ID: 1157559769

View in Genome Browser
Species Human (GRCh38)
Location 18:48638024-48638046
Sequence CCACCTCCTGCAGTTGGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 346
Summary {0: 1, 1: 0, 2: 5, 3: 35, 4: 305}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157559769_1157559780 20 Left 1157559769 18:48638024-48638046 CCTTGCCCAACTGCAGGAGGTGG 0: 1
1: 0
2: 5
3: 35
4: 305
Right 1157559780 18:48638067-48638089 TCTCTGCTGCCTCCCTGCCTGGG 0: 2
1: 0
2: 10
3: 157
4: 767
1157559769_1157559779 19 Left 1157559769 18:48638024-48638046 CCTTGCCCAACTGCAGGAGGTGG 0: 1
1: 0
2: 5
3: 35
4: 305
Right 1157559779 18:48638066-48638088 GTCTCTGCTGCCTCCCTGCCTGG 0: 1
1: 1
2: 12
3: 114
4: 792

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157559769 Original CRISPR CCACCTCCTGCAGTTGGGCA AGG (reversed) Intronic
900299166 1:1968510-1968532 CAACCCCCTGCAGGTGGCCATGG + Intronic
900736867 1:4304688-4304710 ACACCTCCTGCAGCTGGGGTGGG - Intergenic
900987329 1:6080734-6080756 CCACGTGCAGCATTTGGGCATGG + Intronic
901559451 1:10058657-10058679 CTGCCGCCTGCAGGTGGGCAAGG + Intronic
901640713 1:10691693-10691715 CCAGCTCCTGAAGATGAGCATGG + Intronic
902241513 1:15093083-15093105 TCACCTCCTACTGATGGGCATGG - Intronic
902451781 1:16500926-16500948 AGCCCTCCTGCAGTTGGGCCAGG - Intergenic
902501167 1:16912739-16912761 AGCCCTCCTGCAGTTGGGCCAGG + Intronic
902574767 1:17370772-17370794 CCTCCACCTGCAGGTGGGTAAGG + Intergenic
902838888 1:19063116-19063138 CCACGTCCTGGGGTTGGGCAGGG - Intergenic
903183708 1:21618089-21618111 TCACCTCTTACAGATGGGCAGGG + Intronic
903267565 1:22167111-22167133 CCACCTCCTGCAGGTGCTCTGGG - Intergenic
903548574 1:24142243-24142265 CCTCGTCCTGCACTTGAGCAAGG + Intronic
903973833 1:27136630-27136652 CCACCACCTGCTGCTTGGCACGG + Intronic
904205619 1:28853200-28853222 CAACCCCTTGCAGTTGGGCATGG + Intronic
904407679 1:30303904-30303926 CCACACCCTGCAGTGGGTCAGGG - Intergenic
905385864 1:37603642-37603664 GCAGCCCCTGCAGTGGGGCATGG + Intergenic
905708671 1:40082077-40082099 CCACCTCCTCAAAATGGGCACGG + Intronic
906078598 1:43069226-43069248 CCTCCCCCTGCAGCTGGGGACGG + Intergenic
906689233 1:47781729-47781751 GCGCCTCCTGGAGTTGTGCAAGG - Intronic
910033302 1:82758852-82758874 TCAAGTCCTGCAGTTGGTCATGG - Intergenic
911666418 1:100557799-100557821 GCACTGCCTGCAGTTGGGGAAGG + Intergenic
914098408 1:144563571-144563593 TCACCTCCTGCCGTTTGGCTGGG + Intergenic
914300574 1:146374071-146374093 TCACCTCCTGCCGTTTGGCTGGG - Intergenic
914518113 1:148391361-148391383 TCACCTCCTGCCGTTTGGCTGGG + Intergenic
915814501 1:158952200-158952222 CTAGCTCCTGCAGCTGGGCCTGG + Intronic
917543702 1:175940185-175940207 TCACCTCCTGCTGTTCGGCCTGG + Intergenic
918302763 1:183219022-183219044 CCACCTCCTCCAGTGTGGCTTGG - Intronic
919354422 1:196502952-196502974 CCACCTCATACAGTTGGGCAGGG - Intronic
919458967 1:197854157-197854179 CCAACCCCTGCAGTTGTTCAAGG - Intergenic
923998840 1:239528272-239528294 CCAATTCCTGCTGTTGTGCAAGG + Intronic
1062920511 10:1275326-1275348 CCACCTCCTCCAGCTGGGGTGGG - Intronic
1064014154 10:11759885-11759907 GCACCTCCTGCAGTATTGCAAGG - Intronic
1065384963 10:25125433-25125455 CCACCTCCTTCACCAGGGCAGGG - Intergenic
1065695438 10:28375606-28375628 CCACCCCCTGCATTTTGCCAAGG + Intergenic
1067004508 10:42648110-42648132 CCTCCTTCTGCTGCTGGGCAGGG + Intergenic
1067040661 10:42951704-42951726 CTACCTCCCCCAGTTGGGCCGGG + Intergenic
1067476879 10:46573200-46573222 CCACCTCCTACGGCTGGCCAGGG - Intergenic
1067617858 10:47768580-47768602 CCACCTCCTACGGCTGGCCAGGG + Intergenic
1069512532 10:69053047-69053069 ACACCCCCTGGAGTTGTGCAAGG - Intergenic
1069740399 10:70683534-70683556 CCACCTCCTGGAATTTGGCTGGG - Intronic
1069851372 10:71407375-71407397 GCGCCTCCAGCATTTGGGCAGGG + Intronic
1070534922 10:77369653-77369675 CTAGCTCCTGGGGTTGGGCAGGG - Intronic
1070587148 10:77775026-77775048 CCACCTCCAGCAGTCTGGCAGGG - Intergenic
1070599079 10:77853350-77853372 CTACCTGCTGCTGCTGGGCACGG + Exonic
1071499057 10:86190577-86190599 CCCCATCCTGCAGGTGTGCAGGG + Intronic
1073135432 10:101217631-101217653 CGACCTCGTGCGGTTGGGGAAGG + Intergenic
1073649731 10:105345369-105345391 CCAAACCCTGCAGTTGGCCAAGG + Intergenic
1074685699 10:115960699-115960721 CCATGTCTTGCAGGTGGGCAAGG - Intergenic
1075336586 10:121613282-121613304 CTGCCTCCTGCAGCTGGGGAAGG + Intergenic
1075679782 10:124323800-124323822 CCACATCTTGGAGGTGGGCACGG - Intergenic
1076736854 10:132462818-132462840 CCACCTGCTGCCGGTGGGCACGG + Intergenic
1077305228 11:1865932-1865954 CCAACACCTGCAGGTGGACAAGG - Intronic
1077497086 11:2891615-2891637 CCTCCTCCTGCAGTGGAGGAGGG - Intronic
1079267757 11:18951139-18951161 CCACCTCATGTATTTGGTCATGG - Intergenic
1080406540 11:31985051-31985073 CCACCTCCAGCTGGTGGACATGG - Intronic
1080878985 11:36301575-36301597 CCACTTCCTCCAGCTGGGAAGGG - Intronic
1081685501 11:45040145-45040167 TCAGCTGCTGCAGTTTGGCAAGG + Intergenic
1081875788 11:46407568-46407590 CCACCTCCTGCATTTGTGCTTGG - Intronic
1082711612 11:56559985-56560007 CCACCTCCAGCAGTAGGAGACGG - Intergenic
1083571743 11:63764970-63764992 GCACCTCCAGCACGTGGGCACGG + Exonic
1084172874 11:67409097-67409119 CCTCCTCCTGCAGCTGCGCGGGG - Exonic
1084496887 11:69510403-69510425 CCAGCCACTGCAGTCGGGCAAGG - Intergenic
1084521051 11:69663062-69663084 TCACCTCCTGCTGTGGGGCCCGG - Intronic
1085051644 11:73383058-73383080 ACACCCCCAGAAGTTGGGCATGG - Intronic
1085341931 11:75737413-75737435 ACACTTCCTGCAGCTGGGAATGG - Intergenic
1087406822 11:97741105-97741127 CCACCTCCTTGAGTTGGGTTAGG + Intergenic
1087812490 11:102623312-102623334 TCACCTCCTGCTGTGGGGCCAGG - Intronic
1088427970 11:109725827-109725849 CCACCTTCTGCAGAGGAGCAAGG + Intergenic
1089459921 11:118646609-118646631 ACAGCTCCTTCACTTGGGCACGG + Intronic
1090651542 11:128810802-128810824 TCACCTTCTGCTGGTGGGCATGG - Exonic
1091323315 11:134666653-134666675 CCACCTCCTCCTGTGGGGTAAGG + Intergenic
1096555389 12:52400616-52400638 CCACGTCCTGCAGCAGAGCAGGG + Exonic
1096714410 12:53482689-53482711 CCACCTCCTCCAGTAGGGCCTGG - Exonic
1099518616 12:83630370-83630392 TGACCCCCTGCAGTTAGGCAGGG - Intergenic
1100198362 12:92272565-92272587 TCACCTTCTTGAGTTGGGCAGGG + Intergenic
1100393521 12:94164544-94164566 GCACCCCCTGCAGTTGTGCAGGG + Intronic
1100924613 12:99530527-99530549 TTACCTGTTGCAGTTGGGCAAGG - Intronic
1101635508 12:106537397-106537419 TCACCTCCTGCTGTGTGGCACGG - Intronic
1101865890 12:108519058-108519080 CCACATCCTGCGGATGGGGAGGG - Exonic
1102821131 12:115910051-115910073 CCACCACATGCAGCTGGGAAGGG + Intergenic
1103822905 12:123712607-123712629 GCTCTTCCTGCAGTCGGGCACGG + Exonic
1104225444 12:126828191-126828213 CCAACTCCTGCAGCAGAGCATGG - Intergenic
1104899341 12:132179928-132179950 CCACCACCTGCTGTAGGGAATGG + Intergenic
1104929100 12:132328984-132329006 CCACCTCCTCCAGGTGGTCCAGG + Intronic
1104934025 12:132355078-132355100 CCACCCCATGCAGGTGGGCCTGG - Intergenic
1104986440 12:132600245-132600267 CCTCCCCCGGCAGGTGGGCATGG + Intergenic
1105070935 12:133234230-133234252 CCAAAGGCTGCAGTTGGGCAAGG + Exonic
1105669835 13:22600807-22600829 CCACCTCCTGCTGTGCGGCCTGG + Intergenic
1109267780 13:60220946-60220968 CCATCTCCTGCAGGTTGGAAGGG + Intergenic
1110866084 13:80397970-80397992 CCACTTGCTGCAGTTTGCCATGG - Intergenic
1112342685 13:98565754-98565776 CCACCTCCTTAGGGTGGGCATGG - Intronic
1113929487 13:113958836-113958858 CCACCACGTGCAGCTGTGCAGGG - Intergenic
1113973359 13:114207654-114207676 TCACCTCCTGCTGTTTGGCCTGG + Intergenic
1114982039 14:28177344-28177366 TCACCTCCTGCTGTGTGGCATGG - Intergenic
1119587268 14:75848106-75848128 CCCCTTCCTTCAGTTGGCCAAGG - Intronic
1120501877 14:85307767-85307789 CCATGTCCTGAAGCTGGGCATGG + Intergenic
1120877254 14:89386407-89386429 GCACCTCCTGCAGTTGTGCAGGG - Intronic
1121166050 14:91801540-91801562 CCAGCTTCTGCGGTGGGGCAGGG + Intronic
1121219561 14:92275401-92275423 CCACCTGCTACAGTTGGGTATGG - Intergenic
1122048697 14:99040950-99040972 TCCCCTCCTGCAGGTGGGCACGG + Intergenic
1122146072 14:99689531-99689553 CCACCCCCTGCAATTTGCCAGGG - Intronic
1122159021 14:99769355-99769377 CCACCTCCTGCTGGTGCCCACGG - Intronic
1123162144 14:106288938-106288960 CCGCCTCCTGCAGCTGAGAAAGG + Intergenic
1123180266 14:106463104-106463126 CCGCCTCCTGCAGCTGAGAAAGG + Intergenic
1123720380 15:23055811-23055833 AAACTGCCTGCAGTTGGGCAAGG + Intergenic
1126661849 15:51040022-51040044 CCACCTCCTGCTGTGCGGCCTGG - Intergenic
1127300428 15:57647724-57647746 ACACCTCCTGCACTTGGCCCTGG + Intronic
1127313919 15:57776969-57776991 CCCCTCTCTGCAGTTGGGCATGG - Intronic
1128327060 15:66730572-66730594 CCACCTCATGCAGGAGGACATGG + Intronic
1128419745 15:67480261-67480283 CCTCCTCCTGAAGTTGGGCATGG + Intronic
1131083347 15:89555145-89555167 ACTCTTGCTGCAGTTGGGCAGGG - Intergenic
1132107451 15:99073553-99073575 CAGCCTCTTGCAGTTGGGCTTGG - Intergenic
1132609645 16:808934-808956 CCTCCTCCTGCCCTTGGACAGGG - Intronic
1132726920 16:1342908-1342930 CCAGCTGCTGGAGTTGGGCTGGG - Exonic
1133535804 16:6701313-6701335 TCACCCCCTGCAGCTGGGTACGG + Intronic
1133702646 16:8323472-8323494 CCACCTTCTGAAGGTGGGCATGG - Intergenic
1134238665 16:12487592-12487614 CCAGCTCCTAGATTTGGGCATGG - Intronic
1134679448 16:16114004-16114026 TCACCTCCTGCTGTGGGGCCTGG + Intronic
1135761386 16:25141019-25141041 CCACCCCCTAAAGTTAGGCAGGG - Intronic
1136121118 16:28135239-28135261 CCAACTCCTCCAGCTGGGCTTGG + Exonic
1138320057 16:56104008-56104030 GCACCCCCTGGAGTTGTGCAAGG - Intergenic
1138655787 16:58490494-58490516 ACACCACCTGCAGTAGGGCCAGG - Intronic
1138739456 16:59290923-59290945 CAACCTGGTGCAGTTGGGCTTGG + Intergenic
1140931334 16:79630901-79630923 CCACCTCCTGCTGCTGGGGGAGG + Intergenic
1141948353 16:87325087-87325109 TCACCTGCTGGTGTTGGGCATGG + Intronic
1143724549 17:8836283-8836305 CCACCTTCTGCATGTGAGCAGGG + Intronic
1144711452 17:17404149-17404171 CCACCTGCTCCAGTGTGGCAGGG + Intergenic
1145066295 17:19763537-19763559 CCACCTCCTGAATCTGGGCTTGG + Intergenic
1146287155 17:31581711-31581733 TGACCTCCTGGAGTTGGGCTGGG + Intergenic
1146296605 17:31655100-31655122 CCAAGCCCTGCAGTGGGGCAAGG + Intergenic
1147603250 17:41758804-41758826 CTGCCTCCTGCAGCGGGGCATGG + Exonic
1149696591 17:58621152-58621174 CCACCTCCTGCAGCTGTGATGGG + Intronic
1150285159 17:63950117-63950139 CCACCTCCTCCTGCTGGGCCAGG + Intronic
1150302306 17:64056632-64056654 CCACCTCCTGCACATGGGTAGGG - Intronic
1150391841 17:64794359-64794381 CCAACCACTGCAGATGGGCAGGG + Intergenic
1151797026 17:76353424-76353446 CCACCTCCTGCACCTGGGGCGGG - Intronic
1151945366 17:77316639-77316661 CGAACTCCTGCTGTGGGGCAGGG - Intronic
1152246403 17:79186916-79186938 GCCTCTCCTCCAGTTGGGCAGGG + Intronic
1152398570 17:80050084-80050106 CCAGCTCCTGCCGCTGGGCTCGG - Exonic
1152580755 17:81164721-81164743 CCACCCCCTGCCCTTGGGCCGGG + Intronic
1152775905 17:82201842-82201864 CCGCCTCCTGCAGCTGGGTGCGG + Exonic
1152851102 17:82636508-82636530 CCACCTCCTGCAGCTGAAGAGGG + Intronic
1153784919 18:8526054-8526076 TCACCTCCTGGGGATGGGCACGG - Intergenic
1157559769 18:48638024-48638046 CCACCTCCTGCAGTTGGGCAAGG - Intronic
1157559871 18:48638541-48638563 TGACCTCCTGCAGGTGGGGAAGG - Intronic
1160246464 18:77163974-77163996 GCACCTCCTGCAGCAGGACACGG + Intergenic
1160698092 19:494312-494334 CTACTTCCTGCAGGTGGGGAGGG - Intronic
1160797941 19:954354-954376 CCACTTCCTGCTGTGGGGGATGG - Intronic
1162100369 19:8335268-8335290 GCACCAGCTGCAGTTGGGCAGGG + Exonic
1164460538 19:28443849-28443871 CCAAATCCTGCGGCTGGGCATGG + Intergenic
1164550032 19:29202555-29202577 CCATTTCCTGCATTGGGGCATGG - Intergenic
1166738522 19:45100320-45100342 CCACCTGCTGCAGTAGGGCATGG + Intronic
1167440254 19:49504315-49504337 GCACCTCCTGCAGCAGGTCATGG + Intergenic
1167638307 19:50667567-50667589 CCTCCTGCTGCAGCTGGGGACGG - Exonic
1168354261 19:55692003-55692025 CCAGCCCCTGCAGCTGGGGAGGG + Exonic
927195993 2:20547200-20547222 CCACCTCCTGCCTTTGGGCATGG + Intergenic
927339567 2:21966856-21966878 TCACCTCCTGCAGTACGGCCCGG + Intergenic
929071544 2:38036547-38036569 CCACGACCTGCAGTTGGACAGGG - Intronic
929532329 2:42761028-42761050 CCAGCCCCTGGAGCTGGGCAAGG + Intergenic
933180236 2:79218214-79218236 CCACTTCCTGCCTTTGGGCAGGG - Intronic
934989531 2:98911615-98911637 CCAGCTCCTTCAGGTGGGCTTGG - Intronic
937014237 2:118589066-118589088 TCACCTCCTGCTGTGGGGCCTGG + Intergenic
937049280 2:118875395-118875417 CCACCACCTGCCTTTGGGCCAGG - Intergenic
937331516 2:121033254-121033276 CCACCTCCTGCAGGGGCTCAGGG - Intergenic
937535887 2:122886594-122886616 CCACCTCTAGAAGTTGGGAACGG + Intergenic
938135633 2:128754290-128754312 CCACATCCTGCAGCTGGCCTGGG - Intergenic
938568939 2:132544648-132544670 ACTCATCCTGCAGTTGGGCTGGG + Intronic
938980388 2:136520815-136520837 CTACCTACTCCAGATGGGCAAGG - Intergenic
940743331 2:157538093-157538115 CCACCACCTGCAGGGGGGCTAGG - Intronic
941213477 2:162673546-162673568 CCAAATCATGCAATTGGGCATGG - Intronic
943112946 2:183628828-183628850 CCAGCTCCTGCAATTGTGTAAGG + Intergenic
943182409 2:184560776-184560798 CCCCCTCCGGAATTTGGGCAGGG - Intergenic
944439469 2:199727493-199727515 CCACCTCCTTTAGCTGGGGATGG + Intergenic
946518678 2:220442210-220442232 CCACACCCTGCAGTTAGGCAAGG - Intergenic
946816277 2:223581975-223581997 CAACCCCTTGCAGTTGGGCAGGG - Intergenic
947199230 2:227599786-227599808 CAACCTCCTGAAGCTGGCCATGG + Intergenic
948631194 2:239303782-239303804 CCGCGCCCTGCAGTTGAGCACGG - Intronic
948824746 2:240568709-240568731 CCGCCACCTGCAGCTGGGCCTGG + Exonic
948893594 2:240918327-240918349 CCACCTGCTCCAGGTGGGCGAGG + Intergenic
1169197193 20:3689619-3689641 CCTGCTCCTGCTGTTGGGCCTGG - Exonic
1169322020 20:4640785-4640807 TCACCTCCTGCTGTGGGGCCCGG - Intergenic
1171206602 20:23286560-23286582 GCACCGCCTGGAGTTGGGGAGGG + Intergenic
1171318717 20:24220202-24220224 CCACATCCTGCAGATTGGTAGGG + Intergenic
1171817535 20:29801623-29801645 TCAGCCCCTGCAGTTGGGAAAGG - Intergenic
1172029056 20:31968730-31968752 CCACCTCCTGCAGCTCGGCCAGG + Exonic
1172692191 20:36797561-36797583 CAGCCTTCTGCAGCTGGGCAAGG + Exonic
1172867204 20:38109486-38109508 CACCCTCCTGCAATTGGCCAGGG - Intronic
1172878655 20:38182466-38182488 CCAGCCCCTGCAGTTGAGGAAGG - Intergenic
1174034496 20:47660065-47660087 CTCCCTCCTGCACTTGGTCAGGG - Intronic
1175876377 20:62232183-62232205 CCACCTCCTGCAGATGCCCTGGG + Intronic
1176020241 20:62958998-62959020 CCAGCTCCTGCAGTGGGACCTGG - Intronic
1176173891 20:63708619-63708641 CCACCTGCTGCAGCTGCGCACGG - Exonic
1178744635 21:35237119-35237141 TCACCTCCTGCAGTATGGCCTGG - Intronic
1178916196 21:36706783-36706805 CCACCTCCACCAGGTGGGAAAGG + Intronic
1179984806 21:44914322-44914344 CCACTTCCTGCAGCTGGGCTGGG - Intronic
1180048388 21:45320259-45320281 CCTCCTCCTGCAGGTGGCCCAGG + Intergenic
1180320869 22:11320282-11320304 TCAGCCCCTGCAGTTGGGAAAGG - Intergenic
1180334174 22:11560463-11560485 TCAGCCCCTGCAGTTGGGAAAGG + Intergenic
1180605895 22:17058430-17058452 CCCCATCCTGCACTTGTGCAAGG - Intergenic
1180831905 22:18910872-18910894 CCACCGCCTGCCGTGGGGCCGGG - Exonic
1180955627 22:19739995-19740017 GGACCTGCTGCAGTTGGGCTTGG - Intergenic
1181048909 22:20229531-20229553 CCACCTCCTGCGGGTGGCCCTGG - Intergenic
1181260062 22:21591188-21591210 CAACCTCCTGCAGTGAGGAATGG - Intronic
1181556956 22:23676708-23676730 ACACCTGCTGCAGGTGGGCCTGG + Intergenic
1181697415 22:24600828-24600850 ACACCTGCTGCAGGTGGGCCTGG - Intronic
1181739441 22:24908970-24908992 TCACCTCCTGCCGTGCGGCAAGG - Intronic
1182278818 22:29206437-29206459 CCTCCCCCTGCACTTGGGAAAGG + Intronic
1183305713 22:37082043-37082065 CTCCCTGATGCAGTTGGGCAAGG - Intronic
1183384611 22:37507846-37507868 CAATCTCCTCCAGTTGGGCCAGG + Exonic
1183709201 22:39492478-39492500 CACCCTCCTGCAGGTGGGCAGGG + Intergenic
1183802333 22:40177190-40177212 CTACCTCCTGCGGTGGGGGAGGG + Intronic
1184692402 22:46123223-46123245 CGACCTTCTGCAGCCGGGCATGG - Intergenic
1185000590 22:48243083-48243105 GGACCCCCTGCAGTTGAGCAAGG + Intergenic
1203281983 22_KI270734v1_random:136143-136165 CCACCGCCTGCCGTGGGGCCGGG - Intergenic
949475477 3:4441071-4441093 TCACCTCCTGCTGTTTGGCCCGG - Intronic
949934508 3:9106422-9106444 CCACCTCCAGGAGCTGGCCAAGG + Intronic
950027310 3:9829062-9829084 CCATCTCCTGCAGGTGGGCCTGG - Exonic
950669733 3:14518779-14518801 CCAGGTCCCGCAGTTGGTCAGGG - Intronic
950771472 3:15314847-15314869 CCTACTCCTGAAGTTGGTCAGGG - Intronic
951415883 3:22420655-22420677 CCACCTCCCACATTTGGTCATGG + Intergenic
953925030 3:46978484-46978506 CCAACCCCTGGTGTTGGGCAGGG - Intronic
955551848 3:60093592-60093614 TCACCTCCTGCTGTGTGGCACGG - Intronic
957486579 3:80870415-80870437 ACACCAGCTGCAGTTGGGGAGGG + Intergenic
959253033 3:103972511-103972533 CTACCTTCTGCACTGGGGCAGGG + Intergenic
962208485 3:133455778-133455800 CCACCTCCTGTAGGGGAGCACGG + Intronic
963631576 3:147737985-147738007 CAATCTCCTGCTGTAGGGCAAGG - Intergenic
964315803 3:155443074-155443096 CTACCTCCTGGAGTTTTGCAAGG + Intronic
964667490 3:159190164-159190186 CCACCCACTGCAGCTGAGCAGGG - Intronic
967394560 3:188992470-188992492 CCACCTCTCGAAGTTGGACATGG - Intronic
967432010 3:189396781-189396803 CTACCTCCAGGACTTGGGCAGGG + Intergenic
968090061 3:195893921-195893943 CCACCTCCTGGAGTTAGACCAGG - Intronic
968504506 4:965655-965677 CCTGCTCCTGGAGTGGGGCAGGG - Intronic
968734993 4:2290681-2290703 CCCTCTCCTGCTGTGGGGCAGGG + Intronic
968782888 4:2596491-2596513 CCACCTACTGCAGTGTGGCCAGG - Intronic
969493973 4:7515380-7515402 CCACCTGCTGGGGCTGGGCAGGG + Intronic
969569224 4:7998748-7998770 CCACCTCCTGCTGCTGGGTGGGG + Intronic
969641643 4:8402278-8402300 TCACTTCCTGCAGGTGGGCAGGG - Intronic
972975698 4:44632938-44632960 CCACCTCCTGCTGTGCGGCCCGG - Intronic
975417210 4:74118735-74118757 TCACCTCCTGCTGTGTGGCATGG - Intronic
976503455 4:85818288-85818310 TCACCCCCTGCAGGTGGGCAGGG - Intronic
976705624 4:88016154-88016176 TCACCTCCTGCTGTGGGGCCCGG + Intronic
981591316 4:146365875-146365897 TCACCTCCTGCAGTGCGGCCGGG - Intronic
983368493 4:166827298-166827320 CCACCTCCTGCCTTTTGGAAAGG + Intronic
984866882 4:184288543-184288565 CCACCTGCTGCAGCAGGGCTGGG - Intergenic
985034034 4:185820528-185820550 CCAAGTCCTGCAGTTGGGGAAGG + Intronic
985096765 4:186420544-186420566 CTCCCTCCTGCTGCTGGGCAGGG - Intergenic
985654362 5:1122189-1122211 CCACCGCCTGCCCTTGCGCATGG + Intergenic
985717204 5:1469336-1469358 GCCCCACCTGCAGGTGGGCAGGG - Intronic
985985857 5:3515709-3515731 GGGCCTCCTGCATTTGGGCAGGG - Intergenic
986590441 5:9363408-9363430 CCACCTCCTGCAGTAGGTAAGGG + Intronic
987017852 5:13838328-13838350 CCACCTCCTGCTGTGTGGCCCGG - Intronic
987674879 5:21062244-21062266 CCACCTCCTACAGGTGGGGTTGG - Intergenic
988882280 5:35516605-35516627 TCACCTCCTGCTGTGGGGCCTGG - Intergenic
990247121 5:53874202-53874224 CCACCTCCTGCTGTGAGGCCTGG + Intergenic
994841735 5:104932633-104932655 CCACCTCCTGCTGTGCGGCCTGG + Intergenic
996881995 5:128309246-128309268 CCTGTTCCTGGAGTTGGGCATGG + Exonic
997796955 5:136820025-136820047 TCACCACCTGCAGTAGGGCATGG - Intergenic
997840415 5:137234356-137234378 CCACCTTCTCCTGTTGGGCAAGG + Intronic
997902177 5:137777184-137777206 CAAACTCCTGCATTTAGGCAAGG + Intergenic
1001011348 5:168101541-168101563 TCACCACCTGCAGTGTGGCAGGG + Intronic
1001286684 5:170428809-170428831 GCACCACCCGCAGCTGGGCAGGG - Intronic
1001760637 5:174205222-174205244 CAACCTCCTGCAGAGGGGCAGGG + Intronic
1003141757 6:3477699-3477721 CCACCTCCTGCTGTGTGGCCTGG + Intergenic
1003483142 6:6551748-6551770 TCACCTCCTGCAGTTGAGTAGGG + Intergenic
1004327277 6:14686741-14686763 TCACCTCCTGCTGTGTGGCACGG + Intergenic
1005027364 6:21476366-21476388 GCACCTGCTGCAGTGTGGCACGG + Intergenic
1005423698 6:25679101-25679123 CCACCACCATCAGCTGGGCATGG + Intronic
1007595057 6:43046136-43046158 CCACCCCCTGGACTTGGCCATGG - Intronic
1010360434 6:74987070-74987092 CCAGCTCCTGCAGTTGCTAAAGG + Intergenic
1010780298 6:79938017-79938039 ACATCACCTGCACTTGGGCATGG - Intronic
1011656627 6:89557670-89557692 TCACCTCCTGCTGTGTGGCAAGG - Intronic
1015145084 6:129976592-129976614 TCACCTCCTGCTGTGTGGCAGGG + Intergenic
1015759532 6:136644008-136644030 CCACCTCCTGCTCCTGGACATGG - Intronic
1016450365 6:144176104-144176126 CCTCCTCCTGCAAAGGGGCATGG - Intronic
1016880287 6:148904908-148904930 CCACCTCCTGCAGCTGCCCTAGG + Intronic
1018724932 6:166604535-166604557 CCACCTCCCCCAGCTGGGGATGG - Intronic
1018956306 6:168412706-168412728 CCACCTCCGGCAGGTGCGAAGGG - Intergenic
1019204747 6:170350514-170350536 CCACCTCCTACAGGTGGGTGTGG + Intronic
1020142745 7:5621549-5621571 CCACCTCCTGAAGCAGGGCCTGG - Intronic
1020184322 7:5947355-5947377 CCGCCTCCTGCAGATCAGCAGGG - Intronic
1020298595 7:6777411-6777433 CCGCCTCCTGCAGATCAGCAGGG + Intronic
1021782847 7:24122699-24122721 CCAACACCTGCTGTTGGCCATGG + Intergenic
1021866192 7:24960914-24960936 CCACTTCCCGAAGGTGGGCAAGG - Intronic
1022235324 7:28455238-28455260 ACAGCTCCTGCAGTTCGGCTCGG - Intronic
1023133104 7:37023521-37023543 TCAGCTTCTGAAGTTGGGCAGGG + Intronic
1023401761 7:39796437-39796459 TCTCATCCTGCATTTGGGCATGG + Intergenic
1024524035 7:50332890-50332912 CCAACTCCTGAAGTTGGGAGGGG + Intronic
1024780834 7:52846463-52846485 TCACCTCCTGCTGTGTGGCATGG + Intergenic
1024950984 7:54860229-54860251 TCCCCTCCTGGAGTGGGGCAGGG + Intergenic
1029109720 7:98206812-98206834 CCACATCCTGCAGCTGTGAAGGG + Exonic
1030114657 7:106054120-106054142 CCACCTCCTTGAGGTGGGTAGGG + Intergenic
1032239547 7:130150038-130150060 CTTCCGCCTGCAGTTGGGCATGG + Intergenic
1032516290 7:132508633-132508655 CCACCTCCTCATGGTGGGCATGG - Exonic
1033527024 7:142226161-142226183 CCACCTCCAGCAGTGAGGAAGGG - Intergenic
1034987329 7:155524383-155524405 TCACCTCCTGCAGTTCAGCCTGG - Intronic
1036285199 8:7438371-7438393 CCACCTCATGCTGTGTGGCATGG - Intergenic
1036336277 8:7873158-7873180 CCACCTCATGCTGTGTGGCACGG + Intergenic
1036723596 8:11200583-11200605 CCACCTGCTGCAGATGGGGCAGG - Exonic
1036787422 8:11697501-11697523 GCACCTGCTGCAGTTGGGGAGGG + Intronic
1037290843 8:17347960-17347982 CCACCACCTGGATTTGGCCATGG - Intronic
1037953994 8:23039232-23039254 CCACCTCCTGCTGTGTGGCCTGG + Intronic
1039049383 8:33479113-33479135 TCTGCTCCTCCAGTTGGGCACGG + Intronic
1040015511 8:42696123-42696145 CCAGCTCCTGCAGGAGGGCTTGG - Intergenic
1044446544 8:92283899-92283921 TCAGCTCCTGCAGTTGAACAAGG + Intergenic
1045349026 8:101321513-101321535 CCAGCACTTGCAGTTAGGCAGGG - Intergenic
1045703289 8:104891985-104892007 CCACCTCCTGCAGCTGTGTCTGG - Intronic
1047310831 8:123690429-123690451 GCGCCTCCTGGAGTTGTGCAAGG - Intronic
1048362383 8:133709083-133709105 GCACCTTCTTCAGCTGGGCATGG - Intergenic
1049180507 8:141219701-141219723 CCACGTCCAGCAGATAGGCACGG + Exonic
1049379565 8:142305295-142305317 CCACCTCCTGCATGTGGAGAAGG + Intronic
1049386188 8:142344260-142344282 CCACCAGCTGCTGTTTGGCACGG - Exonic
1049456892 8:142697030-142697052 CGCCCTCCTGAAGTTGTGCAGGG + Intergenic
1049501971 8:142971734-142971756 CCACCACCTGCAGGAGGTCAGGG + Intergenic
1051990008 9:23141566-23141588 TCACCTCCGGCAGTTTGGAAAGG + Intergenic
1052515253 9:29472178-29472200 CCACCTCCTACAGGTGTGTATGG - Intergenic
1056474049 9:86935895-86935917 CCACCTCTTGAAGCTGGGCTTGG + Intergenic
1056768634 9:89460831-89460853 CCTCCTCCTGCAGACAGGCAGGG + Intronic
1057269564 9:93643110-93643132 TCACCTCCTTCTGTGGGGCATGG + Intronic
1057326072 9:94065360-94065382 CCACCACCGGCAGTTAGCCAAGG + Intronic
1057351149 9:94299919-94299941 TCACCTCCTGCAGATGAGCTTGG - Exonic
1057574891 9:96234367-96234389 CCAACTCCTGCATTAGAGCAAGG + Intergenic
1057796344 9:98160702-98160724 CCACCCCCAGCAGTTGCTCAAGG - Intronic
1057903761 9:98968759-98968781 TCAGCTCCTGCAGTTGGGCCTGG + Intronic
1058066468 9:100554135-100554157 TCTCCTCCTGCAGCTGGCCAGGG + Intronic
1059391048 9:113999677-113999699 CCCCCCACTGCAGTTGGGCCAGG + Intronic
1059662285 9:116413933-116413955 CCAGCTCCTGAAATTGGGCATGG - Intergenic
1059697712 9:116744600-116744622 CCACCACGTGCAGTTGGCAATGG - Intronic
1060141595 9:121215056-121215078 CTACCACCAGAAGTTGGGCAAGG - Intronic
1060915866 9:127390152-127390174 TCCCCTCCTGCAGTTGTTCAGGG - Intronic
1060980107 9:127786623-127786645 CCTCCTCCTGTAGTGGGGGAGGG + Intronic
1061263456 9:129492464-129492486 CCAAGTACTGCAGTTGGGCTGGG - Intergenic
1061860268 9:133464363-133464385 CCACCCCCTGAAGCTGGGCTGGG - Intronic
1061921133 9:133783219-133783241 CTTCCTCCTGGAGTGGGGCAGGG + Intronic
1062117666 9:134818042-134818064 CCTCCTCCCTCAGGTGGGCAAGG - Intronic
1062376359 9:136263618-136263640 CCACCTGCTGCAGCTTGGCCTGG + Intergenic
1203369091 Un_KI270442v1:286056-286078 TCAGCCCCTGCAGTTGGGAAAGG - Intergenic
1186487459 X:9944628-9944650 TGAGCTCCTGCTGTTGGGCACGG - Exonic
1189425664 X:40897551-40897573 CCACCTCCTGCTGGTAGCCAAGG - Intergenic
1191896132 X:65995314-65995336 CCACCTCCTCTAGTTGCTCACGG - Intergenic
1193360584 X:80574541-80574563 CAACCTTCTGCACTTGGTCATGG + Intergenic
1197772421 X:130097884-130097906 CCACTTCCTGCAGCTAGGCCTGG + Intronic
1198087181 X:133292735-133292757 CCACCTCCTGCAGTGGGCACAGG - Intergenic
1199595321 X:149502355-149502377 CCTCCAGCTGCATTTGGGCAAGG + Intronic
1200908807 Y:8513527-8513549 CAACCCGCTGCAGTTGGGCATGG - Intergenic
1201244189 Y:11986877-11986899 ACCCCTCCTGCAGCTGGGCAGGG + Intergenic