ID: 1157564675

View in Genome Browser
Species Human (GRCh38)
Location 18:48671949-48671971
Sequence TTATCTCTCGAAGGTCATTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 128}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157564673_1157564675 14 Left 1157564673 18:48671912-48671934 CCATTCAGTATATTTTTCATTTC 0: 1
1: 6
2: 60
3: 232
4: 1200
Right 1157564675 18:48671949-48671971 TTATCTCTCGAAGGTCATTGTGG 0: 1
1: 0
2: 0
3: 7
4: 128
1157564672_1157564675 15 Left 1157564672 18:48671911-48671933 CCCATTCAGTATATTTTTCATTT 0: 2
1: 9
2: 45
3: 204
4: 1319
Right 1157564675 18:48671949-48671971 TTATCTCTCGAAGGTCATTGTGG 0: 1
1: 0
2: 0
3: 7
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157564675 Original CRISPR TTATCTCTCGAAGGTCATTG TGG Intronic
901594842 1:10376605-10376627 TTATCTCTCGAAGGCGAGTGAGG - Exonic
903993781 1:27292215-27292237 TGTTCTCTCGAAGGTCATACTGG - Exonic
907865167 1:58392281-58392303 TTACATCTTGAAGGTCACTGTGG - Intronic
908670096 1:66536625-66536647 TTATCTTTCCAAGGTTATTGTGG - Intronic
909214343 1:72867142-72867164 TTATGTTTCCAAGGTCATTAAGG + Intergenic
911137489 1:94456641-94456663 TGATCTCTCGATGGACATTTAGG + Intronic
912898750 1:113624100-113624122 TTATCTGTCGATGGACATTTAGG + Intronic
913418318 1:118636354-118636376 TTATCTCACAGAGGTCCTTGGGG - Intergenic
913541305 1:119823183-119823205 TTATCTCATGGAGGTCCTTGGGG + Intergenic
914957365 1:152174921-152174943 TTATTTGTCCAAGGTCATAGAGG + Intergenic
916566462 1:165983063-165983085 TTGTCTCACAAAGGTCCTTGGGG - Intergenic
917886139 1:179386974-179386996 TCATCTCTAGAAGGTCAGTTTGG + Intronic
922882563 1:228991967-228991989 TTTTCTCTCCAAAGTCATTTTGG - Intergenic
923374624 1:233348378-233348400 TTATCTCTGGATGGACATTTGGG + Intronic
1065609271 10:27455307-27455329 TTATCTCTCTTAGGTCACAGGGG - Intergenic
1069447526 10:68487018-68487040 TTATCTCCCGAAGTTTATTTTGG - Intronic
1071112688 10:82178611-82178633 TTACCTATCAAAGGTCATTTAGG + Intronic
1072123422 10:92424615-92424637 TTATCCATTGAAGGTCATTTGGG + Intergenic
1073658073 10:105439131-105439153 TTATTTCTCCAACATCATTGGGG + Intergenic
1075996017 10:126876882-126876904 TTAGCTCTCAGAGGCCATTGTGG + Intergenic
1078126746 11:8572913-8572935 TACTCTCTCACAGGTCATTGAGG - Intronic
1079398000 11:20082579-20082601 TTTTCTCTGGCAGGTCAATGAGG + Exonic
1079515320 11:21260704-21260726 TTATGTCTTGAGGGTTATTGAGG + Intronic
1079633823 11:22711358-22711380 TTATCTCACAGAGGTCCTTGGGG + Intronic
1082583023 11:54897059-54897081 TTATATCTGGGAGCTCATTGAGG + Intergenic
1085859905 11:80220921-80220943 TTATCTGTCGATGGACATTTAGG - Intergenic
1086743056 11:90391697-90391719 TTATCTCTCAGGGGTCTTTGAGG + Intergenic
1090055351 11:123418719-123418741 TTCTCTCCAGAAGGGCATTGTGG + Intergenic
1090789979 11:130083722-130083744 TCATCTCTCGATGGACATTTAGG + Intronic
1093277519 12:17148387-17148409 TTGTCTCTCAGAGGTCTTTGGGG + Intergenic
1098974994 12:76893226-76893248 TTATCTCTAGAAGTTCAATTTGG - Intergenic
1100706238 12:97203392-97203414 TTGTCTCTCAGAGGTCCTTGGGG + Intergenic
1108384992 13:49891159-49891181 AAATCTCTTGAAGGTCATTTTGG - Intergenic
1109126912 13:58529183-58529205 AAATCTCTTGAAGGTCATTTTGG - Intergenic
1112106269 13:96242930-96242952 TTATCTGTGGATGGTCATTCAGG - Intronic
1113240179 13:108328494-108328516 TTTTCTCTCAGAGGTCTTTGGGG + Intergenic
1113772218 13:112917512-112917534 TGACCTCTCGAAGGTGAGTGCGG + Intronic
1114789471 14:25640552-25640574 ATACCTCTCTAAGTTCATTGTGG - Intergenic
1115665906 14:35546086-35546108 TTTTATCCCTAAGGTCATTGAGG - Intronic
1116025405 14:39508430-39508452 TTATCTCACAAGGGTCCTTGAGG + Intergenic
1117615235 14:57527820-57527842 TTGTCTCACAAAGGTCCTTGGGG - Intergenic
1119816605 14:77574590-77574612 TTATCACTTGATGGTCATTTGGG - Intronic
1127049225 15:55063396-55063418 TTATCTCTAGAAGTTCATTTTGG - Intergenic
1128961124 15:72005967-72005989 TTATCTGTTGAAGGACATTTTGG - Intronic
1129562302 15:76584016-76584038 TTATCTCTTGATGGACATTTAGG - Intronic
1131869403 15:96745912-96745934 GTATCCCTTGAAGCTCATTGAGG - Intergenic
1133119203 16:3595984-3596006 TTTTTTCTCAAAGGTCAATGTGG - Intronic
1139479756 16:67223822-67223844 TTACCTCCCGAAGGGCATTCTGG + Intronic
1142521007 17:504463-504485 CCTTCTCTCGAAGGTCACTGAGG - Intergenic
1145201782 17:20951833-20951855 TTTTCTCTGGAAGGGAATTGGGG + Intergenic
1145936155 17:28716033-28716055 TAAGATCTCCAAGGTCATTGTGG - Exonic
1147391544 17:40112376-40112398 TTCTCCCTCCAAGGTCATAGGGG - Intergenic
1155081730 18:22417311-22417333 AAATCTCTTGAAGGTCATTTTGG + Exonic
1156020808 18:32597610-32597632 TTATCTCACAGAGGTCCTTGGGG + Intergenic
1156363712 18:36406669-36406691 TTATATTTGGAAGGTTATTGCGG + Intronic
1156726621 18:40136369-40136391 GTATCTCTCCAAGGTCTTTATGG + Intergenic
1157564675 18:48671949-48671971 TTATCTCTCGAAGGTCATTGTGG + Intronic
1163289669 19:16371024-16371046 TTATCTCTCTGAGATCATCGTGG + Intronic
1166096836 19:40544969-40544991 TTCTCTCTTGATGGGCATTGAGG + Intronic
929909557 2:46077807-46077829 GTATTTCTAGAAGGTCAGTGTGG - Intronic
933121701 2:78546415-78546437 TCATCTCTCAAAGGACATTTAGG - Intergenic
937357390 2:121206686-121206708 TTATGTCTTAAATGTCATTGTGG + Intergenic
937584295 2:123527123-123527145 ATATCTCTCTAGGCTCATTGTGG + Intergenic
939391798 2:141577687-141577709 TTACCTCTCGCAGATCATAGGGG + Intronic
939519129 2:143207319-143207341 TTACTTTTCCAAGGTCATTGGGG - Intronic
939945344 2:148403081-148403103 TTATCTCTAGAAGTTCAATTTGG + Intronic
941912556 2:170778827-170778849 TTATCACTCAAAGAACATTGGGG - Intergenic
942556527 2:177177815-177177837 CTACCTCTCGAGGCTCATTGCGG + Intergenic
943236564 2:185328521-185328543 TTATCTGTTGATGGTCATTTGGG + Intergenic
945320532 2:208417225-208417247 TTATCTCTCGAAATGCATTAAGG + Intronic
948143045 2:235688398-235688420 TTCTCTCTGGAAGGTCATGACGG + Intronic
948350441 2:237335890-237335912 TTCTCTCTGGAATGTCAGTGGGG - Intronic
1181944653 22:26506720-26506742 ATATCCTTCAAAGGTCATTGTGG - Intronic
951602687 3:24394018-24394040 ATATCTATTGAAGATCATTGTGG - Intronic
951905810 3:27706271-27706293 TTATCTCTAGAAGTTCAATTTGG + Intergenic
952986419 3:38788960-38788982 TTTTCTCTGGAAGGTCAGTTCGG + Exonic
955378593 3:58418577-58418599 TTATTTGTCCAAGGTCATAGCGG - Intronic
957923795 3:86781231-86781253 TTATCTCTGGAAGATCATCCAGG - Intergenic
963622909 3:147634787-147634809 TTATCTCACAGAGGTCCTTGAGG + Intergenic
964990202 3:162801413-162801435 TTATTACTCTTAGGTCATTGAGG + Intergenic
965707563 3:171524487-171524509 TTAGATTTCAAAGGTCATTGTGG - Intergenic
967827486 3:193889629-193889651 TTATCTGTCAATAGTCATTGGGG + Intergenic
969482999 4:7456792-7456814 TCATCTCTCGACGATCAGTGTGG + Intronic
970859043 4:20681224-20681246 TTACATTTTGAAGGTCATTGTGG - Intergenic
971651700 4:29284196-29284218 TTATTTCTAGAAGTTCATTTTGG + Intergenic
972678563 4:41283992-41284014 TTATCTCTTCAAGATTATTGAGG - Intergenic
977997594 4:103514171-103514193 TCATCTCTAGAAGGTCAGTTTGG + Intergenic
979656746 4:123203641-123203663 TTATCTGTCTAAGGACATTTAGG + Intronic
980042476 4:127955227-127955249 TTATCTGTCGATGGACATTTGGG - Intronic
981250033 4:142589870-142589892 TTTTCTATCAAAGGTCATTTTGG - Intronic
981955325 4:150465296-150465318 TTATCTGTCGATGGACATTTGGG + Intronic
982960390 4:161828062-161828084 TTATCTCACAGAGGTCCTTGGGG - Intronic
984530792 4:180913816-180913838 TTATCTCTCTGAGGCCTTTGGGG + Intergenic
985884589 5:2667505-2667527 TTATCTTTCGAATTTCATTATGG - Intergenic
987878708 5:23712761-23712783 TTACTTCTGGAAGGTCAGTGTGG - Intergenic
993613621 5:90084249-90084271 TTATCTCACAGAGGTCCTTGGGG + Intergenic
996668069 5:126083918-126083940 TTATCTCACAGAGGTCCTTGGGG + Intergenic
998447306 5:142208271-142208293 TTACCTCTTGAAGGACATTTTGG + Intergenic
998683887 5:144502408-144502430 GGATCTCTGGAAGGTCATGGAGG + Intergenic
1000583626 5:163065846-163065868 TTTTTTCTCGCAGTTCATTGGGG - Intergenic
1001847087 5:174931782-174931804 AAAGCTCTAGAAGGTCATTGTGG - Intergenic
1004656187 6:17664013-17664035 TAATCACTTGAAGGACATTGGGG - Intronic
1007333309 6:41131854-41131876 TTACCTCTTTTAGGTCATTGAGG - Intergenic
1010358666 6:74966103-74966125 TTATCTCACAGAGGTCCTTGGGG - Intergenic
1012222383 6:96664625-96664647 TTATCTGTTGATGGTCATTTGGG + Intergenic
1013393928 6:109714544-109714566 TTATCTATAAAAGGTCATTTGGG + Intronic
1021232292 7:18100588-18100610 TCATCTCTTGAAGTTCAATGGGG + Intronic
1023746921 7:43330445-43330467 TTATCTCTCAAAGTTCTGTGAGG - Intronic
1025242590 7:57290217-57290239 TTATATATCAAAGGTCAGTGTGG - Intergenic
1026167974 7:67927924-67927946 TTATATATCAAAGGTCAGTGTGG - Intergenic
1031321067 7:120328913-120328935 TTATCTCTCTAAAGTCATTTGGG + Intronic
1033831946 7:145265604-145265626 TCATCTGTCCATGGTCATTGGGG + Intergenic
1037268299 8:17094011-17094033 TTATCTTTTGAAGGACATTGAGG - Intronic
1041930923 8:63285370-63285392 TCATCTGTTGATGGTCATTGAGG + Intergenic
1045703747 8:104896727-104896749 TTATCTCTGGATGCTCTTTGTGG + Intronic
1047232999 8:123013253-123013275 TTATCTCTTGAAGAGCATTTAGG - Exonic
1047937587 8:129797693-129797715 TTATCTCACAAGGGTCCTTGGGG - Intergenic
1048401726 8:134077507-134077529 TTTTCTCTGGAAGGTCTTGGAGG + Intergenic
1049281649 8:141752647-141752669 TTATCTCTGGAAGGGGATGGAGG + Intergenic
1050296465 9:4210190-4210212 TTTTCTCAAGAAGGTCTTTGGGG - Intronic
1051263037 9:15284467-15284489 TTATCTATTGAAGATCATTTGGG - Intronic
1051273115 9:15374389-15374411 TTATCTCACAGAGGTCTTTGGGG + Intergenic
1051503938 9:17807555-17807577 TTATCTTTGGAAGGTCCTTGGGG + Intergenic
1051683222 9:19629533-19629555 CTGTCTCTTGAAGGTCATAGGGG + Intronic
1051909055 9:22132003-22132025 TTATATCTAGAAAGTCTTTGGGG + Intergenic
1055244182 9:74220321-74220343 TTATCTCTCACAGGTTCTTGGGG + Intergenic
1059166758 9:112084242-112084264 TTATCTATAGAAGGTTATTTGGG - Intronic
1185781332 X:2849753-2849775 TTATCCCTCAAAGATCTTTGAGG + Intronic
1187539443 X:20177427-20177449 TTATCTGTTGAAGGACATTTGGG + Intronic
1188784205 X:34324221-34324243 TTATCCCTCGATGGGCATTTAGG - Intergenic
1192289607 X:69779857-69779879 TTTTGTCTCTAATGTCATTGTGG + Intronic
1192941277 X:75914031-75914053 TTATCTCTAGAAGTTCAGTATGG + Intergenic
1194589457 X:95780585-95780607 TTATCTCTCGAAAGTTAGTTTGG - Intergenic
1194804189 X:98307054-98307076 TTATCTCTCCAAGGTCAAAGAGG + Intergenic
1197250036 X:124206144-124206166 TTATCTGTTGATGGTCATTTAGG + Intronic
1198510435 X:137345220-137345242 TTATTTTTCAAAGGTCTTTGTGG - Intergenic