ID: 1157566041

View in Genome Browser
Species Human (GRCh38)
Location 18:48679965-48679987
Sequence CTGTATGTAGGGAGAGCAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 4, 3: 15, 4: 187}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157566038_1157566041 -8 Left 1157566038 18:48679950-48679972 CCTCGAGAGGGGAGACTGTATGT 0: 1
1: 0
2: 0
3: 2
4: 76
Right 1157566041 18:48679965-48679987 CTGTATGTAGGGAGAGCAGTTGG 0: 1
1: 0
2: 4
3: 15
4: 187
1157566037_1157566041 0 Left 1157566037 18:48679942-48679964 CCAGGAGTCCTCGAGAGGGGAGA 0: 1
1: 0
2: 0
3: 11
4: 142
Right 1157566041 18:48679965-48679987 CTGTATGTAGGGAGAGCAGTTGG 0: 1
1: 0
2: 4
3: 15
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157566041 Original CRISPR CTGTATGTAGGGAGAGCAGT TGG Intronic
900338546 1:2176839-2176861 CTGTATGTAGGAAGGGGTGTGGG - Intronic
903779590 1:25812806-25812828 CTGGATCTAAGGGGAGCAGTGGG + Intronic
904079242 1:27861730-27861752 CTGCATTTAGGAAGAGCAGAGGG + Intergenic
904295340 1:29516643-29516665 CTGTGTGTTGGGAGTGAAGTGGG + Intergenic
906276531 1:44520638-44520660 CTGTCTGGGGGAAGAGCAGTAGG - Intronic
906593480 1:47050590-47050612 CTGTTTTTAGGAAAAGCAGTAGG - Exonic
907053099 1:51342963-51342985 CAGTGTGCAGGGAGAGCAGAGGG - Intronic
909607358 1:77520574-77520596 CTGTATGAAGGGAGAGCATCAGG - Intronic
911320792 1:96411194-96411216 CTGTCAATAGGGAGGGCAGTTGG - Intergenic
913528966 1:119719684-119719706 GTAAATGTAAGGAGAGCAGTGGG - Intronic
915129231 1:153685783-153685805 CTGAAAGGAGGGAGAGCAGGAGG - Intronic
916772276 1:167922511-167922533 GTGTAGGTAGGGAGAGAAGAAGG + Intronic
918349760 1:183642736-183642758 TTGTATTTAGAGAGACCAGTAGG + Intronic
919762747 1:201108512-201108534 CTGAATGCAGGGAGAGCTCTAGG - Intronic
919933636 1:202237222-202237244 CTGGATGGAGGGAGAGGAGAGGG - Intronic
922979233 1:229811593-229811615 AAATATGTAGGGAGAGCTGTAGG + Intergenic
1064253682 10:13726497-13726519 CTGCCTGTATGCAGAGCAGTGGG + Intronic
1066700746 10:38125494-38125516 CTGCATGGAGGGAGAGGAGATGG + Exonic
1067878086 10:50021712-50021734 CTGAGTGTTGGGAGAGCAGTGGG + Intergenic
1069389399 10:67917179-67917201 CAATATGTGGGGAGAGCACTCGG + Exonic
1070969162 10:80549416-80549438 CTGTATGGAGGCAGAACAGGAGG - Intronic
1072602871 10:96947013-96947035 ATTTATGTAGGGAGAAAAGTGGG + Intronic
1073349944 10:102812648-102812670 CTGTATGGTGGGGGAGGAGTTGG - Exonic
1073997036 10:109327386-109327408 TTGTATTTAGGGAGAGGAGGAGG - Intergenic
1074211285 10:111337623-111337645 CTGTATGTATGTGGGGCAGTAGG + Intergenic
1074365521 10:112854750-112854772 CAGTATGTAGGGAGAGCAATCGG + Intergenic
1076169050 10:128304915-128304937 CTGGGTGTAGGGAGAGCTATGGG - Intergenic
1076602000 10:131663321-131663343 CAGACTGTGGGGAGAGCAGTGGG - Intergenic
1077080423 11:722448-722470 CGGCATCTCGGGAGAGCAGTGGG - Exonic
1078657977 11:13260218-13260240 CTGCATGGAGGGAGAGCAGCAGG + Intergenic
1082651419 11:55798630-55798652 ATGTAAGTGGGTAGAGCAGTGGG + Intergenic
1082941562 11:58710516-58710538 GTGAATGCAGGGAGAGAAGTTGG + Intronic
1085345782 11:75767518-75767540 CTGTAGGTCAGGAGGGCAGTGGG - Intronic
1085988767 11:81814176-81814198 CTGAAGGGAGGGAGAGCATTAGG + Intergenic
1088888795 11:114028824-114028846 CTGGATGTAAGGAGGACAGTGGG - Intergenic
1091449306 12:562592-562614 CTGGAGGCAGGGAGAGGAGTGGG + Exonic
1091810315 12:3391466-3391488 CTGTGTGTGGGACGAGCAGTGGG + Intronic
1091916293 12:4273536-4273558 CTGGATGGAGGGAGAGGGGTGGG + Intergenic
1092313096 12:7379841-7379863 CTGTATGTGAGAAGAGGAGTAGG + Intronic
1095714085 12:45322610-45322632 CTGGATGCAAGGAGACCAGTGGG + Intronic
1100071635 12:90727534-90727556 CTGTAGGGAGGGATAGCATTAGG - Intergenic
1100891487 12:99131159-99131181 CTGGATGTTGGGAGAGCAGGTGG - Intronic
1103660006 12:122506636-122506658 GTGTGTGTAGGGAGGACAGTGGG + Intronic
1104101146 12:125611474-125611496 CTGTCTGAAGGTAGAGCATTAGG + Intronic
1104880182 12:132065291-132065313 CTGTAGGCAGGGAGAGCATTTGG + Intronic
1105065503 12:133193865-133193887 TGGTATGTAGGTGGAGCAGTGGG - Intronic
1107085916 13:36427931-36427953 ATGTATAAAGGGGGAGCAGTTGG - Intergenic
1107097191 13:36549673-36549695 CTGTTTGTAGGGAGAGGGGATGG - Intergenic
1108241993 13:48474593-48474615 ATGTATGGAAGGAGACCAGTAGG - Intronic
1108383277 13:49874657-49874679 CTTTCTGTAGGGGGAGCAGCAGG + Intergenic
1109611013 13:64764595-64764617 CTGCATGTATTGAGAGCAGAGGG - Intergenic
1111708874 13:91785884-91785906 GTGGAAGTAGGGAGAGTAGTTGG - Intronic
1112676267 13:101705690-101705712 CTGAATGGAGGGGGAGCAGATGG + Intronic
1112727311 13:102319352-102319374 CTGTATCTAAGCAGAGCAGGGGG - Intronic
1115047705 14:29016798-29016820 CTTTATTTAGGGAGAACACTTGG + Intergenic
1118012970 14:61628800-61628822 CTGAGTGTAGGGAGTGCACTGGG - Intronic
1119651302 14:76385647-76385669 CGGGATGGTGGGAGAGCAGTGGG - Intronic
1121732117 14:96194271-96194293 CTGCATGCAGGGAGGGCAGAAGG + Intergenic
1121885388 14:97538294-97538316 CTGTGTGAGGGGAGAGGAGTAGG + Intergenic
1123430753 15:20214030-20214052 CTGTATGTAGGGAGAAAATTGGG - Intergenic
1124833962 15:33177514-33177536 CTGTAAGTAGGGAGAACAAAAGG - Intronic
1124945615 15:34262744-34262766 CTGTATGTAGGGATTGCTGCTGG - Intronic
1124984321 15:34591501-34591523 GTGGAAGTAGGGAGAGCGGTTGG - Intergenic
1124991323 15:34676890-34676912 CAGTGTGGTGGGAGAGCAGTGGG + Intergenic
1126955330 15:53927338-53927360 CTGTAGGCAAGGAGAACAGTTGG + Intergenic
1128567679 15:68711922-68711944 CTGGAGGTAGGGGGTGCAGTGGG - Intronic
1129897097 15:79116534-79116556 ATGAATTTAGGGAGAACAGTGGG + Intergenic
1132852321 16:2030347-2030369 TTGTATCTAGGGGGAGGAGTGGG - Intronic
1135463538 16:22665553-22665575 CTGTATGTAGGGAGACCATGAGG - Intergenic
1136853890 16:33637188-33637210 CTGTACGTAGGGAGAAAATTGGG + Intergenic
1138557598 16:57781573-57781595 TTGTATTTACTGAGAGCAGTTGG - Intronic
1138673453 16:58633746-58633768 TTGTCTGTAGGGAGAGGAGTGGG + Intergenic
1141845711 16:86607529-86607551 CTGTGTGTTGGGAGAGAAGGGGG - Intergenic
1145101503 17:20081274-20081296 CTGTATCTAGGCACTGCAGTAGG - Intronic
1145102572 17:20089099-20089121 CGGTGTGTAAGGGGAGCAGTAGG + Intronic
1145931636 17:28690158-28690180 CTCTGTGTTGGGAGAGCGGTAGG - Exonic
1149771871 17:59328828-59328850 CTGGAAGCAGGGAGATCAGTTGG + Intergenic
1152266016 17:79295361-79295383 CGTTTTGTAGGGAGAGCAGGAGG + Intronic
1156590005 18:38476096-38476118 CTGTATGGAGGTAGAGAAGATGG + Intergenic
1157206959 18:45708992-45709014 CTTTCTGTGGGGTGAGCAGTAGG - Intergenic
1157566041 18:48679965-48679987 CTGTATGTAGGGAGAGCAGTTGG + Intronic
1158390266 18:57039263-57039285 CTGGATGTTGGTGGAGCAGTTGG + Intergenic
1158452199 18:57576858-57576880 CTGTCTGGAGGGAGAGGAGATGG - Intronic
1159005755 18:63008897-63008919 CTGTGTGTAGGGAGAAGAGAGGG - Intergenic
1159742101 18:72184742-72184764 GTGGATGGAGGAAGAGCAGTTGG - Intergenic
1160118934 18:76109597-76109619 CTGTATTTAGTGAGAGAAATAGG + Intergenic
1160335842 18:78038493-78038515 CTGGATGTAGAGAGAAAAGTGGG + Intergenic
1163571790 19:18086687-18086709 GTGTATGTGTGGAGAGCTGTGGG - Intronic
1163680051 19:18676054-18676076 CTGGATGTAGGGAGGTCAATGGG + Intergenic
1166049000 19:40247000-40247022 CTTTCTGTAGGGTGGGCAGTGGG - Intronic
925074065 2:997452-997474 CTGTCTGTGGTGAGAGCAATTGG + Intronic
925217319 2:2108348-2108370 CTGTATGAAGGGTAAGCTGTGGG - Intronic
927541768 2:23918511-23918533 CAGTGTGTAGGGAGAGGAGCAGG - Intronic
928200854 2:29246814-29246836 CTGGAGGTGGGGAGAGCAGTTGG - Intronic
930640550 2:53850349-53850371 CTGTATTTGGGGAGAGCTGAGGG + Intergenic
933479436 2:82836968-82836990 TTTTATATAGGGAGAGAAGTGGG + Intergenic
933656645 2:84894143-84894165 CAGTATACAGGGAGAGCAGAAGG + Intronic
934163476 2:89273648-89273670 CTGTATGTATGAAGTGCAATAGG + Intergenic
934203798 2:89908876-89908898 CTGTATGTATGAAGTGCAATAGG - Intergenic
937593831 2:123648662-123648684 CTATAGGTAGGAAGAGCAGATGG + Intergenic
940039920 2:149349328-149349350 CTGTAGGTACAGAGAGAAGTAGG + Intronic
941860299 2:170272383-170272405 CTGGAAGTAGGGAGACCAGCTGG - Intronic
941871202 2:170387705-170387727 CTGTTTTTAGGGAAAGCATTTGG + Intronic
943709124 2:191070546-191070568 CTGAATCTAGGAAGTGCAGTGGG - Intronic
944068048 2:195639859-195639881 CTGTAAGTATTAAGAGCAGTTGG - Intronic
945311200 2:208315690-208315712 CTGTTTGGAGGAAAAGCAGTGGG + Intronic
945406200 2:209451728-209451750 GTGTATGTAGGCACAGCTGTAGG + Intronic
946153585 2:217792610-217792632 GTGTTTGTAGTTAGAGCAGTGGG - Intergenic
946928970 2:224654321-224654343 CTGAATGGAGGGAGACAAGTAGG - Intergenic
946978121 2:225175751-225175773 CTGTAAGTAGGGAAGGTAGTAGG + Intergenic
1169900109 20:10544227-10544249 CTGGATGAAGGGAGAGCCTTAGG - Intronic
1171238903 20:23549398-23549420 CTGTGTGTAGTGGGAGCACTGGG - Intergenic
1173663477 20:44750108-44750130 CTCTATGCAGGGAGAGCGGAGGG - Exonic
1175593402 20:60211809-60211831 CACTGTGTTGGGAGAGCAGTGGG + Intergenic
1175738969 20:61407054-61407076 CTGTATCCAGGCAGAGCAGATGG - Intronic
1182977637 22:34638226-34638248 CTGTAGGTGGGGAGTGCAGAGGG - Intergenic
1183374835 22:37457170-37457192 TTCTTTGTAGGGAGAGGAGTGGG - Intergenic
1183390027 22:37540424-37540446 CTGTGTGTTTGGAGAGCAGTGGG - Intergenic
1184982754 22:48105832-48105854 CTGAAAGCAGGGAGAGCAGAGGG - Intergenic
950500681 3:13361677-13361699 CTGTTTGAAGGGAGAGTAGATGG - Intronic
952019053 3:28994930-28994952 CTGGTTGTGGGGAGAGGAGTGGG + Intergenic
954136533 3:48584557-48584579 CTGTAAGGACAGAGAGCAGTGGG + Intronic
954159000 3:48706512-48706534 CTGTCTGTAGAGAGAACAGAAGG - Intronic
954946133 3:54425811-54425833 CTGTTAGAAGGCAGAGCAGTGGG - Intronic
955856196 3:63276695-63276717 CTGCATGTAGGAAGAGCAGTAGG + Intronic
958151014 3:89695536-89695558 CTGTGTGTAGGGAGAGGGGCAGG - Intergenic
960268377 3:115647564-115647586 CAGTATGAAGGGAGAGTAGAAGG + Intronic
961398967 3:126620810-126620832 ATGTGTGTAGGCAGAGTAGTTGG - Intronic
961406632 3:126684325-126684347 CTGGATGGAGGGAGAGCAGGTGG + Intergenic
963606004 3:147412054-147412076 GTGTATGTAGGGAGTGGGGTGGG + Intronic
964310964 3:155391897-155391919 CTGCATGCAGGGAGTGAAGTAGG - Intronic
964608068 3:158580144-158580166 GTGGAAGTAGGGAGAGCATTAGG + Intronic
968647806 4:1749010-1749032 CGGTGGGGAGGGAGAGCAGTGGG - Intergenic
968752054 4:2395444-2395466 CTGTGTGTGGGGAGAGCGTTGGG - Intronic
968958945 4:3733143-3733165 CTGTATGTACAGCGAACAGTGGG + Intergenic
969042395 4:4309508-4309530 CTGTCTTTGGGGAGAGGAGTAGG + Intronic
969961878 4:10952731-10952753 CAGAATGTAAGGTGAGCAGTGGG + Intergenic
970661156 4:18287373-18287395 CTTTAGGTAGGGGAAGCAGTGGG + Intergenic
973191758 4:47393462-47393484 TTGAGTGTAGGGAGAGCTGTAGG - Intronic
973738492 4:53896366-53896388 CTGTAAATAGGGATAACAGTAGG - Intronic
980133537 4:128838804-128838826 CTGGCTGTAGGGAGAGGTGTTGG + Intronic
985070777 4:186164884-186164906 CCATGTGTAGGGAGAGCAATTGG - Intronic
986696775 5:10364196-10364218 TTGTAAGGAGGTAGAGCAGTTGG + Intronic
989161958 5:38399665-38399687 CTGTAGGCAGGGAAAGCGGTTGG + Intronic
990305770 5:54492937-54492959 CTGTCTGTGGGGTGAGCAGAAGG - Intergenic
991047986 5:62242993-62243015 CTGTACGTAGGGAGAAAATTGGG - Intergenic
992649125 5:78840145-78840167 ATGTATGTAGGGAGCACAATAGG + Intronic
993436707 5:87904743-87904765 CAGTAAGTAAGGAGATCAGTTGG + Intergenic
996790871 5:127291381-127291403 CTGGATGTAGGGAGATTTGTGGG + Intronic
997235500 5:132269937-132269959 TTGTATGTAGGGAGATTGGTAGG + Intronic
997365705 5:133323962-133323984 CTGTGTGAAGGGAGTGCAGTGGG - Intronic
997587096 5:135049872-135049894 GTGTCTGTCAGGAGAGCAGTGGG + Intronic
998152694 5:139766060-139766082 CTGGATGAAGGGAGAACATTGGG + Intergenic
998729923 5:145062923-145062945 CTGTGTGTGGGGAGGGCAGTGGG + Intergenic
999076320 5:148799127-148799149 CTGTCTGTAGGGAGAGCTCAAGG + Intergenic
1000811372 5:165865890-165865912 TTGTATGTAGGCAGAGGAGGGGG - Intergenic
1001277142 5:170359218-170359240 CTGTAAGAAGGGAGAGCCATGGG - Intronic
1004331802 6:14728693-14728715 CTGTATGTGGGCAGAGAAGGAGG + Intergenic
1004735933 6:18406494-18406516 GTGTGTGTAGGGGGAGTAGTAGG + Intronic
1004963559 6:20821103-20821125 GTGTTTGGAGGGAGAGCGGTAGG + Intronic
1006442712 6:34062079-34062101 GTGTATGTTGGGAGAGTGGTGGG - Intronic
1009481372 6:64162049-64162071 CTGCATGTAGGTAGAGCAAGAGG - Intronic
1011848832 6:91600933-91600955 CCATCTGTAGGGAGAGGAGTGGG + Intergenic
1014666887 6:124249383-124249405 CTGTTTTTAGGGAGAGCTATGGG + Intronic
1014778553 6:125537678-125537700 CTGCTTTTAGGGACAGCAGTAGG + Intergenic
1016071490 6:139744533-139744555 CAGTATAAAGGGAGATCAGTAGG - Intergenic
1016979915 6:149844439-149844461 GTGAATGTTGGGAGAGCAGAGGG - Intronic
1017444135 6:154492204-154492226 CAGTATGTAGGAAGAGGAATAGG - Intronic
1019808849 7:3149500-3149522 ATGTGTGTTGGGAGAGCAATGGG - Intronic
1020410478 7:7886697-7886719 CTGGATGTAGGGAGATCAGTTGG - Intronic
1022396472 7:29991470-29991492 GTGTGGGTAGGGAGAGCATTAGG + Intergenic
1022901267 7:34812662-34812684 CTGATTGTGGGCAGAGCAGTAGG - Intronic
1025985843 7:66451000-66451022 CTGAATGTAGCCAGAGCACTGGG + Intergenic
1026002700 7:66574297-66574319 CTGAATGTAGCCAGAGCACTGGG + Intergenic
1026029157 7:66774502-66774524 CTGAATGTAGCCAGAGCACTGGG - Intronic
1027128850 7:75576385-75576407 CTGTATGTTGGGATGTCAGTGGG + Intronic
1029337399 7:99914151-99914173 CTGTAAGTAGGGAGGGCAGTCGG - Intronic
1030266657 7:107628875-107628897 CTGTATGCTGGGGGAGGAGTTGG - Intronic
1031975442 7:128090661-128090683 CTGGGAGAAGGGAGAGCAGTGGG - Intronic
1035471740 7:159114336-159114358 CTGTCTGTTTGGAAAGCAGTGGG + Intronic
1036607696 8:10322292-10322314 CTGGATGCAGGGAGATGAGTTGG + Intronic
1037703144 8:21293490-21293512 TTGTATGAAGGTAGCGCAGTAGG - Intergenic
1041171478 8:55146841-55146863 CTGTATCAAGGGACAGCAGAAGG - Intronic
1042054487 8:64749487-64749509 CTGGACTGAGGGAGAGCAGTGGG + Intronic
1044488527 8:92783381-92783403 CTGTGTGTAAGGAGAGCTGACGG + Intergenic
1045662706 8:104454555-104454577 CTGTATGTAGTGAAGGGAGTGGG + Intronic
1045966850 8:108034925-108034947 CAGTATTTAGGGAAAACAGTTGG - Intronic
1046380245 8:113440415-113440437 CTATATGTAGGAAGATCAATAGG - Intergenic
1046652871 8:116858140-116858162 TTGCATATAGGGAGAGAAGTAGG + Intronic
1046780401 8:118208900-118208922 CTGTATGTAGGGAGGGCTCAAGG + Intronic
1047197987 8:122738888-122738910 CTGTCTGAAGGGAGAGAAATTGG - Intergenic
1047801625 8:128316078-128316100 CTGGAGGTAAGGAGAGCAGGAGG + Intergenic
1049159373 8:141087506-141087528 GTGAATGTGGGGAGAGCAGTCGG + Intergenic
1053052684 9:34975028-34975050 CTGGAGGTGTGGAGAGCAGTTGG - Intronic
1053200245 9:36147320-36147342 CTGGACCTAGGGAGAGCAGAGGG - Intronic
1056592178 9:87972638-87972660 CTGTGGCTATGGAGAGCAGTGGG + Intronic
1058769207 9:108214231-108214253 CTGTATGGAGAGAGAGGACTGGG - Intergenic
1059845353 9:118269552-118269574 CTGTATGTGAGTTGAGCAGTAGG - Intergenic
1060299695 9:122368069-122368091 CTGTAGCTAGGGTGAGCAGGAGG + Intergenic
1189718028 X:43884558-43884580 CTGTATGTGGGGACAACAGGTGG - Intergenic
1191898108 X:66014922-66014944 CTGTATGCCAGGAGAGAAGTTGG + Intergenic
1195704690 X:107730376-107730398 CTGTATGAAGGGAGTTCAGTGGG - Intronic
1195885744 X:109635635-109635657 CCATATGTAAGAAGAGCAGTTGG + Intronic
1196036976 X:111156082-111156104 CTGGATGAAGGGAGACTAGTAGG + Intronic
1198405061 X:136304127-136304149 CTGTAGATATGGAGAGCAGATGG + Exonic
1201367212 Y:13220817-13220839 TTGTATGTAGTGAGAGATGTGGG - Intergenic
1201562195 Y:15329964-15329986 TTGGATGAAGGGAGAGCAGGAGG - Intergenic