ID: 1157560563

View in Genome Browser
Species Human (GRCh38)
Location 18:48642680-48642702
Sequence TAGGCTATCCTGACTGATAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 3, 2: 3, 3: 26, 4: 106}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157560563 Original CRISPR TAGGCTATCCTGACTGATAC AGG (reversed) Intronic
907049123 1:51317914-51317936 TTGGCGATCCTGAGTGCTACAGG + Intronic
908096800 1:60747737-60747759 TAGGTTATCCTTAATGATCCAGG - Intergenic
908497382 1:64708184-64708206 TGGACAATCCTGACTAATACAGG + Intergenic
909769800 1:79407269-79407291 TAGGAAATCCTGACTGATATAGG - Intergenic
910938064 1:92503303-92503325 CAGCCTATCCTGACTAATGCAGG + Intergenic
912149560 1:106840815-106840837 TAGCTTACCCTGACTGAAACTGG - Intergenic
920276975 1:204813723-204813745 TAGAATATCCTGCCTGATAAGGG + Intergenic
922952933 1:229574310-229574332 AAGGATATCCTGTCTGTTACTGG - Intergenic
923125682 1:231032772-231032794 TAGGCTCTCCTGGCTGGGACAGG + Intronic
1064264718 10:13816475-13816497 TAGCCTATCCTGATTGATTCAGG + Intronic
1066076664 10:31885395-31885417 GAGGCTATTCTGACTGATGGAGG - Intronic
1067223987 10:44363578-44363600 TAGGCTACCCTGGCTGCTGCTGG - Intergenic
1077260241 11:1614438-1614460 CAGGCCATCCTGACTGACACTGG - Intergenic
1078165459 11:8879417-8879439 TAGCTCCTCCTGACTGATACAGG + Intronic
1084237997 11:67800549-67800571 TGCTCTTTCCTGACTGATACAGG - Intergenic
1091503334 12:1040739-1040761 TAGGCTTTCCTTCCTAATACTGG + Intronic
1092782974 12:12004317-12004339 TAGTTTATCCTGACCAATACAGG - Intergenic
1094140379 12:27174679-27174701 TAGCCTATCCTCACTGATACAGG - Intergenic
1099339894 12:81416651-81416673 GAGGCTATCTTGATTCATACTGG + Intronic
1101267234 12:103101869-103101891 TAGGTCATCCTGACTTATTCTGG - Intergenic
1101271275 12:103147875-103147897 TAGGCTATCTTGACTGCTGCTGG - Intergenic
1101657504 12:106736089-106736111 TAGCCTACCCTAACTAATACAGG - Intronic
1104043906 12:125148146-125148168 TAGGGAACCCTGACTAATACAGG + Intergenic
1104532639 12:129586790-129586812 TAGCCTATCTTGACTAATGCAGG + Intronic
1107355170 13:39558761-39558783 TAGGGTATCCTGCCTGGTGCTGG - Intronic
1107666556 13:42696831-42696853 TTGCCTATCCTGACTGATGCAGG + Intergenic
1108558152 13:51616438-51616460 TAGCCTATCCTGACTGATGCAGG - Intronic
1111799746 13:92966963-92966985 TAGCATATCCTGACTAATAGAGG - Intergenic
1112125335 13:96460236-96460258 TAGACTTTCCTGTCTGATTCTGG - Intronic
1112866194 13:103902201-103902223 TAGGCAATACTTACTGAAACAGG + Intergenic
1114976188 14:28103044-28103066 TAGCCTATCTTGGCTGCTACAGG - Intergenic
1115131050 14:30052155-30052177 TAGAGAATCCTGACTAATACAGG + Intronic
1116291831 14:43053263-43053285 TAGACAACCCTGACTAATACAGG - Intergenic
1117436903 14:55724196-55724218 TAGGCTATGCTGACTGATACAGG - Intergenic
1120499040 14:85271152-85271174 TAGTTTAAACTGACTGATACAGG - Intergenic
1124351428 15:28958381-28958403 TAGCCTGTCCTCACTGATCCAGG + Intronic
1124628285 15:31322714-31322736 CAGCCTCTCCTGACTGATACAGG + Intergenic
1128864484 15:71103920-71103942 TAGTCTAGGCTGGCTGATACTGG + Intronic
1129888386 15:79054769-79054791 TAGCCTATTCTGACAGATACAGG + Intronic
1131840403 15:96430597-96430619 TTGGCTATGATGACTGGTACAGG + Intergenic
1131939561 15:97545981-97546003 TAGGCAATCATGACAGATAAGGG + Intergenic
1133716288 16:8452458-8452480 TAGTTTATCCTAACTCATACAGG + Intergenic
1138154817 16:54693376-54693398 TAGCTTATCCTGACTGATACTGG + Intergenic
1143845659 17:9771342-9771364 CAGGCTATCCTCACTGTCACGGG + Intergenic
1143996051 17:11007403-11007425 TAACCTATTCTGACTGATACAGG + Intergenic
1147455493 17:40535608-40535630 TAGCATATCCTGACCAATACAGG - Intergenic
1150164642 17:62929969-62929991 TAGTCCATCTTGACTGATATAGG + Intergenic
1150470109 17:65430110-65430132 TAGCCTATTCTAACTGATACAGG + Intergenic
1150617204 17:66781525-66781547 CAGCCTATCCTTACTGATACCGG + Intronic
1150936254 17:69638847-69638869 CAGACAATCCTGACTAATACAGG - Intergenic
1151566174 17:74899753-74899775 GTGTTTATCCTGACTGATACAGG - Intergenic
1156738674 18:40296920-40296942 GAGGCTATGCTGACTTATGCAGG + Intergenic
1157560563 18:48642680-48642702 TAGGCTATCCTGACTGATACAGG - Intronic
1157587160 18:48810199-48810221 GTGGCTATCCCGACTGATATGGG - Intronic
1159709190 18:71733334-71733356 AATGCTATCCTTACTGTTACAGG - Intronic
1167677385 19:50895786-50895808 TAGAGAATCCTGACTAATACAGG + Intergenic
927468144 2:23351972-23351994 AGGGCTTTCCTGACTGTTACCGG - Intergenic
927889214 2:26738069-26738091 GAGGCTGTCCTGAGTGATAAGGG - Intergenic
929399533 2:41563938-41563960 CAGGGTATGTTGACTGATACAGG - Intergenic
929857078 2:45646501-45646523 TAGCCAATCCTGACTAATAAAGG + Intergenic
929954249 2:46443381-46443403 TAGACTATCCAGACTAATACTGG + Intronic
930655151 2:54000503-54000525 CAGCCTATCCTGACTGACACAGG - Intronic
938989706 2:136615322-136615344 TAGTTTATACTAACTGATACAGG - Intergenic
939523851 2:143266872-143266894 TAGCCTATTTTGGCTGATACAGG - Intronic
942455850 2:176137498-176137520 TAGGCTTTAGTGACTGATGCTGG + Intergenic
943662449 2:190573697-190573719 TAGCCTACCCTGACTGCTGCAGG + Intergenic
945682044 2:212926118-212926140 TAGCCTGTCCTAACTGAAACAGG - Intergenic
945744449 2:213703256-213703278 TAGACTGTCTTGACTGATACAGG + Intronic
946614486 2:221495029-221495051 TTGCCTCTCTTGACTGATACAGG + Intronic
1169296518 20:4404680-4404702 AAGCCCATCCTGAATGATACAGG + Intergenic
1170334392 20:15252297-15252319 TAGGCTATCCTGACTGGTACAGG - Intronic
1173155737 20:40607027-40607049 TAGATTATCCTGGCTTATACAGG - Intergenic
1174092757 20:48062546-48062568 CAGTCTTTCCTGACTGATATGGG - Intergenic
1175433683 20:58927369-58927391 TACTCTATCCTGACTGACGCAGG - Intergenic
1177406161 21:20671183-20671205 TAGGATATTTTGACTGATAATGG - Intergenic
1181858846 22:25802547-25802569 GAGACCATCCTGGCTGATACAGG + Intronic
949368465 3:3308604-3308626 TAGCCTATACTGACTGGTACTGG + Intergenic
949678216 3:6482394-6482416 TAGGGAATCCTGACTAATACAGG - Intergenic
950171739 3:10843545-10843567 CAACCTATCCTGACTGCTACAGG - Intronic
950643879 3:14365696-14365718 TAAGCTTTCCTGACTGATTCGGG - Intergenic
952011604 3:28906231-28906253 TATCCTATCCTGACTAATACGGG + Intergenic
954908327 3:54082083-54082105 TAGGCAATCATGGATGATACTGG + Intergenic
958508394 3:95012760-95012782 TAGCCTATTCTGATTGAAACAGG - Intergenic
962031434 3:131604803-131604825 TAGAGAATCCTGACTAATACAGG + Intronic
962909402 3:139834403-139834425 TAGCCTATCCTGATTGAAAGAGG + Intergenic
963794256 3:149615996-149616018 GAGGCCATCCTGACTGAAAGAGG + Intronic
970876907 4:20882106-20882128 TAGAGAATCTTGACTGATACAGG + Intronic
972291793 4:37696565-37696587 TAGGCTATACTGACTGCCAAAGG + Intergenic
974153077 4:58035367-58035389 GAAACTATCCTGCCTGATACCGG + Intergenic
974356356 4:60817786-60817808 TAGTTTATCTTGATTGATACTGG - Intergenic
979538039 4:121846638-121846660 TAGGATATCCTGAATGAATCTGG + Intronic
981664349 4:147206141-147206163 TAGCCCAACCTGACTAATACTGG + Intergenic
983014333 4:162592628-162592650 TAGGGAACCCTGACTGATATAGG - Intergenic
983403660 4:167297749-167297771 TATGCCATCCTGACTTATACGGG + Intergenic
983806082 4:171994149-171994171 TAGACCATCTTGATTGATACTGG - Intronic
990241065 5:53817142-53817164 AAGGACATCCTGAATGATACAGG + Intergenic
990469218 5:56098277-56098299 TAGCCTACCCTGACTGATGCAGG + Intergenic
990487905 5:56277338-56277360 TGGGAAATCCTGACTGATCCAGG + Intergenic
992195035 5:74330645-74330667 TAGAGAACCCTGACTGATACAGG - Intergenic
994668377 5:102735270-102735292 TAGGTTAACCTCACTGATTCTGG + Intergenic
995954858 5:117765027-117765049 TAGGCCATTCTGAATGAGACAGG + Intergenic
999757302 5:154674236-154674258 CAGCCCATCCTGACTGATACAGG + Intergenic
1001101494 5:168818190-168818212 TTTGCTATTCTGACTGATTCAGG + Intronic
1001967024 5:175917494-175917516 TGGTCTATCCTGACTAATACTGG - Intergenic
1002249911 5:177921718-177921740 TGGTCTATCCTGACTAATACTGG + Intergenic
1010325982 6:74562285-74562307 TAGAAAATCCTGACTAATACAGG + Intergenic
1012343978 6:98164500-98164522 TAAGCTATCCTCAATTATACAGG + Intergenic
1012366413 6:98446034-98446056 TAGGGAACCCTGACTAATACAGG + Intergenic
1013914549 6:115319847-115319869 TAGCCTATCTTGATTGATACAGG - Intergenic
1014940969 6:127437956-127437978 TAGGCTTTCCAGACAGATCCAGG - Intergenic
1020321024 7:6939035-6939057 TGCTCTTTCCTGACTGATACAGG - Intergenic
1022239254 7:28493344-28493366 TAGCCTATCCTGCCTCAGACTGG - Intronic
1023287473 7:38633811-38633833 TAGAGAACCCTGACTGATACAGG + Intergenic
1030549765 7:110943743-110943765 TAGTCTAAGCTGACTGACACGGG + Intronic
1030697150 7:112598250-112598272 TTGGCTATTGTGAATGATACTGG + Intergenic
1032303462 7:130710813-130710835 TAGGCTAGCCTGAAAGATATTGG - Intergenic
1032990748 7:137392511-137392533 TCGGCTATCCCAACAGATACTGG + Intronic
1034636533 7:152571752-152571774 GAGACCATCCTGGCTGATACGGG + Intergenic
1035554693 8:557762-557784 TAGAGAATCCTGACTAATACAGG + Intergenic
1037548966 8:19951242-19951264 TAGGGGATCCTGGCTGAAACAGG + Intronic
1038657320 8:29465692-29465714 CAGACTATACAGACTGATACTGG - Intergenic
1043487176 8:80709738-80709760 CAGGCTATCCTACCTGACACAGG - Intronic
1045192997 8:99901495-99901517 TAGCTCATCCTGACTGGTACAGG + Intergenic
1048645188 8:136411987-136412009 TTAAATATCCTGACTGATACAGG - Intergenic
1048963981 8:139601906-139601928 CAGCCTATCCTGACTGCTCCAGG - Intronic
1051577794 9:18637023-18637045 TAGGCTATCTTGACTTTTATGGG - Intronic
1052725240 9:32221275-32221297 TAGGGAACCCTGACTAATACAGG - Intergenic
1052993082 9:34533463-34533485 TAGCCAATCCTGATTGATATAGG - Intergenic
1054803413 9:69375595-69375617 TAGCCCATCCTGACTGATAGAGG + Intronic
1060541884 9:124436586-124436608 TAGCATGTCCTGACTGATACAGG + Intergenic
1060578207 9:124718226-124718248 TGGGCTATCCTGACAGTTGCAGG - Intronic
1061569956 9:131471011-131471033 CACGCTATCCTGGGTGATACAGG - Intronic
1062135946 9:134928549-134928571 TAGGGAACCCTGACTAATACAGG + Intergenic
1185958449 X:4518899-4518921 TAGAGAATCCTGACTAATACAGG - Intergenic
1187428243 X:19197895-19197917 TAGCCCATCCTGATTAATACAGG - Intergenic
1196292348 X:113957867-113957889 TAGACTATCCTGACTGATACTGG - Intergenic
1197271658 X:124430993-124431015 TAGTCTATCCTGACTGAAGCTGG - Intronic
1199573358 X:149289843-149289865 TAGGCTAGCCTGCCTGCAACTGG + Intergenic
1201304022 Y:12535336-12535358 TAAGCTAGACTGACTGAAACTGG - Intergenic