ID: 1157560509

View in Genome Browser
Species Human (GRCh38)
Location 18:48642308-48642330
Sequence GTGGTTCAGTTGGTCTCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 201}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157560504_1157560509 4 Left 1157560504 18:48642281-48642303 CCACAAGAACTGTGGTGATTCCA 0: 1
1: 1
2: 0
3: 13
4: 134
Right 1157560509 18:48642308-48642330 GTGGTTCAGTTGGTCTCTGTGGG 0: 1
1: 0
2: 1
3: 18
4: 201
1157560503_1157560509 9 Left 1157560503 18:48642276-48642298 CCTGGCCACAAGAACTGTGGTGA 0: 1
1: 0
2: 0
3: 8
4: 153
Right 1157560509 18:48642308-48642330 GTGGTTCAGTTGGTCTCTGTGGG 0: 1
1: 0
2: 1
3: 18
4: 201
1157560501_1157560509 24 Left 1157560501 18:48642261-48642283 CCAAAGAGATGTCATCCTGGCCA 0: 1
1: 0
2: 2
3: 12
4: 173
Right 1157560509 18:48642308-48642330 GTGGTTCAGTTGGTCTCTGTGGG 0: 1
1: 0
2: 1
3: 18
4: 201
1157560499_1157560509 26 Left 1157560499 18:48642259-48642281 CCCCAAAGAGATGTCATCCTGGC 0: 1
1: 0
2: 0
3: 16
4: 163
Right 1157560509 18:48642308-48642330 GTGGTTCAGTTGGTCTCTGTGGG 0: 1
1: 0
2: 1
3: 18
4: 201
1157560500_1157560509 25 Left 1157560500 18:48642260-48642282 CCCAAAGAGATGTCATCCTGGCC 0: 1
1: 0
2: 2
3: 12
4: 163
Right 1157560509 18:48642308-48642330 GTGGTTCAGTTGGTCTCTGTGGG 0: 1
1: 0
2: 1
3: 18
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157560509 Original CRISPR GTGGTTCAGTTGGTCTCTGT GGG Intronic
900630355 1:3631795-3631817 TGGGTTCAGTTGGGCCCTGTAGG + Intronic
901171800 1:7264195-7264217 CTGATTCAGTTGGTCTGGGTGGG + Intronic
902641756 1:17771122-17771144 GTGGGCCATATGGTCTCTGTCGG + Intronic
904134135 1:28297994-28298016 GTGGCTCAGCTGGTCTTTGAAGG + Intergenic
904494502 1:30879038-30879060 GTGGTTCAGTAGGTCTGGGGTGG + Intronic
906057081 1:42925685-42925707 GTGGTTCATTTTGTGTGTGTGGG + Exonic
906138693 1:43519925-43519947 GTGTTTCAATTTGTCTCTGCTGG - Intergenic
907412840 1:54294634-54294656 GGGGTTCAAGTGGCCTCTGTGGG + Intronic
907700985 1:56788077-56788099 CTGGTTCAGTTGGTCTGAGTTGG - Intronic
907796763 1:57725547-57725569 GTGTTTCTGATGGTCTTTGTGGG + Intronic
910732295 1:90411383-90411405 CCGGTTCAGTTGGTGTCAGTTGG + Intergenic
910859810 1:91732386-91732408 CTGATTCAGTTGGTCTGGGTTGG + Intronic
914333318 1:146692885-146692907 GTTGTTCAGATCGTTTCTGTAGG - Intergenic
915728480 1:158035915-158035937 GTAGTTCTGTAGGGCTCTGTAGG - Intronic
917989631 1:180360508-180360530 GTGATTCATTAGGTCTCTGGTGG - Intronic
918131035 1:181629885-181629907 GTGGTTCTGTGCGTCTGTGTGGG + Intronic
918755024 1:188329378-188329400 GTGGTTTTTCTGGTCTCTGTAGG - Intergenic
920212899 1:204341309-204341331 CTGGTTCAGTTGGTCTCTGGTGG - Intronic
921241235 1:213185791-213185813 GTGGTTCTGTCTGTCTTTGTGGG + Intronic
921960193 1:221026228-221026250 GAGCTCCAGTTGGGCTCTGTGGG - Intergenic
922092799 1:222413322-222413344 GATGGTCAGTTGGTGTCTGTTGG - Intergenic
923659237 1:235944258-235944280 CTGGTTCAGTAGGTCTGGGTTGG - Intergenic
1063076188 10:2719129-2719151 GTGGTTCACTTGCTGTCTTTAGG + Intergenic
1063647757 10:7902631-7902653 GTAGTTCAGATGGTGTCTATCGG + Intronic
1064168454 10:13006819-13006841 GGGCTTCAGTTCCTCTCTGTGGG + Intronic
1065641962 10:27792185-27792207 GTAATTCAGTTGGTCTGTGATGG - Intergenic
1068212296 10:53935636-53935658 CTGGGTCATATGGTCTCTGTCGG - Intronic
1069099547 10:64302204-64302226 GTGGTTCAGTGGATCTCAGGTGG + Intergenic
1071361314 10:84848809-84848831 GTCTTTCAGTTGGTATTTGTAGG + Intergenic
1071471884 10:85989242-85989264 GTGGGTCATTTGCTGTCTGTAGG + Intronic
1072135474 10:92541839-92541861 ATGGCTCAGTAGGTCTCTGGTGG - Intronic
1073563824 10:104518908-104518930 GTGGTTCAGTTTCCTTCTGTGGG + Intergenic
1073608351 10:104918592-104918614 GTGGGGCAGTTGTCCTCTGTGGG - Intronic
1075593229 10:123707782-123707804 CTGGTTCAGTTGGTCTGGGGTGG - Intronic
1076341237 10:129746622-129746644 GTGCTTCAGTAGGTCTATTTTGG + Intronic
1077845975 11:6025366-6025388 ATGTTTCTGTTGCTCTCTGTAGG - Intergenic
1083528279 11:63393278-63393300 ATTCTTCACTTGGTCTCTGTTGG + Intronic
1083843188 11:65315974-65315996 GGGGTTCAGCGGGTCACTGTAGG - Intronic
1083901020 11:65643563-65643585 GTGTTTCAGCAGTTCTCTGTGGG - Intronic
1084693268 11:70739169-70739191 GAGGTTCAGTTGGTTGCTGGTGG - Intronic
1088501638 11:110489461-110489483 TTGTTTCAGTTGGTCTATGGTGG + Intergenic
1090298013 11:125607578-125607600 CTGATTCAGTAGGTCTGTGTTGG - Intronic
1090884302 11:130862264-130862286 GTGGTTCAGTGGGCCTGTGCAGG + Intergenic
1095081656 12:38006898-38006920 GTTATTCAGTTTGTCACTGTAGG - Intergenic
1097945314 12:65361370-65361392 CTTGTTCTGTTTGTCTCTGTTGG + Intronic
1098486592 12:71028523-71028545 GTGGTTCAGCTGGAGTCTGGAGG + Intergenic
1098692620 12:73507436-73507458 GTGGTTTAGGTGGTCTGTGGAGG + Intergenic
1098909941 12:76198765-76198787 CTGGTCCAGTTGGTATCAGTTGG - Intergenic
1101074634 12:101116101-101116123 GTGTTTCAGTTGGCCGCTGAAGG + Intronic
1101678189 12:106938916-106938938 TTGGCTTAGTTGGTCTCTGGTGG - Intergenic
1103652012 12:122440267-122440289 GTGGTTCTTCTGGTCTCTGCTGG - Intergenic
1108008091 13:45973023-45973045 GTTGTTCTGTTGGTCTCACTTGG - Intronic
1110213604 13:73002080-73002102 GTGGTTCAATTAGTTTTTGTTGG - Intronic
1111194510 13:84856111-84856133 GTAATTCACTTGGTTTCTGTTGG + Intergenic
1112332442 13:98486699-98486721 GTAGTTCAGCGGTTCTCTGTTGG - Intronic
1114138172 14:19877533-19877555 GTGACTCAGTTGCTCACTGTGGG - Intergenic
1114743418 14:25121369-25121391 CTGGTTCAGTAGGCCTGTGTGGG + Intergenic
1114747088 14:25160629-25160651 GTGGTTCAGAAGGTCTGTGGGGG + Intergenic
1118233809 14:63980738-63980760 GTGGTTCAGTTACTTTCTGATGG + Intronic
1118277553 14:64399337-64399359 GTGGCTCAGTTAGTGTCAGTGGG + Intronic
1119667547 14:76496165-76496187 GTGTTTCTGTTGGGCTCTGTGGG + Intronic
1121481537 14:94281108-94281130 GTGGTTGAGTGTGTCTGTGTAGG + Exonic
1121920583 14:97877262-97877284 CAGGTTCAGATGGTCACTGTTGG - Intergenic
1122279976 14:100616182-100616204 ATGGTTCTGTTGGTCTTTTTGGG + Intergenic
1124553136 15:30700665-30700687 CTGGTTCAGTAGGTCTGAGTGGG + Intronic
1124678107 15:31705005-31705027 CTGGTTCAGTAGGTCTGAGTGGG - Intronic
1127336119 15:57986422-57986444 GAGGTTCAGCTTGTCTCTTTTGG - Intronic
1131200669 15:90393152-90393174 GTGGTTCAGTAGGTCGGGGTGGG + Intronic
1131320373 15:91384192-91384214 GTGGATCACTTGCTCTCTTTGGG + Intergenic
1132225192 15:100134924-100134946 GAGGTGCAGTTGGTCTTTATAGG - Intronic
1134660260 16:15978830-15978852 GGGGTGCAGTTGGTGTCTGTTGG + Intronic
1134766213 16:16760461-16760483 GTGGTTCTGCTGGGCTCTGTTGG + Intergenic
1134885179 16:17784604-17784626 GTAGTGCAATTGGTCTTTGTAGG - Intergenic
1134979838 16:18598750-18598772 GTGATTCTGCTGGGCTCTGTTGG - Intergenic
1135713928 16:24744266-24744288 TTGGGTGAGGTGGTCTCTGTCGG + Intronic
1138775692 16:59721117-59721139 GTGGTTCTTCTGGTCTCTGCTGG - Intronic
1140000300 16:71018365-71018387 GTTGTTCAGATCGTTTCTGTAGG + Exonic
1141545988 16:84769567-84769589 GTGGTTCAGTTGTGCATTGTGGG + Intronic
1141690695 16:85594616-85594638 GTGGGTCAGATGGCCGCTGTGGG + Intergenic
1143956426 17:10673657-10673679 GAGGATCATTTGATCTCTGTTGG - Exonic
1148744100 17:49908783-49908805 GCGGATGAGGTGGTCTCTGTGGG + Intergenic
1149856184 17:60085028-60085050 GTTGTGCACTTGGTCTCAGTGGG - Intergenic
1149971916 17:61227354-61227376 GTAATTCATTTGGCCTCTGTGGG + Intronic
1157560509 18:48642308-48642330 GTGGTTCAGTTGGTCTCTGTGGG + Intronic
1158515869 18:58129835-58129857 GTGGTGGTGTTGGGCTCTGTTGG + Intronic
1158515900 18:58130036-58130058 GTGGCTATGTTGGGCTCTGTTGG + Intronic
1158515915 18:58130136-58130158 GTGGCTGTGTTGGGCTCTGTTGG + Intronic
1158515952 18:58130374-58130396 GTGGCTGTGTTGGGCTCTGTTGG + Intronic
1158515960 18:58130426-58130448 GTGGCTGTGTTGGGCTCTGTTGG + Intronic
1158516033 18:58130870-58130892 GTGGTGGTGTTGGGCTCTGTTGG + Intronic
1158516042 18:58130918-58130940 GTGGTGGTGTTGGGCTCTGTTGG + Intronic
1158516050 18:58130966-58130988 GTGGTGGTGTTGGGCTCTGTTGG + Intronic
1158516089 18:58131214-58131236 GTGGTGGTGTTGGGCTCTGTTGG + Intronic
1158516112 18:58131356-58131378 GTGGTGGTGTTGGGCTCTGTTGG + Intronic
1158516129 18:58131452-58131474 GTGGTGGTGTTGGGCTCTGTTGG + Intronic
1158516138 18:58131500-58131522 GTGGTGGTGTTGGGCTCTGTTGG + Intronic
1158584466 18:58719170-58719192 GTGGTTCTGCTGGTCTTTCTTGG + Intronic
1159898126 18:74016220-74016242 GTGTTTCAGTTTGACTCTGAAGG - Intergenic
1161033162 19:2069080-2069102 GTGGAGCAGATGGTCTCTGTTGG + Intergenic
1162064716 19:8118168-8118190 GTGTTTGAGTGGGTCTGTGTGGG - Intronic
1163238196 19:16042020-16042042 GTGGGTTAGATGTTCTCTGTTGG + Intergenic
1167414087 19:49361443-49361465 GTGGTTCTGTGGGTCTCTCCTGG - Exonic
1168352359 19:55683857-55683879 GTCGTTCACATGGTGTCTGTTGG + Intronic
926094608 2:10073104-10073126 GTGGTGCAGATGGGCTCTGGGGG + Intronic
927860772 2:26558703-26558725 TTGGTTGCCTTGGTCTCTGTGGG - Intergenic
931655612 2:64508802-64508824 CTGATTCAGTTGGTCTCGGGTGG - Intergenic
932924730 2:75959852-75959874 GTGGTCCTGTTGCTCTCAGTTGG + Intergenic
935282440 2:101529665-101529687 GTTGTTCCTTTGGTATCTGTGGG - Intergenic
935318430 2:101860962-101860984 GTGGCTCCGCTGGTCTCTGCAGG - Exonic
939986338 2:148833102-148833124 CTGGTTCAGTAGGTCTGGGTGGG + Intergenic
940065803 2:149627290-149627312 GTGCTTCAGTTTGTCTGTCTTGG + Intergenic
941578398 2:167265053-167265075 GTAGTTCTGCTGGTCTTTGTGGG + Intergenic
944521798 2:200577897-200577919 TTGGTTAAGGTGGTGTCTGTTGG + Intronic
948767676 2:240231929-240231951 GTGGTACTGTTGGTCTGTTTTGG - Intergenic
1169808799 20:9587661-9587683 GTGATTCAGTAGGTCTGGGTGGG + Intronic
1170459276 20:16561644-16561666 GTGGTTAAGGTGGTATCTGCAGG - Intronic
1170588370 20:17752608-17752630 GTGGTTGAGCTGGTCACTGCTGG + Intergenic
1171095318 20:22327269-22327291 TGGGTTCAGTTGGTCTGGGTGGG + Intergenic
1174262208 20:49304793-49304815 CTGGTTCAGTAGGTCTGTGGTGG + Intergenic
1174959163 20:55135524-55135546 GTGGTTCTGTTAGTTTCTCTTGG + Intergenic
1178497765 21:33101648-33101670 CTGGTTCTGTTGTTCTCAGTGGG - Intergenic
1179286581 21:39983055-39983077 CTGGCTCAGTTGGTGTATGTGGG - Intergenic
1179657997 21:42857319-42857341 GTGGGTCAGTCGGTCTCTTCTGG - Intronic
1180830485 22:18903527-18903549 GTGGTTCAGTTTGTTTCTTTAGG + Intergenic
1181069193 22:20321748-20321770 GTGGTTCAGTTTGTTTCTTTAGG - Intergenic
1181614169 22:24040878-24040900 GTGGGGCAGTTTCTCTCTGTTGG + Intronic
1203280574 22_KI270734v1_random:128798-128820 GTGGTTCAGTTTGTTTCTTTAGG + Intergenic
952836425 3:37606285-37606307 ATTTTTCAGTTGGTCTCTCTGGG - Intronic
954023301 3:47761210-47761232 GTGGATCAGTTGATCCCTGGAGG + Intronic
959568319 3:107855662-107855684 TCTGTTCAGTTGTTCTCTGTGGG + Intergenic
961575629 3:127833700-127833722 GTGGTTCTTTTGGTCTCTGCTGG - Intergenic
961661136 3:128469383-128469405 GTGGCTCATGTGGTCTCTGGAGG + Intergenic
964276916 3:155018604-155018626 GAGGTTGAGTGGGTCTCTGCAGG - Intergenic
964466351 3:156997481-156997503 CTGGTTCAGTAGGTCTGGGTAGG + Intronic
967304844 3:188050317-188050339 GGGGCTCACTTGGTGTCTGTGGG - Intergenic
970427354 4:15957923-15957945 CTGGTTCAGTTTGTCTGTGGTGG + Intergenic
971671271 4:29561045-29561067 GTGGTGCAGTTCGTGTCTGAAGG - Intergenic
972164361 4:36264586-36264608 GTTGTAGAGTTGGTCTCTGCAGG - Intergenic
973576452 4:52294545-52294567 CTGGTTCAGTGGGTCTCATTTGG + Intergenic
976017078 4:80569205-80569227 GTGTTTCATTTGTTTTCTGTTGG + Intronic
976319498 4:83696841-83696863 GTGGCTCAGTTGGTCTGTTTTGG - Intergenic
978275806 4:106948294-106948316 CTGATTCAGTAGGTCTGTGTGGG + Intronic
979341510 4:119529962-119529984 CTGATTCAGTAGGTCTGTGTTGG - Intronic
979490639 4:121323319-121323341 GTAGCTCACTTGGTCTCTTTAGG + Intergenic
980831179 4:138130929-138130951 ATGGTCCAGTTGGTATCTGATGG - Intergenic
981744663 4:148040669-148040691 GTGGTTCTGTTGGTTTCAGTTGG + Intronic
983641185 4:169945276-169945298 CTGATTCAGTTGGTCTGGGTTGG + Intergenic
984420396 4:179513943-179513965 GTGGTGCAGTGGATCTCTGGAGG - Intergenic
988217782 5:28298869-28298891 GTGATTCAGTTGCTCTCTGGTGG - Intergenic
990379995 5:55213630-55213652 GAGGTTTAGTTGGTCTCAATAGG - Intergenic
991650264 5:68845496-68845518 GTGGGTCATCTGCTCTCTGTTGG - Intergenic
994099255 5:95876533-95876555 CTGGTTCACTTGGTCTAGGTCGG + Intergenic
995611544 5:113915728-113915750 GTGGTTCAATTAGGCTGTGTTGG + Intergenic
996491591 5:124104590-124104612 GTGATTCAGTTGGTCTGAGGTGG - Intergenic
997883020 5:137607216-137607238 GTGGCTCGGTTGATCTCTGCTGG - Intergenic
1000718078 5:164671837-164671859 GTGGTTTAATTGGTCTGTGGTGG + Intergenic
1001156649 5:169278225-169278247 GTGGTACAGATGGTCGCTGGAGG - Intronic
1002309067 5:178303638-178303660 GTGCCTCCGTTTGTCTCTGTAGG + Intronic
1002675881 5:180912142-180912164 GTGGTTCAGTTTGAGTCTGAAGG - Intronic
1004313471 6:14565897-14565919 GTGGTTCAGTGAGTCCCTTTGGG - Intergenic
1004685127 6:17936013-17936035 GTGTTTGAGTTGGTCAGTGTGGG - Intronic
1005182838 6:23125992-23126014 GGGGTTCAGTAGGTCTATTTTGG + Intergenic
1005616279 6:27576244-27576266 GTGATTTAGTTAGTCTCTGGAGG - Intergenic
1005897363 6:30189673-30189695 CTGGTTCAGCTGGTGTCTTTGGG - Intronic
1006256635 6:32837885-32837907 GGGGCTCAGCTGGTCACTGTGGG - Exonic
1007524852 6:42482948-42482970 CTGGTCCAGTTGGTCGCTGATGG + Intergenic
1011369123 6:86613490-86613512 CTGCTTCAGTTGGTCTTGGTTGG + Intergenic
1012796785 6:103772115-103772137 GTGGTTCAGATGGGATTTGTAGG - Intergenic
1013276207 6:108587164-108587186 CTGGTTCAGTTGGTATTTGGTGG + Intronic
1014685998 6:124501171-124501193 GAGGTGCAGTGGTTCTCTGTGGG - Intronic
1014814785 6:125923384-125923406 GTGTTACAGTTGGTCTTTCTTGG + Intronic
1017875126 6:158517784-158517806 GCGGCACACTTGGTCTCTGTGGG + Intergenic
1019554236 7:1620695-1620717 GTGGTTCATCTGGAATCTGTTGG + Intergenic
1020551411 7:9610591-9610613 GTGGTTCAGTTGGTTAAAGTAGG + Intergenic
1021021297 7:15600921-15600943 TTGGTTCAGTTGGTCTGGGGTGG + Intergenic
1021083047 7:16386120-16386142 GTGGTGGAGGTGGTCTCGGTAGG + Intronic
1021502883 7:21349497-21349519 TTGGTTAAGTTGGTGTCTGCTGG - Intergenic
1021505745 7:21382956-21382978 ATGCTTCAGTGGGTCACTGTTGG - Intergenic
1021874939 7:25039766-25039788 TTAGTTCAGATGGTGTCTGTTGG + Intergenic
1022120370 7:27302484-27302506 GTGGACCATATGGTCTCTGTTGG + Intergenic
1023420903 7:39978707-39978729 GTGGTTCAGTAGGTCTGGGCTGG + Intronic
1023954696 7:44874983-44875005 TTGATTCAGTTGGTCTATGGTGG + Intergenic
1023984390 7:45086463-45086485 GTGGTTCAGCTGGGCTCGGTGGG + Intronic
1024010369 7:45261230-45261252 GTGGTGGAGGTGGGCTCTGTGGG + Intergenic
1024158104 7:46647066-46647088 GTGGTTCACCTGATCTCTTTGGG - Intergenic
1027720400 7:81734598-81734620 CTTGTTCTCTTGGTCTCTGTTGG - Intronic
1030127214 7:106165615-106165637 GCAGTTCTGCTGGTCTCTGTTGG - Intergenic
1030984394 7:116224056-116224078 GTGGTTCTCTTGCTCTCTCTGGG + Intronic
1031993542 7:128213182-128213204 CTGGTTCAGTAGGTCTGGGTAGG - Intergenic
1033325749 7:140376861-140376883 GAGGATCATTTGGTCTCTGGAGG - Intronic
1033511863 7:142067296-142067318 GGGGCTCTGTTGGGCTCTGTTGG + Intronic
1033514935 7:142096286-142096308 GGGGCTCTGTTGGGCTCTGTTGG + Intronic
1034337566 7:150333344-150333366 GTGGTTCTGTTGGTGTCTAGTGG + Intronic
1034685923 7:152971398-152971420 GTGGTTCAGTGGGTCTGTGCTGG + Intergenic
1037267204 8:17076768-17076790 GTGGTTCAGTAGGTCTGGGATGG + Intronic
1038678170 8:29642519-29642541 TTAGTTCAGCTGGTCTCTGTGGG - Intergenic
1039126966 8:34214698-34214720 GTGGGCCATTTGGTCTCTGTTGG - Intergenic
1042047527 8:64670669-64670691 TTGGTTCAGTTTGTCTCTGCAGG - Intronic
1046630594 8:116619260-116619282 GTGGTTCTGCTGGACTCTGCTGG - Intergenic
1048527377 8:135215354-135215376 CTGGCTCAGTGGGTCTGTGTGGG + Intergenic
1050733371 9:8735082-8735104 GTGGGTCAGTAGGTCTGTGGTGG + Intronic
1051763407 9:20495313-20495335 GTGATTCAGTAGGTCGCAGTGGG - Intronic
1051989028 9:23128911-23128933 GAGGATCAGATGGTTTCTGTAGG + Intergenic
1055045977 9:71924139-71924161 GTGATTAATTTGGTCCCTGTAGG + Intronic
1055051706 9:71988001-71988023 GGGGTTCAGTTAGTCACGGTTGG + Intergenic
1057667962 9:97061358-97061380 GGGGTTCAGTTAGCCTCTGGTGG - Intergenic
1058957950 9:109966808-109966830 CTGGTTCAGTAGGTCTCAGGCGG + Intronic
1059720454 9:116954877-116954899 CTGGTTCAGTAGGTCTGGGTTGG - Intronic
1062673908 9:137728788-137728810 GTGACTCACTTGGTCTATGTGGG + Intronic
1187599558 X:20812844-20812866 TTGGTTAAGGTGGTTTCTGTTGG + Intergenic
1188592294 X:31852539-31852561 ATGGGCCATTTGGTCTCTGTTGG - Intronic
1188685423 X:33063751-33063773 GTGATTCAGTTGGTCTGGGGTGG - Intronic
1193320577 X:80116403-80116425 TTGATTCAGTTGGTCTCTGATGG + Intergenic
1194592602 X:95817570-95817592 CTGATTCAGTTGGTATGTGTTGG - Intergenic
1195341318 X:103909194-103909216 GTTGTTCAGATCGTTTCTGTAGG - Intergenic
1195708144 X:107752949-107752971 GTGAATTTGTTGGTCTCTGTGGG + Intronic
1196026258 X:111044407-111044429 TTTGTTCATTTGGTCTTTGTAGG + Intronic
1197729668 X:129798918-129798940 ATGGTTCAGTTGGGCTGTGCTGG - Intergenic
1198080693 X:133236490-133236512 GTGATTCAATTGGTCTGTGGCGG + Intergenic
1198206826 X:134473650-134473672 GTGGTATAGTGGGACTCTGTAGG + Intronic
1200154108 X:153966243-153966265 GTGGTACAGTTGTGCTGTGTGGG - Intronic