAGAGGGCTGG + Intergenic
1036182494 8:6597526-6597548 CTGGGCTGGGAGAGGGCTCCGGG - Intronic
1036797896 8:11769442-11769464 CAGGGATGGAAGAAGGGTGCAGG - Intergenic
1038704864 8:29884143-29884165 TGTGGATGGAAGAAGAGTCCTGG + Intergenic
1039250771 8:35661631-35661653 CTGGGAAAGATGAAGAGTCCTGG + Intronic
1039968019 8:42297961-42297983 ATGGTCTGGCAGAAGAGTCCTGG - Intronic
1040306146 8:46212873-46212895 CTGGGATGGGAGAGGCGTCCAGG - Intergenic
1040306196 8:46213093-46213115 CTGGGATGGGAGAAGCGTCATGG - Intergenic
1041538061 8:58950762-58950784 CTTGGGTGGGAAAAGAGTCCTGG + Intronic
1045312527 8:101015520-101015542 AGGGGCTGGAAGGAGAGACCAGG - Intergenic
1048192438 8:132302034-132302056 TGGGGCTGGAAGACCAGTCCAGG + Intronic
1048405452 8:134114688-134114710 CTGGACTTTAAGGAGAGTCCAGG + Intergenic
1049214627 8:141402042-141402064 CGGGGCTGGAGGAGGAGACCTGG + Intronic
1049223064 8:141436620-141436642 CTGGGTTGGGAGGAGGGTCCTGG + Intergenic
1053305927 9:36984915-36984937 CTGGGCTGGGAGCAGGGACCTGG + Intronic
1053537698 9:38942217-38942239 AGGGGTTGGTAGAAGAGTCCAGG - Intergenic
1054628436 9:67421713-67421735 AGGGGTTGGTAGAAGAGTCCAGG + Intergenic
1058808445 9:108616159-108616181 GTGGGCTTGAAGAAGACTCAAGG + Intergenic
1059561066 9:115334925-115334947 CTGGGCCAGAGGAAGAGGCCAGG - Intronic
1060009485 9:120031001-120031023 CTTGGCTGGAAGCAGAGGCGGGG - Intergenic
1060027889 9:120188334-120188356 CTGTGCTGGAGCAAGAGCCCAGG - Intergenic
1060736815 9:126071353-126071375 CTGGGCTGGAAGCAGAGACATGG - Intergenic
1061819467 9:133218167-133218189 GTCAGCTGGAAGAGGAGTCCAGG + Intergenic
1061923912 9:133796823-133796845 CTGGCCTGGCGGAAGAGTCAAGG - Intronic
1062241222 9:135540022-135540044 GTCAGCTGGAAGAGGAGTCCAGG - Intergenic
1062401075 9:136372906-136372928 CTGGGGCAGGAGAAGAGTCCAGG - Intronic
1062627560 9:137450125-137450147 GAGGGCTGGAGGCAGAGTCCAGG - Intronic
1203424762 Un_GL000195v1:27545-27567 CTTGGCTGGGAGAAGATCCCAGG + Intergenic
1203571872 Un_KI270744v1:139877-139899 CTGGGCTGGAGAAAGATGCCTGG - Intergenic
1185534623 X:850928-850950 CTGTGCTGGAAGCAGAAGCCTGG - Intergenic
1188600922 X:31962770-31962792 CTGGGCTGGATGGAGAGTCAAGG + Intronic
1189019564 X:37320216-37320238 CTGGGCCGGAAGGGGTGTCCAGG - Intergenic
1189601340 X:42630009-42630031 CTGGGCTATAAGAAGCCTCCTGG - Intergenic
1190320662 X:49177532-49177554 CTGGGCCTGAAGAGGAGGCCTGG + Intronic
1194746832 X:97637414-97637436 CTGGTTTGGAAGCAGAATCCAGG - Intergenic
1195138513 X:101934221-101934243 CTGGGCTGGAGCATGAGTCATGG - Intergenic
1195759823 X:108234392-108234414 CTGGGCAGCAAGAAGAATTCAGG - Intronic
1196831723 X:119781155-119781177 CTGGACTGGAAGAAGAGAGGGGG + Intergenic
1201898560 Y:19021220-19021242 CTGGGCTGGAAGCAGAGGGATGG + Intergenic